1 Comment

Clinical Molecular Genetics

1
An  Overview  of  Clinical  Molecular  Genetics
Rob  Elles
1. Introduction
Clinical  molecular  genetics  has only  recently  become  recognizable  as a
diagnostic  discipline  m  its own  right-gradually  becoming  distinct  from  its
academic-  and research-based origins.  This  chapter  seeks to give  some shape
and  context to  the contrtbutions  that follow  and add  to previously  published
ideas  of  how  diagnostic  laboratories  are  structured  and  evolving  (2,2).  The
chapter largely  draws on the UK  experience of  the field  and does not  claim  to
be authoritative  on  developments  in  North  America,  Europe,  Australasia,  or
other parts of  the world.
2. Clinical  Molecular  Genetics  and  Other  Diagnostic  Disciplines
Diagnosis  of  genetic disease usually  involves  a consideration  of  the mher-
ited nature  of  the condition  and therefore  often  involves  a family  study. This
imposes unique  disciplmes and requirements  on the molecular  diagnostic  labo-
ratory  which  distinguishes  it  from  other  categories of  clinical  laboratory.  The
family  is the unit  of  study m contrast to the individual.  This  will  remain  true
even  when  mutation  screening takes over  from  linkage  analysis.
Furthermore,  inheritance  across generations and horizontally  in the extended
kindred  gives  the  information  generated  by  the  genetic  laboratory  a lasting
relevance.  It places on the laboratory  a responsibility  for  long-term  and careful
storage and retrieval  of clinical  information,  For instance this requirement  may
be met by  a report  format  suitable for  long-term  access deposited  in the  indi-
vidual  or the family  file  held by  the genetic  counseling  service.
Similarly,  key samples must be reliably  stored and readily  retrievable.  Such
long-term  sample storage provides  a challenge  in  terms of  space, safety, and
reliability,  and data storage and retrieval  (see Section 7.4.).
From  Methods  in  Molecular  Medrcrne  Molecular  Dlagnosls  of  Genebc  Diseases
Edited  by  R  Elles  Humana  Press  Inc  ,  Totowa,  NJ
I
2  El/es
As well  as this long-term  cycle of  storage and testing, a molecular  genetics
laboratory  also requires the flexibility  to respond to urgent clinical  needs. These
include prenatal  diagnosis (PND)  and carrier  detection tests during  pregnancy.
In  the neonatal period,  cystic fibrosis  (CF)  mutation  screening is an example of
a test which  may be urgently  required  in order  to influence  management of  the
child’s  condition.  In  addition  some presymptomatic  programs  (e.g., Huntmg-
ton’s  disease [HD]),  which  are set in a rigorous  counseling  protocol,  require  a
rapid  results service  (see Section 3.5.).
Both of  these disciplines of  urgent and long-term  testing require  clear lines of
commumcation with  clinicians and the clinical  genetics infrastructure. For  PND,
one key individual  who can coordinate the patient and the family  doctor, obstetric,
genetic counseling,  and laboratory  services is important  for  their  smooth pro-
vision  A second example is the existence of  a reliable  mechanism for  the clmi-
cal service  and the laboratory to coordinate and prioritize testing within  a family
and ensure the availability  of key samples required in a linkage or carrier detection
study. This may be achieved by a regular meeting between individual  counselors/
clinicians and the laboratory scientist responsible for  a particular diagnostic area.
The  establishment of  voluntary  family  registers m the United  Kingdom  has
provided  a structure which  lends itself  to the long-term  continuity  of  contact
required  for effective  counseling and carrier and presymptomatic  testing within
the extended family  (see Chapter  11). A geographical  area-based structure  for
genetic services  serving  populations  of  14  million  prevents  duplicated  provi-
sion of services and gives an effective  catchment size for genetic diseases all of
which  are relatively  rare.
However,  diagnostic  testing  at a distance is  quite  possible  as long  as the
requirements  and  limitations  of  testing  are  appreciated.  The  referring  clmi-
clans must understand  that there may be a requirement  for  a correct diagnosis
in an index  case, for  key specimens, the need to establish informativeness,  the
error  rates inherent  in  the test, and the lag time  in some procedures  (mutation
screening for  example). The  laboratory  must be aware of  the degree of urgency
in a particular  case and be realistic  about quoting  turnaround  times for  the test.
The  widespread  implications  of  genetic testing  also impose  a requirement
for  a reference  point  to the social and ethical considerations connected with  the
generation  of this type of  data. Practically  this means a close working  relation-
ship  between  the  laboratory  and  the  clinic-usually  clinical  geneticists  and
nonclinical  counselors.
3.  Categories  of  Test
Clinical  molecular  genetics testing falls  into  five  main  categories. The  mix
of  cases within  these categories  will  to  some  extent  define  the  resources
required  in the laboratory  and the characteristics of  the laboratory.
Overview  of  Molecular  Genetics  3
3. I.  Differential  Diagnostic  Testing
This  category includes differential  diagnosis for  the X-linked  muscular  dys-
trophies  and for  some of  the neurological  disorders  where  neurological  symp-
toms  exist  for  example  to  differentiate  HD  from  other  rare  conditions,  to
confirm  or exclude  Fragile  X  (FraX)  disease as a cause of  mental  retardation,
and to clarify  a diagnosis  or  suspicion  of  CF  or  Angelman/Prader  Willi  syn-
drome. A  feature  of  these molecular  tests is that they are often  highly  specific
but not highly  sensitive.  For  example failure  to detect a deletion  in Duchenne
or  Becker  muscular  dystrophy  (DMD/BMD)  does not  exclude  the diagnosis
because a high proportion  of  these remaining  cases may be the result of a point
mutation.
3.2.  Carrier  Detection  Within  Families
These tests are relevant  for  instance where  an index case exists for  congeni-
tal adrenal  hyperplasia  owing  to 2 1 -hydroxylase  deficiency  and carrier  detec-
tion  is required  for  a sibling  or close blood  relative.  Molecular  genetic testing
is a powerful  tool  for  this kind  of  diagnosis and may be the only  method  suit-
able  for  deriving  carrrer  information,  Linkage-based  carrier  testing  in  DMD
may involve  introducing  risks derived  from  biochemical  and pedigree  data and
the complex  calculations  require  skills in using and interpreting  the computer-
based statistical packages available  for  this type of  analysis (see Chapter  8).
3.3.  Carrier  Detection  Within  Populations
Molecular  testing for  autosomal recessive diseases may not be the most effi-
cient  way  of  carrier  testing  in  populations-for  hemoglobinopathies  for
instance. However  in some cases like CF, it is the only method available  and may
be sufficiently  efricient  to be effective  (see Chapter 5 for  methods). Molecular
genetics laboratories  set up to handle this type of  program  must be capable of
handling  relatively  large  numbers  of  cases and have  the  sample processing,
testing, and reporting  systems appropriate  for  the task. The  limitations  on this
kind  of program  are based on social acceptability,  the existence of  an adequate
counseling  service,  and cost effectiveness  in detecting heterozygotes couples.
3.4.  PND
A  demand  for  PND  from  parents is usually  apparent  for  severe  childhood
onset diseases where  there is a poor  prognosis and no effective  treatment. The
demand on the molecular  genetics laboratory  IS to cope with  an urgent  test in
pregnancy  in  a situation  where  the test may be complex. The answer is to have
a close collaboration  with  the  clinicians  ideally  to  gather  the required  speci-
mens from  the index  case and from  family  members prior  to  the requirement
4  El/es
for  PND.  The  laboratory  then has the opportunity  to ascertain in  advance  the
tests required  (i.e., to make the family  informative  for  a linkage-based  test or to
define  the genetic mutations  involved).  The  prenatal  test can then proceed m a
more  controlled  fashion  with  a faster and more predictable  turnaround  time.
3.5.  Presympfomafic  Diagnosis
Presymptomatic  diagnosis  for  adult  onset disorders  also requires  a  close
liaison  between  the laboratory  and the referring  clinicians.  Counselmg  proto-
cols may place the test in  the urgent  category  once a decision  to proceed  has
been  taken by  the patient.  An  example  of  this is HD.  It  is felt  to be of  para-
mount  importance  to  minimize  the  period  of  anxiety  prior  to  receiving  the
result.  The  laboratory  must be m a position  to meet these demands (3).  Other
tests may require  extensive effort  before  a test can be offered  to the family,  for
mstance m familial  adenomatous polyposis coli or familial  breast-ovarian  cancer,
the work  involved  in finding  the mutation is a considerable undertaking.
4.  Introducing  New  Genetic  Tests
The  human genome project  is generating  a huge amount of  data and charac-
terizmg  genes capable of  producing  human disease at an impressive  rate. This
presents an enormous challenge to the molecular  diagnostic laboratory  in terms
of  the possrble choice of  diagnostic areas to resource and develop.  However  a
number  of  constraints and consrderations impose themselves in these choices.
4.1. Disease  Frequency  and  Patient  Demand  for  Testing
The  first  diagnostic tests to be developed  naturally  tended toward  those dis-
eases that are most frequent,  for  instance the hemoglobmopathies-DMD  and
CF. There  is, however,  a relationship  between  the demand for  testing  and the
perceived  individual  burden  of  a disease. This  may  depend  on whether  it  is
treatable or  not, causes mental  or physical  handicap,  its age of  onset, average
impairment  of  function,  and loss of  life  years and life  quality.  Hemophilia  A,
although  as prevalent  as DMD,  does not present a large  demand for  molecular
carrier  detection  or  prenatal  diagnosis  at  least to  UK  laboratories.  Families
may  consider  that the problem  of  HIV  contamination  of  factor  VIII  has been
controlled  and the disease is treatable  and does not warrant  PND.
4.2.  Resource/Benefit  Trade  Off
Given  current  technologies,  the choice of  a diagnostic  area may be dictated
by  the  available  resources m  the laboratory.  For  instance, hydrocephalus  is
perceived  to  be  a  serious  condition  with  a considerable  patient  demand  for
carrier testing and PND.  However,  the offer  of a service is tempered by the low
detection  rate of  mutations  m the L 1 CAM  gene owing  to possible genetic het-
Overview  of  Molecular  Genetics  5
Table  1
Comparison  of  Mutation  Detection  Services  for  CF  and  Hydrocephalus
Gene
screened
Number
of exonic
fragments
to screen
Mutations
detected by SSCP/
heteroduplex
analysis (%)
cost/
Estimated  mutation
turnaround  Estimated  found
ttme  (wk)  cost (LJS$)  ww
CFTR  20  9ga  32  1100  1122
LICAM  27  lgb  32  1475  8194
5creenmg  of 20 exonlc fragments detects approx 98% of mutations  in UK  populations
bDetectlon rate m the cases referred  (S. Ramsden, personal commumcatlon)
erogeneity,  phenocopies,  and the laborious nature of screens given  current strat-
egies. These tests may involve  a single-stranded  conformatlonal  polymorphism
(SSCP)/heteroduplex  analysis  or  denaturing  gradient  gel  electrophoresis
(DGGE)  prescreen  followed  by  sequencing  and  development  of  a mutation-
specific  assay. Laboratories  may attempt to alter  the resource/benefit  ratio  by
selecting the diagnostic  criteria  acceptable for  a referral  to be accepted. In  the
case of hydrocephalus,  perhaps referrals  by limiting  to clear X-linked  familial
cases. In  contrast,  rare  mutation  screening  for  CF  provides  a high  detection
rate (>95%)  and the demand for  testing is high.  Typical  referrals  are the result
of  equivocal  diagnosis of  CF or for  carrier  screening where  only  one mutation
segregating  in a family  is recognized. The cost per mutation  detected is much
less for  CF than for  LlCAM  (Table  l),  although the cost of detection should be
divided  by the average  number  of  persons who  will  take up and benefit  from
the  test. Without  doubt  the  resource/benefit  equation  will  alter  rapidly  as
new  technologies  to find  unknown  and uncommon  mutations  in  genes come
on-stream  in the future.
4.3.  Technical  Difficulty
Other criteria  which  may be considered are the degree of technical  difficulty
involved  in an analysis and the current level  of sophistication  of  the laboratory.
For  example,  strategies of  analysis involving  RNA  as the analytical  material
may not  be tenable. In  the same way,  linkage-based  risk  analysis using  com-
puter  programs  may not be an expertise available  in the laboratory.
4.4.  Clinical  Limitations
Other  problems  may  be exterior  to the  laboratory.  For  instance, it  may be
difficult  to  set up  a  linkage-based  service  for  a familial  cancer like  neuro-
fibromatosis  type 2 (bilateral  meningioma)  where  early  death may mean that
families  are frequently  fragmented  and  the key  samples are  simply  unavail-
6  El/es
able. Similarly,  if the clinical  infrastructure  to collect key specimens and clini-
cal diagnostic  and pedigree  information  is not available,  then providing  a ser-
vice  IS difficult.  Thus, the choice of  a laboratory  service may be closely tied to
local  clinical  expertise, Interests, and resources.
4.5.  Rare  Disorders  Versus  Population  Screening
Climcal  molecular  genetics laboratories  began by  being  mostly  concerned
with  diagnosis of relatively  rare disorders m an index case and in carrier testing
within  the immediate  family-persons  at high  prior  risk  of  carrying  and per-
haps expressing  the  disease gene in  question.  The  possibility  now  exists for
genetic diagnosis  among the general population  at relatively  low  prior  risk  of
carrier  status in  relevant  recessrves and of  genetic  susceptibility  to  common
diseases. Chapters 5, 16, and 19 discuss techniques relevant  to populatton-based
screens in  CF  and cardiovascular  disease. These programs  have  not yet taken
hold  on a large  scale. However  if  they do, they will  signal a profound  shift  m
the scale and organization  of  the clinical  molecular  genetics laboratories  that
undertake  them and indeed of  the services required  to counsel those screened.
Laboratory  and clinical  genetic  services are faced with  the choice of  entermg
these areas which  will  greatly  change the nature and emphasis of  their  work.
5.  Services  for  Rarer  Disorders
Limited  demand because of the rarity  of a disorder  limits efficiency  by slow-
ing  the development  of  expertise  and by not  allowing  batch efficiencies  in  a
reasonable  turnaround  time.  One  answer  to  this  problem  is  to  widen  the
catchment  population  for  a service  speciality.  In  the  United  Kingdom,  most
laboratories  serving  a National  Health  Service  (NHS)  Region  of  14  million
people provide  core services for  CF, DMD,  FraX,  and HD,  but only  one or two
laboratories  specialize m rarer  disorders  such as mitochondrial  myopathies  or
a- 1 antitrypsin  deficiency.  These more specialized services may develop  m the
public  sector by the adoption  of formal  or informal  arrangements between cen-
ters to promote  sample flows.
6.  Relationship  Between  Research  and  Diagnostic  Service
Molecular  diagnostics has a short transfer time  from  the research laboratory
to the service laboratory  (largely  because new diagnoses are usually  new appli-
cations of  a generic DNA-based  technology).  This transfer  time may mvolve  a
validation  period  of  only  a few  weeks from  the publication  of  a characterized
gene to the new  diagnostic  test-the  trinucleottde  repeat expansion  mutation
in HD  is a case in point.  It  is not surprising  that there  is often  a close relation-
ship between  university  academic research teams and diagnostic  facilities.  In
many  examples research groups take on the initial  cohort  of  diagnostic  cases.
Overview  of  Molecular  Genetics  7
These studies form  an integral  part  of  the  search for  or  characterization  of  a
gene,  the  spectrum  of  pathological  mutations  within  it,  and  the  range  of
expressed phenotypes. However,  for  a variety  of reasons, such as the ending  of
research potential,  increasing demand, changmg interests, or medico-legal  con-
siderations, research laboratories  invariably  and quite properly  wish  to pass on
diagnostic  work  to  diagnostic  facilities.  Physical  and  organizational  links
between  the research and diagnostic  laboratories  are then of  enormous  benefit
in  facilitating  this transfer  of  technology  and application.  Similarly,  the diag-
nostic service  may be of  benefit  to the research effort  in providing  mfrastruc-
ture  facilities,  a continuity  of  expertise  in  the  technology,  a  resource  for
laboratory  quality,  and access to a DNA  sample bank and its associated clinical
information.
The  initial  application  of  a new  diagnosis is usually  itself  of  research inter-
est and it  is in  this level  of  development  that the diagnostic  laboratory  is most
active.  In  the public  sector the controllers  or purchasers of  health care may be
quite  rigorous  in their  approach to this kind  of  research. They  may require  or
commission  it as an evaluation  to determine  whether  outcomes in terms of  the
costs and benefits  to  the persons tested are  suffictently  great  to  allow  addi-
tional  resources for  a new  service  development  (46).
7.  Space  Requirements
for  the  Clinical  Molecular  Genetics  Laboratory
The  technological  base of  clinical  molecular  genetics has yet to  stabilize
making  it  difficult  to  make  statements on  specialized  facilities  that  will  be
required  in the future.  However,  the current  situation  can be outlined  together
with  an idea on whether  the requirements  will  diminish  or  grow.
7.1.  Specialized  Facilities  for  Specimen  Handling
Handling  facilities  are required  to receive  and process specimens (mostly
blood,  but  also prenatal  samples, solid  tissues, and mouthwashes).  The  space
must take account of the biohazard associated with  these specimens. This  haz-
ard  is generally  a population  frequency  risk  of  HIV  and hepatitis  B,  unless
certain  high-risk  groups are being  routinely  dealt with.
Specimen preparation  requires centrifugation  facilities  and may involve  han-
dling  hazardous chemicals (phenol  and chloroform)  depending  on the chemis-
try  chosen. Parts of  the process may be dealt with  by automated equipment.
The  clinical  and data processing involved  in  sample handling  must not be
overlooked  and access is required  to  the laboratory  database via  a computer
terminal,  and sufficient  space must be provided  for  a clean and dry area within
the sample preparation  room  separated from  the actual sample handling  facil-
ity  for  efficient  clerical  procedures to be carried  out.
8  El/es
A laboratory  serving  a population  of 4 million  people may expect to receive
60-70  samples/wk, but this obviously  will  depend heavily  on the clinical  mfra-
structure available,  the mix  of  disease categories offered  as a laboratory  ser-
vice,  and whether  a population  screening program  is being offered.  The  ideal is
for  a separate room to be provided  for  sample handling  to give  a physical  sepa-
ration  of  the biological  and chemical hazards involved  from  other  laboratory
actrvrties,  to  provide  a clear  barrier  to  contamination  by  polymerase  chain
reaction  (PCR)  products, and to provide  an efficient  environment  for  the cleri-
cal procedures  required.
7.2.  General  Operations
Adequate  space is required  for  general  operations  including  PCR,  poly-
acrylamide  and agarose gel electrophoresis,  restriction  enzyme digestion,  cen-
trifugation,  Southern blotting,  silver  staining,  and chemiluminescent  imaging
techniques. Specialized areas required  for  these activities  include  containment
for  chemical  hazards and a clean area for  setting up PCRs.
7.3.  Radioisotopes
Although  the trend  has been  away  from  radioisotope  techniques  in  recent
years, the  use of  32P and  33P and  35S is still  required  for  Southern  blotting,
certain  fragment  sizing  techniques,  and  the  Protein  Truncation  Test.  These
techniques are still  standard for  instance in sizing FraX  and myotonic  dystro-
phy  alleles  and m  sequencmg. The  ideal  is a separate room  for  radiorsotope
handling  requiring  fume extract, sealed floors,  nonabsorbent working  surfaces,
and so on to meet national  and local  isotope handling  regulations.
7.4.  Storage
The  accumulation  of  an archived  bank of  DNA  specimens is an inevitable
consequence of  setting up  a clinical  molecular  genetics service  and  thought
needs to be given  to  suitable  storage facilities.  DNA  is inherently  stable and
very  low  temperatures are not required. However,  a storage temperature of -20°C
or below  is recommended.  A DNA  bank  of  25,000  specimens stored in  2-nL
cryotubes racked m vertical  towers in a chest freezer occupies approx  0.5 m3 of
freezer space. This  space should be doubled  if  a pohcy  of  splitting  samples for
safety  from  tire,  security,  or  other  incident  is  adopted.  The  duplicate  bank
should  be  in  a  separate part  of  the building  for  extra  protection  against  the
possibility of serious mishap (7). A bank serving 4 million  people can be expected
to grow  at a rate of up to 2500-3500  samples/yr (5000-7000  including  dupli-
cates). Account  must be taken of  the heat generated from  freezers in planning
storage space.
Overview  of Molecular  Genetics  9
7.5.  Imaging
Radioisotope  imaging  requires  specialized  instrumentation  or  standard
autoradiography.  Autoradiography  requires  access to  a -70°C  freezer  and
facilities  for  developing  standard X-ray  films.  In  addition,  ethidium  bromide
stained  gels  must be visualized  and  recorded  under  UV  illumination.  These
operations  require  constant  access to  a darkroom  which  is  standard  to  a
molecular  genetics laboratory.
7.6.  lnsfrumentation
Recently,  more  automated  instrumentation  has  become  important  in
molecular  genetics. Fluorescent  labeling  techniques  coupled  with  automated
detection  allow  analysis  of  sequencing  gels  and  fragment  analysis  for
microsatellites,  SSCP, and similar  techniques.  Space needs to be allowed  for
this type of  instrumentation  and associated computer  and printmg  equipment.
7.7.  Microbiology
PCR  has largely  taken  over  from  the  use of  recombinant  DNA  probes  in
clinical  molecular  genetics. However,  facilities  to propagate plasmid  or cosmid
DNA  in  bacteria are required  for  some techniques including  analysis of  FraX
disease, myotonic  dystrophy, and Angelmann/Prader  Willi  syndromes and for
fluorescent  in  situ  hybridization  studies. The  alternative  may  be to purchase
these materials  commercially.  These facilities  may be available  m association
with  academic research programs  involved  in cloning  and screening for  DNA
sequences from  libraries.  Otherwise  these facilities  will  have  to be provided.
The  space will  need to account for  national  and local regulations  covering  the
handling  of  genetically  manipulated  organisms.  Generally  these operations
require  precautions  appropriate  to the lowest  level  of  containment  consistent
with  good  microbiological  practice  and  will  not  require  negative  pressure
rooms, extraordinary  equipment,  or room  fixtures.  Nevertheless  the ideal situ-
ation  is a separate laboratory  devoted  to microbiological  work.
7.8.  Other  Space  Requirements
The  clinical  molecular  genetics laboratory  also requires  access to adequate
office,  information,  and communication  facilities  and preparation,  autoclave,
and storage areas.
8.  Equipment  and  Choices  of  Technology
The technology  in molecular  genetics is shifting,  but a number  of  key tech-
nologies  will  be important  in  the next 5 yr and these may be borne  in mind  in
the choices of  capital  equipment  purchased and in  setting up techniques.  The
technologies  which  are likely  to become more  important  are:
10  Elles
1.  Rapid fluorescent sequencmg and fragment analysis;
2.  Nonradioactive hybridization techniques—imaging systems;
3.  Kit-based diagnostic systems,
4.  Automated sample handling devices;
5.  Information  technologies–access to the Internet;
6  Laboratory databases and reporting systems
9.  Staffing  of  the  Clinical  Molecular  Genetics  Laboratory
The  staffing  of  molecular  diagnostic  laboratories  has reflected  the research
origins  of  the discipline.  In  many cases those first  employed  in diagnostics,  at
least m the United  Kingdom,  came from  a research background  and in the years
following,  graduate  scientists have  largely  been employed.  It  is still  true  that
the nature  of  the work  is relatively  nonroutine  and automation  and kit-based
technologtes  have  yet to make  a major  impact  on  molecular  genetic  testing.
Because of  this, a number  of  characteristics are required  of  the core staff  in  a
laboratory:  an abihty  to innovate  and troubleshoot,  a deep understanding  of  the
technology,  result  interpretation,  data and risk  analysis, and the relationship
between the laboratory  and climcal  genetics. These criteria  dictate that the time
of relatively  skilled and motivated  graduates IS available  to the laboratory  either
directly  running  the diagnostic  service  or  overseeing  its activities.  Academic
scientists may be able to give  this input at least at the beginning  of  the service.
9.1.  Growth  in  Staffing  in  the  United  Kingdom
The  last 8-l  0 yr have  seen a steady growth  in public  sector (NHS)  laborato-
ries in the United Kingdom. Table 2 indicates this growth  and illustrates that most
of  this expansion has been by employing  graduate scientists. The  other  grades
of staff  commonly  found  in this kind  of laboratory  are technical  support work-
ers and short-term  funded  workers  on academic research assistant scales or the
same type of  NHS  scientific  scale as the graduate scientists.
9.2.  Training
In  the  Umted  Kingdom  since  1990,  2-yr  postgraduate  training  programs
accredited  and  controlled  by  the  UK  Clinical  Molecular  Genetics  Society
(CMGS),  have  become available.  This  training  is workplace  based and relies
on the achievement  of  competences. It  should give  the trainee  a wide  experi-
ence of  the main diagnostic  areas and techniques but also includes a theoretical
program  and a research project.  This  is one route  to the main  career grade for
diagnostic  scientists. Specialist career grade training  qualifications  by exami-
nation  are available  to allow  molecular  geneticists to achieve  Membership  of
the  Royal  College  of  Pathologists  (MRCPath).  Postqualification  Continued
Professional  Development  by  attendance at accredited  meetings  or participa-
Overvjew  of Molecular  Genetics  II
Table  2
Growth  in  UK  Staffing  from  1988-19948
Category of staff  1986  1994
Qualified graduate scientists  15  107
Trainee graduate scientists  –  14
Technical/support workers  5  27
Academic-related staff/short-term  18  38
funded graduate staff
%ource  UK  Climcal  Molecular  Genetm  Society (CMGS)  survey
Change (%)
+613

+440
+111
tion  in  approved  relevant  activities  has become  a recent  requirement  for  the
laboratory  scientist. In North  America,  the American  Board  of Medical  Genet-
ics and the Canadian  College  of  Medical  Genetics accredit training  programs
for  clinical  molecular  geneticists (8).
9.3.  Individual  Skills
One characteristic  of  molecular  diagnostics  in recent years has been a con-
stant change  within  the  technology  (Southern  blotting  to  PCR)  and  in  the
method  of diagnosis (linkage  to direct mutation  analysis). This  shifting  ground
has dictated  that  staff  retain  a contact with  the research base and  develop  an
individual  expertise in a diagnostic area. For the diagnostic laboratory  this may
have  the strength  of  allowing  up-to-the  minute  research developments  to be
quickly  brought  into  service  and for  building  quality  into tests. The  weakness
is that this expertise  may be embodied  in  one person who  may move  on  and
damage the overall  capability  of  what  remain  relatively  small  laboratories  in
most cases. This  problem  of  overspecialization  can be overcome  by  deliber-
ately spreading responsibilities  as laboratories  expand. It also will  diminish  as
techniques  become  more  standardized, automated,  and  kit-based,  and  some
work  in the laboratory  becomes relatively  deskilled  from  graduate  scientist to
technician  level.
10.  Audit
As part  of  the evaluation  of  the effectiveness  of  molecular  genetic  diagno-
sis, it  has become  necessary to  standardize the  collection  of  workload  and
activity  data. In the United  Kingdom,  audit data is collected by the CMGS. The
three main  categories of data are samples entering  the laboratory  for  testing or
archiving,  tests indicated  as genotypes, and output as reports. The definition  of
samples is self-explanatory  but the working  definition  of  genotypes and reports
is more problematic  and worth  outlining.
12  Elles
A genotype  is the sequence, variant,  or mutation  data generated by one PCR
reaction  or Southern blot  track. In many cases the definition  is straightforward,
but in  some cases is somewhat complicated.  A  multiplex  of  nine exons ampli-
fied  from  the dystrophin  gene would  count as one genotype. An  Amplification
Refractory Mutation  System test may involve  two PCR reactions but counts as one
genotype for  audit purposes as both reactions are required to produce a result.
A report  is defined  as the answer to one clinical  question  m one individual.
A  family-specific  report  for  DMD  may  include  the  characterization  of  the
dystrophm  mutation  in the index case and say two  carrier  tests on female  rela-
tives.  Thts would  count as three reports  for  audit. When  a couple  is tested for
informativeness  in advance of a pregnancy this counts as one report  because in
this context the results on one individual  are meaningless without  those of their
partner.  The  value  of  standardized audit  data 1s in  allowing  the laboratory  to
track trends in  workload,  provide  accurate costs, and make internal  and exter-
nal comparisons  (Tables  3 and 4).
10.1.  UK  Trends
Although  the number of  UK  laboratories  submitting  audit returns had stabi-
lized by  1990, the audit  figures  demonstrate an impressive  increase in activity
over  the next 3-yr  period.  Samples processed doubled  and reports  issued rose
by  approaching  200%.  The  fact  that genotypes only  rose by  a factor  of  45%
reflects  the  move  away  from  linkage-based  tests, the increased emphasis on
PCR technology,  a reduced failure  rate, and an increase in low  prior  risk-popu-
lation-based  tests (CF and FraX).  Over  a similar  period,  the number  of  services
available  increased by 65%, but most of  these comprise relatively  rare disorders.
11. Quality  Issues-External  Quality  Assessment
An  emphasis m diagnostics is a systematic attempt to assess and control  the
quality  of  tests. To this end, a number  of  single disease external quality  assess-
ment  (EQA)  exercises have  been undertaken  (9).  In  addition  North  America,
Australasia,  the United  Kingdom,  and parts of  Europe  are some way  into  set-
tmg up  standing multidisease EQA  systems involving  testing reference  speci-
mens and  some form  of  mterpretatton  of  the results or  of  theoretical  results
(see Chapter  20).
1 I. 1. Internal  Quality  Assurance
Internal  quality  assurance includes all the controls  and checks that a labora-
tory builds  into its procedures to prevent  sample mix-up  and to ensure a consis-
tent and adequate quality  of testing. Some examples of these measures are given
in  Chapter  20.
Overview  of Molecular  Genetics  13
Table  3
UK  Activity  Statistics  from  1990-l  9948
Activity  indicator
Samples processed
Genotypes
Reports issued
Number of laboratories
submitting audit returns
%ource  CMGS  surveys
1990  1993-1994  Change, %
19,446  42,505  +118
101,379  146,562  +45
8551  24,618  t-188
25  27  +8
Table  4
UK  Service  Categories  Offered  from  1988-I  9938
1988  1991  1993
Number of services offered
%ource  CMGS  surveys
32  49  81
11.2.  Laboratory  Accreditation
In  the United  States, several individual  states, most notably  New  York,  have
developed  accreditation  systems for  diagnostic  molecular  genetics  laborato-
ries. The  accreditation  requires that the materials used (probes or PCR marker
systems) meet certain  standards (e.g., having  well-established  recombination
frequencies  between  the marker  and the disease in  question).  It  also requires
the staff  to be qualified  specialists.
In  the  United  Kingdom,  an  independent  company  set up  by  the  Royal
College  of  Pathologists-College  of  Pathologists  Accreditation  trains  inspec-
tors and has the power  to accredit facilities.  Inspection  Includes examination  of
the  effectiveness  of  the  management  structure,  the  equipment  and  facilities
available  in  the  laboratory,  and  safety  and  maintenance  standards. Also  the
quality  and consistency of  documentation  relating  to the tracking  of specimens
through  the  laboratory,  staff  facilities,  and training  are  examined.  Although
accreditation  is only  in  the earliest stages of  development  in the United  King-
dom,  the pressure to  become accredited  will  increase from  the public  sector
health  service  purchasing  organizations which  fund  genetic  services.
12. Role  of  the  Professional  Bodies
In  the United  Kingdom,  a number  of  professional  bodies have  had an inter-
est in  the  development  of  clinical  molecular  genetics over  the  last  10 yr.  Of
note are the Clinical  Genetics Society, the Association  of  Clmical  Cytogeneti-
14  El/es
cists, and the Royal  College  of  Pathologists. The  American  College  of Medical
Genetics and the American  College  of  Pathologists have  broadly  similar  roles
in the United  States. The  UK  professional  body with  the most direct interest in
the field  is the CMGS.  Since 1987, the CMGS  has organized  laboratory-based
scientists mostly working  in NHS  diagnostic laboratories. The society promotes
the discipline  through  training,  audit,  quality  assessment schemes, best prac-
tice  guidelines,  and scientific  meetings.
13. Conclusions
Clinical  molecular  genetics will  continue  to grow  as the benefits  of  testing
become apparent, as the number  of possible tests increases, and as they become
available  to  new  populations.  The  technology  will  change and become  more
kit-based  and automated. However,  for  some time the discipline  will  retain  and
enjoy its close links with  the research community  as the human genome project
reaches its successive goals.
Whatever  scientific  and technical developments  bring,  scientists working  in
this  field  will  continue  to be anxious  that the testing  they carry out  should  be
provided  in  an adequate counseling  framework  and after  an informed  debate
on  the  social  and  ethical  impact  of  the mtroduction  of  genetic  testing.  They
also will  be concerned to retain  the confidence  of  the public  in genetic testing
by promotmg  an improving  standard of quality  in all  the centers involved.
Acknowledgments
My  thanks to Andrew  Read, Simon Ramsden, and Andrew  Wallace  for  dis-
cussion during  the preparation  of  this chapter.
References
1. Harris, R., Elles, R., Craufurd, D., Dodge, A., Ivinson, A., Hodgkinson, IS., et al.
(1989) Molecular genetics in the Natronal Health Service in Britain. J. Med.  Genet.
26,219-225.
2.  Rona, R. J., Swan, A. V., Beech, R., Wilson, 0. M., Kavanagh, F. B., Brown, C.,
et al. (1992) DNA  probe technology: implications for service planning in Britain.
Clm.  Genet.  42,  186-195.
3.  Tyler,  A.,  Ball,  D.,  and  Craufurd,  D.,  on  behalf  of  the  United  Kingdom  Hunt-
ington’s  Disease  Prediction  Consortium  (1992)  Presymptomatic  testing  for
Huntington’s disease in the United Kingdom. Br.  Med.  J.  304,  1593-1596.
4.  MacDonald,  F., Morton,  D.  G.,  Rindl,  P.  M.,  Haydon,  J., Cullen,  R.,  Gibson,  J., et
al. (1992)  Predictive diagnosis of  familial  adenomatous polyposis with  linked
DNA  markers:  populatron  based  study.  Br  Med  J  304,86!I-872.
5.  Elles,  R.  G.,  Hodgkinson,  K.  A.,  Mallick,  N.  P.,  O’Donoghue,  D.  J.,  Read,  A.  P.,
Rimmer,  S.,  Watters,  E.  A.,  and  Harris,  R.  (1994)  Diagnosis  of  adult  polycystic
kidney  disease  by  genetic  markers  and  ultrasonographic  imaging  in  a voluntary
family  register. J  A4ed  Genet  31,  115-120.
Overview  of Molecular  Genetics  15
6.  Read,  A.  P.,  Kerzm-Storrar,  L.,  Mountford,  R.  C.,  Elles,  R.  G.,  and  Hans,  R.
(1986)  A  regrster  based  system  for  gene  tracking  in  Duchenne  muscular  dystro-
phy  J.  Med.  Genet.  23,581-586.
7  Yates,  J., Malcolm,  S., and Read,  A.  P.  (1989)  Guidelines  for DNA  bankings  report
of  a working  party  of the  Clinical  Genetics  Society  J  Med.  Genet  26,245-250
8.  Andrews,  L.  B.,  Fullarton,  J.  E.,  Holtzman,  N  A.,  and  Motulsky,  A.  G.  (eds.)
(1994)  Assessing  Genetics  Risks-Implications  for  Health  and  SocluE  Policy,
National  Academy  Press, Washington,  DC,  pp.  202-233.
9.  Cuppens,  H.  and  Cassimans,  J.  J.  (1995)  A  Quality  Control  Study  of  CFTR
Mutation  Screening  in  40  different  European  Laboratones.  Eur.  J  Hum.  Genet.,
3,235-245

2
PCR  Techniques  for  Deletion,  Linkage,
and  Mutation  Analysis  in  DuchennelBecker
Muscular  Dystrophy
Roger  Mountford
1.  Introduction
Duchenne  muscular  dystrophy  (DMD)  and  Becker  muscular  dystrophy
(BMD)  are allelic  disorders  caused by mutations  in  the dystrophin  gene. The
molecular  genetic  analysis  of  these disorders  is  among  the  most  difficult
encountered  in a routine  diagnostic  laboratory.  The  analysis is made difficult
by the size and structure of  the gene, which  is 2.4 Mb  in size, and comprises 79
exons encoding  a 14-kb mRNA  transcript  (1,2). The  exons are all  small (~200
bp),  whereas  the introns  vary  from  109 bp  to >200  kb.  The  interpretation  of
results is hampered  further  by the incidence  of  new  mutation  (approximately
one-third  of DMD  cases), the greater than normal  level  of recombination  across
the gene (approx  10% [3,4]),  and finally  the occurrence  of  a significant  level
of  germline  mosaicism (5,6).
1. I.  Strategy
It  is  difficult  to  define  a set procedure  for  the analysis of  all  DMD/BMD
cases, since the exact tests performed  will  depend on the pedigree structure and
the availability  of  key samples. However,  the following  set of  guidelines  will
cover  most cases seen in  a diagnostic  laboratory.
1. I. 1. Mutation  Detection
Approximately  two-thirds  of  boys with  DMD  and a similar  proportion  of
affected  males  with  BMD  have  a  deletion  of  one  or  more  exons  of  the
dystrophin  gene (73).  The deletions vary  in size and location,  but are clustered
in  two  “hot  spots,”  the  major  site encompassing  exons 45-52,  and  a minor
From:  Methods  in  Molecular  Medlclne*  Molecular  Diagnosis  of  Genetrc  Diseases
E&ted  by  I?  Elles  Humana  Press  Inc  ,  Totowa,  NJ
17
18  Mountford
region  including  exons 3-19.  Deletions  are detected using  a multiplex  poly-
merase chain  reaction  (PCR)  method  (9),  in  which  18 exons are analyzed in
two  separate PCR reactions. These exons were  chosen to include  the two  dele-
tion  “hot  spots,”  and  this  system is estimated to  identify  approx  98%  of  all
deletions. Further  exons can be studied to increase the sensitivity  of the test or
to define  the extent of  deletions  identified  by the initial  screen, However,  full
characterization  of  a deletion  may require  analysis with  cDNA  probes.
A  further  5-10%  (7)  of  affected  males have  a duplication  of  one or  more
exons, and the remainder  are assumed to have  point  mutations.  The  duplica-
tions have  traditionally  been detected using dosage estimation of cDNA-probed
Southern  blots.  Autoradiograph  signals from  blots have  proven  very  difficult
to  quantify,  and many  laboratories  do  not  screen routinely  for  duplications.
Alternatively,  duplications  can be detected using pulsed-field  gel electrophore-
sis (PFGE) (see Chapter  17) or by RNA  analysis, but these methods are labor-
intensive,  technically  demanding  procedures that are used in  very  few  routine
laboratories.  However,  the  advent  of  automated  fluorescent  dosage analysis
will  make duplication  screening a reality  for  more  laboratories  in  the future.
Point mutation  screening is very  difficult  given  the size of  the gene. Muta-
tions  can be identified  systemattcally in  patients using  reverse  transcriptase-
polymerase  chain reaction  (RT-PCR)  analysis of  illegitimate  transcripts  of  the
gene in  peripheral  lymphocytes  followed  by the use of  the protein  truncation
test (IO,ll)  (see Chapter  4).  However,  this  system is only  used in  a research
context, and has not been transferred  to a routine  diagnostic setting. Some point
mutations  may be identified  by single-stranded  conformational  polymorphism
(SSCP)/beteroduplex  analysis on the 18 exons used for  the multiplex  deletion
screening  assay. This  system requires  no extra  resources m the laboratory  in
terms  of  primers.  However,  there  is  no  evidence  for  clustermg  of  such
mutations  (12,13),  and therefore,  this approach  has a limited  detection rate.
1.2. Direct  Carrier  Defection
1.2.1.  Deletion  Detection
If  a deletion  is detected m a family,  then carrier  detection  can be performed
using  one of  a number  of  direct  tests. The  simplest method  is to  analyze the
family  with  one or more polymorphisms  from  withm  the deleted region  (14).  If
a woman  is heterozygous for  the appropriate  marker, then she cannot be a car-
rier  (excluding  germline  mosaicism-+ee  Section 1.2.3.). If  a woman  is a car-
rier,  this  can manifest  itself  as a failure  to  inherit  a maternal  allele  for  the
appropriate  marker,  although  this  is dependent  on  the right  combination  of
alleles being present in the woman’s  parents. This  approach is quick and effec-
tive,  but  is limited  because there are no markers  available  for  all  the  deleted
regions  (see Table  l),  and those that are used may not always be informative.
Table  1
Sequences  of  Primers  for  Multiplex  Deletion  Screena
Exon
Product,
bp  Forward  primer,  5’-3’  Reverse  prtmer,  5’-3’
5’  Reaction
1
19
3
8
13
6
G
4
3’  Reaction
48
44
51
43
45
50
53
47
42
60
52
535  GAA  GAT  CTA  GAC  AGT  GGA  TAC  ATA  ACA  TX  TCC  GAA  GGT  AAT  TGC  CTC  CCA  GAT  CTG
AAT  GCA  TG  AGT  CC
459  TTC  TAC  CAC  ATC  CCA  TTT  TCT  TCC  A  GAT  GGC  AAA  AGT  GTT  GAG  AAA  AAG  TC
410  TCATCCATCATCTTCGGCAGATTAA  CAG  GCG  GTA  GAG  TAT  GCC  AAA  TGA  AAA  TCA
360  GTC  CTT  TAC  ACA  CTT  TAC  CTG  TTG  AG  GGCCTCATTCTCATGTTCTAATTAG
238  AAT  AGG  AGT  ACC  TGA  GAT  GTA  GCA  GAA  AT  CTG  ACC  TTA  AGT  TGT  TCT  TCC  AAA  GCA  G
202  CCA  CAT  GTA  GGT  CAA  AAA  TGT  AAT  GAA  GTCTCAGTAATCTTCTTACCTATGACTATGG
196  -M-G  TCG  GTC  TCC  TGC  TGG  TCA  GTG  CAA  AGC  CCT  CAC  TCA  AAC  ATG  AAG  C
506  TTG  AAT  ACA  TTG  GTT  AAA  TCC  CAA  CAT  G  CCT  GAA  TAA  AGT  CTT  CCT  TAC  CAC  AC
426  GTTGTGTGTACATCGTAGGTGTGTA  TCC  ATC  ACC  CTT  CAG  AAC  CTG  ATC  T
388  GAA  ATT  GGC  TCT  TTA  GCT  TGT  GII”T  TC  GGA  GAG  TAA  AGT  GAT  TGG  TGG  AAA  ATC
357  GAA  CAT  GTC  AAA  GTC  ACT  GGA  CTT  CAT  GG  ATA  TAT  GTG  TT’A  CCT  ACC  CTT  GTC  GGT  CC
307  CTTTCTTTGCCAGTACAACTGCATGTG  CAT  TCC  TAT  TAG  ATC  TGT  CGC  CCT  AC
271  CAC  CAA  ATG  GAT  TAA  GAT  GTT  CAT  GAA  T  TCT  CTC  TCA  CCC  AGT  CAT  CAC  TTC  ATA  G
212  TTG  AAA  GAA  TTC  AGA  ATC  AGT  GGG  ATG  CTT  GGT  TTC  TGT  GAT  TTT  CTT  TTG  GAT  TG
181  CGT  TGT  TGC  ATT  TGT  CTG  TlT  CAG  TTA  C  GTC  TAA  CCT  TTA  TCC  ACT  GGA  GAT  TTG
155  CACACTGTCCGTGAAGAAACGATGATG  TTA  GCA  CAG  AGG  TCA  GGA  GCA  T-I-G  AG
139  AGG  AGA  AAT  TGC  GCC  TCT  GAA  AGA  GAA  CG  CTG  CAG  AAG  CTT  CCA  TCT  GGT  GTT  CAG  G
113  AAT  GCA  GGA  TTT  GGA  ACA  GAG  GCG  TCC  TTC  GAT  CCG  TAA  TGA  TTG  TTC  TAG  CCT  C
“Adapted  from  ref  9.
20  Mountford
An  alternative  direct  carrier  detection  method  is to use fluorescent  in  situ
hybridization  (FISH)  of standard metaphase chromosome spreads with  cosmid
probes spectfic for  given  dystrophin  exons (25).  If  a carrier  has a deletion  that
includes  the relevant  cosmid, then she will  show a signal on only  one of  her X
chromosomes, whereas  a noncarrier  will  have  a signal  on both.  A  number  of
cells  (minimum  10) are  analyzed to rule  out  false-negative  results  owing  to
hybridization  failure.  This direct technique has advantages over  the use of poly-
morphic  markers  m that  a result  is more  certain.  However,  cosmids are not
currently  available  for  all  the deleted  exons, and  the  size of  the  deletion  is
crmcal.  If  the  deletion  does not  encompass the whole  of  the region  comple-
mentary  to the cloned DNA  in the cosmtd, then the labeled cosmid will  hybrid-
ize to the deleted chromosome  and the test becomes invalid.  Therefore,  if  the
cosmid includes  an exon at either  end of  the deletion,  then an affected  boy  or
an obligate  carrier  should be tested to validate  the test in each specific  family.
This method  will  usually  be performed  in, or in conjunction  with,  a cytogenet-
its  laboratory.
Other  direct  tests include  the  use of  PFGE  (16)  or  RT-PCR  analysis  of
ectoplc  dystrophin  transcripts  (l&11).  PFGE  is  a very  effective  method  of
detecting  deletion  carriers  and,  in  addition,  has the  ability  to detect duplica-
tions.  However  it  requires  a positive  commitment  to  the  technology.  This
method  is  considered  in  more  detail  m  Chapter  17.  Analysis  of  ectopic
dystrophin  RNA  transcripts from  peripheral  lymphocytes  is a potentially  use-
ful method of carrier detection, but is technically difficult.  The effect of X  chromo-
some mactivation on such low levels of transcript is not understood, and therefore,
it is not possible to say a woman  is not a carrier  with  complete  certainty.
A new method of deletion  detection is the use of automated fluorescent  DNA
analysis to measure dosage on PCR products using the exons of  the multiplex
deletion  screen (I  7,18). This  involves  the use of  modified  fluorescent  primers
or  the incorporation  of  a fluorescent-labeled  nucleotide  in  the multiplex  PCR
assay. The  number  of  cycles of  amphfication  is kept below  24 to  ensure the
reaction  is still  in  the logarithmic  phase. The  levels  of  fluorescence  m  each
exon can then be analyzed and compared with  each other  either visually  using
peak heights  or  statistically  using  peak areas. The  ratio  of  a deleted  exon  to
nondeleted  exons in a carrier  would  be approximately  half  that in a noncarrier.
This  method  is new, but  the technique  has proven  to be accurate and is being
introduced  mto routine  service  laboratories.
1.2.2.  Point  Mutation  Detection
If  a point  mutation  has been  detected  in  a  family,  then  carrier  detection
should  be carried  out  using  an appropriately  designed  assay. If  the mutation
alters a restriction  enzyme site, then a simple assay based on the enzyme should
PCR  Techniques  for  DMDBMD  21
be used. If  no  restriction  site is involved,  a modified  oligonucleotide  primer
can be designed to create a novel  restriction  site involving  either the normal  or
mutant  sequence, or alternatively,  primers  may be designed for  an amplitica-
tion  refractory  mutation  system (ARMS)-based  assay (see Chapter  5). If  these
methods are not possible, then an assay using allele-spectfic  oligonucleotides
(ASOs) specific for  the normal  or mutant sequence can be used, or finally  direct
sequencing of  potential  carriers  can be performed.
1.2.3.  Germline  Mosaicism
Interpretation  of  all  direct  carrier  tests is  complicated  by  the  presence of
germline  mosaicism.  It  has been  demonstrated  that  where  the  mother  of  an
affected  male has been shown not to be a carrter by any one of the direct detec-
tion  methods  available  using  somatic material,  she still  has a 5%  chance of
having  another  affected  child  ($6).  Therefore,  the mother  of  an affected  male
can never  be told  she is definitely  not a carrier.
If  a woman  is definitely  a carrier  and her  affected  son(s) has inherited  the
grand-paternal  haplotype  for  some/all markers across the gene, then there  is a
chance that the grandfather  could have been a germinal  mosaic carrier. This  has
implications  for  any maternal  aunts of  affected  males. Cases of  grand-paternal
mosaicism  have  been  demonstrated,  but  there  are  no  figures  available  for
its frequency.
1.3. Indirect  Carrier  Detection
If  no mutation  is detectable m a family  or a direct test is uninformative,  then
carrier  detection  and  prenatal  diagnosis  can be  carried  out  indirectly  using
linked  markers. There  are over  20 intragenic  polymorphisms  described  in  the
dystrophin  gene (Table  2). These range from  restriction  fragment  length  poly-
morphisms  (RFLPs)  with  two  alleles  to  highly  polymorphic  microsatellite
markers. They  can be used to track the disease through  a family,  but interpreta-
tion  of  the results is complicated  by the high  level  of  intragenic  recombination
and by the high  frequency  of new mutations. There  are two recombination  “hot
spots” located  in introns  3 and 44 of  the dystrophin  gene.
Ideally,  when  carrying  out linkage  analysis, markers from  the 5’ and 3’ ends
of  the gene plus a marker  between  introns  3 and 44 should  be used to reduce
the  possibility  of  double  recombinants  going  undetected.  However,  not  all
families  are informative  with  this combination  of  markers.
The  results of  linked  marker  analysis can be combined  with  details  of  the
pedigree  and information  on serum creatinine  kinase levels  to produce  relative
carrier  risks.  Such risks  are often  calculated  using  the  MLINK  option  of  the
LINKAGE  computer  program  (19)  (see Chapter  8).
Table  2
Sequences  of  Primers  for  Dystrophin-Specific  Markers
Marker  Forward  primer,  S-3’  Reverse  pruner,  5’-3’
DYSI
DYSII
PERT  84-l/Mae111
NM7173
PERT  87-1lBstNI
pERT87-  1 SIBamHI
pERT87-8/TaqI
pERT87-  15lXmnI
pERTW-  15  TuqI
Cala/PstI
Cf23amqI
Exon  43  TA
STR44
Exon  45-SSCP
STR45
Exon  4804seI
DXS997
STR49
STR50
Exon  53-SSCP
DMDI
566
STR62163
STRHI
MPlP
3/DYS
ACT  GTA  AAT  GAA  ATT  GTT  TTC  TAA  GTG  CC
TGA  GTA  CTT  GCA  CAC  AAA  GC
CAG  GGA  TGC  AAA  GGA  ACT  GGG
ATC  CCA  TCC  TGT  TCT  ATT  TT
CTA  TCA  TGC  CTT  TGA  CAT  TCC  AG
TCC  AGT  AAC  GGA  AAG  TGC
GTC  AGT  TGG  TCA  GTA  AAA  GCC
GAC  TGG  AGC  AAG  GGT  CGC  C
GAC  TTT  CGA  TGT  TGA  GAT  TAC  TTT  CCC
GAA  TGG  CCT  GCC  CTT  GGG  GAT  TCA  G
ATT  CAG  CAG  GGG  GTG  AAT  CTG  A
GAA  CAT  GTC  AAA  GTC  ACT  GGA  CTT  CAT  GG
TCC  AAC  ATT  GGA  AAT  CAC  ATT  TCA  A
CTT  TCT  TTG  CCA  GTA  CAA  CTG  CAT  GTG
GAG  GCT  ATA  ATT  CTT  TAA  CTT  TGG  C
AAG  CTT  GAA  GAC  CTT  GAA  GAG  C
TGG  CTT  TAT  TTT  AAG  AGG  AC
CGT  TTA  CCA  GCT  CAA  AAT  CTC  AAC
AAG  GGT  TCC  TCC  AGT  AAC  AGA  TTT  GG
TTG  AAA  GAA  TTC  AGA  ATC  AGT  GGG  ATG
TGT  CTG  TCT  TCA  G’M’  ATA  TG
GCA  GCT  ATA  TGT  TTC  CCA  AGA  TTG  A
TTC  TTC  GTC  GAT  ACC  CCC  ATT  CCA
ACGACAAGAGTGAGACTCTG
ATC  AGA  GTG  AGT  AAT  CGG  TTG  G
GAA  AGA  TTG  TAA  ACT  AAA  GTG  TGC
GTT  AAC  AAA  ATG  TCC  TTC  AGT  TCT  ATC  C
TAG  TGT  TTT  CCT  AAG  GGG  TT
CAG  TTT  GTT  TAA  CAG  TCA  CTC
ACT  GGC  ATG  CAT  TAT  TTT  GT
CTC  AAT  AAG  AGT  TGG  ATT  CAT  TC
ATA  ATT  CTG  AAT  AGT  CAC  AAA  AAG
CCAATTAAAACCACAGCAG
ACA  ATT  TCC  CTT  TCA  TTC  CAG
AAG  CTT  GAG  ATG  CTC  TCA  CCT  TTT  CC
AGT  GTT  AAG  TTC  TTT  GAG  TTC  TGT  CTC  AAG
GTT  GTA  AGT  TGT  CTC  CTC  TTT  GC
ATA  TAT  GTG  TTA  CCT  ACC  CTT  GTC  GGT  CC
TCA  TCA  CAA  ATA  GAT  GTT  TCA  CAG
CAT  TCC  TAT  TAG  ATC  TGT  CGC  CCT  AC
CTCTTTCCCTCTTTATTCATGTTAC
CCT  GAA  TAA  AGT  CTT  CCT  TAC  CAC  AC
GTT  TTC  AGT  TTC  CTG  GGT
CAT  ATG  ATA  CGA  TTC  GTG  TTT  TGC
TAT  GCT  ACA  TAG  TAT  GTC  CTC  AGA  C
CTT  GGT  TTC  TGT  GAT  TTT  CTT  TTG  GAT  TG
ATA  ACT  TAC  CCA  AGT  CAT  GT
GAG  GTT  CTT  TGG  AGG  AAT  AC
CTC  TTT  GAG  TTT  GAA  GTT  ACC  TGA
ATA  TAT  CAA  ATA  TAG  TCA  CTT  AGG
ATC  TAG  CAG  CAG  GAA  GCT  GAA  TG
GGATGCAAAACAATGCGCTGCCTC
PCR  Techniques  for DMDIBMD  23
2. Materials
Analytical-grade reagents should be used at all stages, unless otherwise indicated.
2.1.  Multiplex  Deletion  Screening
1.  10X  PCR  buffer:  670  mMTris-HCl,  pH  8.3,  166 mMammonium  sulfate,  500  mM
KCl,  37 amagnesium  chloride,  and 0.85  mg/mL  bovine  serum  albumin  (BSA).
Filter  sterilize  and  store as 1-mL  aliquots  at -20°C.
2  Deoxynucleoside  triphosphates  (dNTPs):  Dissolve  10  mg  of  individual  nucle-
otides  (Sigma,  St.  Louis,  MO)  in  sterile  dHzO  to  a concentratron  of  20  m&f,  and
mix  together  to  form  an equimolar  mix  of all  four  dNTPs.  Store  400~pL  aliquots
at -2OOC.  Avoid  excessive  freezing  and thawing.
3.  Ohgonucleotide  primers:  Primers  may  be  synthesized  “m-house,”  cleaved  from
their  CpG  column,  and deprotected  in  ammonium  hydroxide.  These  can be stored
for several  years at -70°C.  Prepare  a 1 OX workmg  stock  of  all  the  primer  pans  at
a concentration  of  2.5  pJ4.
4.  Tuq polymerase:  The  author  uses BRL  (Life  Technologres,  Garthersburg,  MD)
enzyme  for  all  laboratory  uses,  but  can  also  recommend  BCL  (Boehringer
Mannheim,  Mannheim,  Germany)  and  Perkin-Elmer  (Foster  City,  CA).
5.  Agarose:  Use  a mixture  of  ordinary  electrophorests-grade  agarose  (Boehringer
Mannheim)  and  NuSieve  low-gelling-temperature  agarose  (FMC,  Rockland,
ME).
6.  TBE  electrophoresis  buffer:  Make  as a  10X  stock  solution,  0.89A4 Tris,  0.89A4
boric  acid,  and  0.02M  EDTA  (pH  8.0).  Store  at room  temperature.
7.  5X  TBE  gel  loading  buffer:  5 mL  10X  TBE,  4.9  mL  glycerol,  0  1% SDS,  3 mg
bromophenol  blue,  and  15 mg  xylene  cyanole.  Store  at room  temperature.
8.  Agarose  electrophoresis  equipment:  Wide  minisubcell  system,  15 x  10 cm  (Bio-
Rad,  Hercules,  CA)
2.2.  SSCP  Analysis
1,  PCR  materials:  Use  the  same  PCR  materials  as multrplex  analysis  except:
a.  10X  PCR  buffer:  670 mMTris-HCl,  pH  8.3,166  mMammomum  sulfate, 37  mM
magnesium  chloride,  0.85  mg/mL  BSA.  Filter  sterilize  and  store  as  1-mL
aliquots  at -20°C.
b.  Oligonucleotides:  Prepare  a  10X  working  stock  of  all  the  primer  pairs  at  a
concentration  of  5  pM.
2.  Formamide  loading  buffer:  10 mL  formamide,  200  mL  0.5MEDTA  (pH  8.0),
3  mg  bromophenol  blue,  and  15 mg  xylene  cyanole.  Store  at room  temperature.
3.  Acrylamide:  Use  49:l  acrylamideibis-acrylamide  mix.  The  author  uses  a 40%
ready-mixed  solution  (Sigma).
4.  Ammonium  persulfate: Prepare a 10% solution  that can be stored at 4°C  for up to 48 h.
5.  Polyacrylamide  electrophoresis  equipment:  Model  SA  system  32  x  20  cm  (Life
Technologies).
6.  Silver-staining  solution  A:  10%  ethanol  (industrial-grade)  and  0.5%  acetic  acid.
Prepare  on  the  day  of  use. Store  at room  temperature.
24  Mountford
7  Silver-staining  solution  B*  0.1%  AgNOs.  Prepare  a  10X  stock  solution  of  1%
AgNO,,  and  store  at room  temperature  m  a brown  bottle  1X  solution  should  be
stored  in  clear  bottles  at room  temperature,  but  away from  hght.  The  1X  solution
may  be reused  until  efficiency  of staining  falls.
8.  Silver-staining  solution  C.  1.5%  NaOH,  0.15%  formaldehyde.  This  solution  is
labile.  Add  the  formaldehyde  nnmediately  (i.e.,  within  3 min)  before  use
9  Silver-staining  solution  D*  0.75%  Na,C03.  Prepare  a 10X  stock  of 7.5%  Na,CO,
Store  at room  temperature.
10.  Cellophane  sheets (Hoefer  Scientific  Instruments,  San  Francisco,  CA).
11.  Drying  frame  and platform  (Hoefer).
2.3.  Microsa  tellite  Analysis
1  PCR  materials:  Use  the  same  PCR  materials  as SSCP  analysis.
2.  Restriction  enzymes  supplied  by  Boehringer  Mannhelm,  Life  Technologies,  and
New  England  Biolabs  (Beverley,  MA).  Restriction  enzymes  are  supplied  with
their  own reaction  buffers.  Store  at -20°C
3  Phenol/chloroform:  Eqmlibrate  phenol  m  100  mA4 Tris,  pH  8.0.  Prepare  a 50.50
solution  of this  phenol  with  chloroform.  Store  at 4°C
4.  Acrylamide:  Use  a  19.1  acrylamide/bis-acrylamide  mix.  The  author  uses a 40%
ready-mixed  solution  (Acugel-National  Diagnostics,  Atlanta,  GA).
5.  Polyacrylamide  electrophoresls  equipment:  ATT0  AE6210  20  x  14 cm  slab  gel
system  (Genetic  Research  Instrumentation,  Dumnow,  Essex, UK).
6.  Silver  staining  (see Section  2.2.,  items  6-9).
3.  Methods
PCR  is a very  powerful  technique  where  contamination  of  the reaction  by
very  low  levels  of  DNA  from  an external  source can lead to erroneous  results.
Great care should be taken to avoid  such contamination  (see Note  1).
Oligonucleotide  primers:  Precipitate  a 400~pL  aliquot  of  primer  in  ammo-
nium  hyroxrde  solution  by  adding  13 PL  of  3M  sodium  acetate and  1 mL  of
absolute ethanol. Cool  to -70°C  for  1 h, and spin in a bench-top  centrifuge  for
15 min.  Resuspend the primer  m 200 pL  of  sterile dH,O,  estimate the concen-
tration  by measuring  the  ODZ6cnm,  and dilute  to the appropriate  concentration
(2.5  pA4 for  multiplex  primers,  and 5 w  for  all  other uses). All  the multiplex
primer  pairs  are diluted  together  to give  a mixed  10X  working  stock.
3.1.  Mutation  Screening
3.1.1.  Multiplex  Deletion  Screening
3.1.1.1.  PCR  CONDITIONS
The  final  concentrations of  the reaction components are: 67 mMTris,  pH  8.3,
50  mMKCI,  16.6  mMNH4S04,  3.7 mMMgCI,,  85 yg/mL  BSA, 0.25 weach
primer,  3 mM  dNTPs,  20-50  ng of genomic  DNA,  1 U of  Taq  polymerase  m a
total  volume  of  10 p.L (see Note  2).
PCR  Techniques  for  DMD/BMD  25
Track
1  2  3  4  5  6  7
exon
48
51
43
45
50
53
47
60
52
Fig.  1.  Screening  for  dystrophin  deletions  using  the  multiplex  PCR  method.  Track
1, deletion  of  exons  48-50;  Track  2,  deletion  of  exons  50-53;  Track  3,  deletion  of
exon  53;  Tracks  4  and  6,  no  deletion;  Track  5,  deletion  of  exon  52;  and  Track  7,
deletion  of  exon  45.
1.  Prepare  a master  mix  of all  the  components,  except  the DNA.  Aliquot  8 yL  into  a
thin-walled  0.5-mL  Eppendorf  tube.
2.  Add  2  pL  of  DNA  solution  (10-25  ng/pL)  (see Note  3).
3.  Add  one  drop  of light  paraffin  oil,  and  place  on  a PCR  machine  with  a preheated
block  at  94’C  (see Note  4).
4.  PCR  cycling  conditions:  Initial  denaturation:  94°C  for  3 min,  followed  by  30 cycles
of 94°C  for  1 min,  60°C  for  1 min,  and 72°C  for  2,3,  or 4 min.  (The  synthesis  time
is extended  by  1 min  every  10 rounds.)  Final  synthesis:  72°C  for  5 min.
5.  Add  2.5  pL  of  5X  TBE  loading  buffer.
6.  Load  6  pL  of  reaction  on  a 2%  agarose  gel  (1%  Nusieve/l%  BCL  agarose),  and
carry  out  electrophoresis  at  100  mA  for  approx  1  h  with  ethidium  bromide
(0.5  mg/mL)  in  both  the  gel  and  the  TBE  running  buffer  (see Note  5).
7.  Once  separation  of  the  bands  is  complete,  photograph  the  gel  on  a  UV  trans-
illuminator  (Fig.  1) (see Notes  6  and  7).
3.1.2.  SSCP/Heteroduplex  Analysis  (see  Note  8)
3.1.2.1.  PCR  CONDITIONS
The final  concentrations of  the reaction components are: 67 miVTris,  pH  8.3,
16.6 mb4NH4S04,  3.7 mJ4MgC12,  85 pg/mL  BSA, 0.5 fleach  primer,  3 mM
dNTPs,  20-50  ng  of  genomic  DNA,  and 0.5  U  of  Taq  polymerase  in  a total
volume  of  10 pL.
26  Mountford
1.  Prepare  a master  mix  of all  the  components,  except  the  DNA  (see Note  9).  Ali-
quot  8 yL  into  a OS-mL  Eppendorf  tube
2.  Add  2  pL  of  DNA  solution  (10-25  ng/pL)  (see Note  3).
3.  Add  one  drop  of  light  paraffin  011, and  place  on  a PCR  machme  with  a preheated
block  at 94V.
4.  PCR  cycling  conditions:  Initial  denaturation:  94°C  for 3 min  followed  by  30 cycles
of 94’C  for 1 min,  60°C  for 1 min,  and 72°C  for 2 min.  Final  synthesis: 72°C  for 5 min.
5.  After  the  PCR  reaction,  if  usmg  male  DNA  samples  (see Note  IO),  mix  5  uL  of
two  unrelated  male  samples  together.
6  Heat  at  95°C  for  5  mm,  and  then  allow  to  cool  slowly  to  room  temperature  to
create  heteroduplexes.
7.  Add  15  uL  of  distilled  water  to  the  PCR  reaction,  and  then  add  25  uL  of
formamide  loading  buffer.
8.  Load  2 pL  of  PCR  product  (double-stranded  DNA)  onto  an  8% polyacrylamide
(49.1)  gel  (see Note  11).
9.  Heat  the  remaining  sample  at  95°C  for  5 min.  Snap  cool  on  ice.
10.  Load  6  pL  of  PCR  product  (single-stranded  DNA)  into  the  same  well  as the
double-stranded  DNA.
11  Run  slowly  overnight  at  4”C,  with  a maximum  current  of  20  mA  (see  Notes
12 and  13).  The  precise  electrophoretic  conditions  depend  on  the  PCR  products
being  analyzed.
12.  When  the  DNA  has migrated  the  desired  distance,  silver  stain  the  gel.
3.1.2.2.  SILVER  STAINING  (SEE NOTE  14)
1.  Separate  the  gel  plates,  and  carefully  transfer  the  gel  into  a  photographic
stammg  tray
2.  Immerse  the  gel  in  300  mL  of  solution  A,  shake  gently  for  3 min,  pour  off  the
solution,  and  immerse  the  gel  m  a further  300  mL  of  solution  A.
3.  Pour  off  solution  A  and  add  400  mL  of  solution  B.  Shake  gently  for  15 mm.
4.  Pour  off  solution  B  (this  can  be  reused),  rinse  the  gel  very  briefly  in  distilled
water, and add 300 mL  of freshly made  solution  C. Shake gently.  The  gel  should  turn
yellow  after  a few minutes,  and  dark  staining  bands  should  appear  shortly  after.
5.  When  the  bands  are  sufficiently  strong,  pour  off  solution  C,  and  add  300  mL  of
solution  D.  Leave  for  at least  10 min.
6.  Dry  the  gel  down  between  two  sheets  of  cellophane  in  a drying  frame  at  37°C
for  4-16  h.
7.  Interpretation  (see Notes  15-l  8).
3.2.  Linked  Markers
3.2.1.  PCR  Conditions
The  final  concentrations  of  the  reaction  components  are:  67  mMTris,  pH  8.3,
16.6  mMNH$04,  3.7  mMMgC12,  85  l.tg/mL  BSA,  0.5  @!each  primer,  3 mM
dNTPs,  20-50  ng  of  genomic  DNA,  and  0.3  U  of  Tag  polymerase  in  a  total
volume  of  10  l.tL.
PCR  Techniques  for  DMD/BMD  27
1.  Prepare  a master  mix  of  all  the  components  except  the  DNA.  Ahquot  8 pL  into  a
0.5~mL  Eppendorf  tube.
2.  Add  2  pL  of DNA  solution  (10-25  n&L).
3.  Add  one  drop  of  light  paraffin  oil,  and  place  on  PCR  machme  with  preheated
block  at  94°C.
4.  PCR  cycling  conditions:  All  markers  use an initial  denaturatton  at 94’C  for  3 min
and  final  synthesis  at 72’C  for 5 min.  Cycling  conditions  for all  dystrophm  mark-
ers are  given  m  Table  3
3.2.2.  RFLPs  (see  Note  19)
1.  After  the  PCR  is  complete  digest  the  products  by  adding  1.5  pL  of  restriction
enzyme  buffer,  2.5  l,tL  of distilled  water, and  1 uL  (5-10  U)  of restriction  enzyme.
2.  Incubate  at the  appropriate  temperature  for  4-16  h.
3.  Add  4  PL  of  5X  TBE  loadmg  buffer.
4.  Load  10  pL  of  sample  onto  a  2%  agarose  gel  (1%  Nusieve/l%  BCL  agarose)
containing  ethidmm  bromide  (5  ug/mL).  Use  1%  BCL  agarose  for  products
>500  bp.
5.  Run  at  100 mA  for  an appropriate  time  to  resolve  the  fragments
6.  When  separation  is complete,  photograph  the  gel  under  UV  transtllummation
3.2.3.  Microsatellites
1.  When  necessary (see Notes  20 and 2 l),  digest the PCR  products by adding  1 5 uL  of
restriction  enzyme  buffer  (10X),  2.5  PL  of  distilled  water,  and  1 uL  (5-10  U)  of
restriction  enzyme.
2.  Incubate  at the  appropriate  temperature  for  4-16  h.
3.  If  the  PCR  products  are >120  bp,  phenol-extract  the  sample  (see Note  22).
4.  Add  an equal  volume  of  phenol/chloroform  (1: 1) to  the  PCR  sample,  mix  thor-
oughly,  and  spin  in  a microcentrifuge  for  1 min.
5.  Take  4  yL  of  PCR  product  (middle  phase-paraffin  oil  is  on  the  top  and  phe-
nol/chloroform  on  the  bottom–see  Note  23),  and  add  1 pL  of 5X  sucrose  load-
ing  buffer.
6.  Load  onto  a  polyacrylamide  (19:  l-see  Note  24)  gel,  and  run  at  50  mA  for
90-180  min  (see Note  25).  The  strength  of  the  gel  depends  on  the  size  of  the
microsatellites  to be resolved.  A  10% gel  is used for products  < 100 bp,  an 8%  gel
for  products  in  the  range  100-160  bp,  and  a 6%  gel  for  products  160-200  bp.
7.  When  DNA  has  traveled  the  desired  distance,  silver  stam  the  gel  (see  Section
3.1  2.2  ).
8.  Interpretation  (see Notes  26  and  27).
4.  Notes
1.  In  all  PCR  assays, great care should  be taken  to avoid  contamination  of the reaction
by  external  sources  of  DNA.  The  most  common  source  of  contammation  is  by
amplimers  from  previous  reactions.  The  most  important  precaution  to  avoid  this  is
always to use separate pipets  for setting  up the reaction  and  for analyzing  the prod-
Table  3
Dystrophin-Specific  Markers  Detectable  Using  PCRa
Marker  Location  TvDe  A/s/c
Fragment  size,
bn  unless  stated  Het  Notes
DYS  I
DYS  II
pERT84  /Mae111
NM72173
pERTSir-l/BstNI
pERT87-8/TuqI
pERT87-  15IBamHI
pERT87-15ITaqI
pERT87-15IXmnI
Cala/&
Cf23aiTaqI
Exon 43iTA
STR44
Exon 45lSSCP
STR45
Exon 48lMaeI
DXS997
STR49
STRSO
Exon 53/SSCP
DMD  I
566
STR62l63
STRHI
MPlP
3’ DYS
Cut wnh BsrNI
Cut wtth  Tug1
Cut wnh BumHI
Cut wtth  TuqI
Cut with XmnI
Cut with PstI
Cut with TaqI
SSCP gel condrtions
Promoter  CA rpt  50/l/27  177-185  0.78
Promoter  CA rpt  52/l/30  -80-94  0.82
Promoter  RFLP  60/l/27  236/128 + 108  0.38
Intron 1  CA rpt  52/l/30  5688  0 57
Intron 12  RFLP  60/l/30  400/250 + 150  0 45
Intron 13  RFLP  55/l/30  145/74 + 7 1  0 38
Intron 17  RFLP  60/l/30  216/166 + 50  0.47
Intron 17  RFLP  60/l/30  416/233 +  183  0.44
Intron 17  RFLP  57/l/30  7301520 + 220  0.44
Intron 24  RFLP  60/l .5/30  1 2/O 7 + 0.5 kb  0 40
Intron 38  RFLP  58/2.5/30  2.1 + 0 30.6 + 0 5 + 0.3 kb  048
Intron 43  2-bp de1  60/l/30  357  0 34
Intron 44  CA rpt  60/l/27  174-204  0.87
Intron 44  SSCP poly  60/l/30  307  0 35
Intron 45  CA rpt  60/l/27  156-184  0 89
Exon 48  RFLP  63/l/30  108/85 + 23  0 38
Intron 48  CA rpt  5811127  109-l 17  064
Intron 49  CA rpt  60/l/27  -1 lo-140  0 93
Intron 50  CA rpt  60/l/27  -150-160  0.71
Exon 53  SSCP poly  60/l/30  212  0.25
Intron 55-57  CA rpt  5511127  –  125-135  0.50
Intron 60  VNTR  60/2/30  1.25/1.2/1.1 kb  0.57
Intron 62163  CA rpt  60/l/27  -190-200  0.38
Intron 64  TAA  rpt  52/l/30  90-102  0.68
3’ Untrans  4-bp de1  55/l/30  82178  0.20
3’ Untrans  CA rpt  6011125  127-135  0.34
u Abbreviations- A/S/C, amrealmg temperature (OC)/synthesis time (mm)/number of cycles, Het, heterozygosity
SSCP gel conditions
Plus constant bands
Cut PCR product with AId
Cut PCR product with MseI
SSCP gel condnions
Cut PCR product with tie1
Difftcult  to resolve

PCR  Techniques  for  DMD/BMD
ucts  If  products  are  seen m  the  negative  (no  DNA)  control,  then  the  results  are
invalid,  and  all  working  stocks  should  be discarded  and  fresh solutions  made  up.
2.  This  buffer  system  gives  more  consistent  results  when usmg  multiple  primer  pairs
than  the  conventional  buffer  (see  Section  2.2.)  that  is  used  for  the  majority  of
PCR  applications.  An  ammomum  sulfate-based  buffer  is  essential  for  this  and
other  multiplex  PCR  systems.
3  In  addition  to  the  obligatory  no  DNA  control,  always  run  a female  sample  as a
positive  control,  and samples  from  patients  with  known  deletions  covering  all  the
exons  in  the  multiplex  reaction  as negative  controls.
4.  Loading  the  samples  onto  a preheated  PCR  block  improves  the  eftictency  of  the
reaction  and is an easier and cheaper alternative  to the conventtonal  “hot  start” system.
5.  The  bands can be resolved  on a lo-cm  gel  Use of ethidium  bromtde  m the  running
buffer  prevents  fade-out  of  the  smaller  PCR  products.  Alternatively,  the  gel  can
be run  without  ethidium  bromide  and then  stained  when the  resolutton  1s complete.
6.  The  multiplex  system  was designed  so  that  problems  with  the  quality  of  the
sample  DNA  owing  to  the  degradation  of  high-mol-wt  material  or  the  presence
of  inhibitors  in  the  sample  would  give  rise  to  results  consistent  with  non-
contiguous  deletions.  False-negatrve  results  are still  theoretically  possible  when
amplification  of  an  exon  fails  because  of  the  presence  of a polymorphism  m  the
primer  bindmg  site.  If  a deletion  of  a  single  exon  is  observed,  then  ideally  the
result  should  be  confirmed  either  by  cDNA  analysrs  usmg  Southern  blotting  or
by  PCR  analysis  using  an  alternative  primer  pair
7.  If  when  using  the  multiplex  system  for  a prenatal  dtagnosis  a nondeleted  male
result  is  obtained,  then  the  sample  should  be checked  for maternal  contamination
by  comparmg  the  fetal  and  maternal  DNA  samples  usmg  an  X  chromosome-
specific  microsatellite  marker  for which  the  mother  is heterozygous.  Any  sign  of
heterozygosity  in  the  male  fetus  would  invalidate  the  multiplex  result.
8.  Both  SSCP  analysis  and  heteroduplex  analysis  can  be  carried  simultaneously
using  this  system.  This  requires  precise  electrophoretic  condmons  so  that  the
double-stranded  DNA  remains  on  the  gel  while  there  is  sufficient  resolution  of
single-stranded  DNA.
9.  The  exons  of  the  multiplex  system  can  be analyzed  in  sets of three  or  four.  Sug-
gested  sets are:
a.  Exons  1,  17,  19,8.
b.  Exons  48,  51,  3,43.
c.  Exons  45,50,  13,47
d.  Exons  53,60,  52.
e.  Exons  44,6,52
These  combinations  can be  changed,  but  some  exons  are incompatible,  since
their  single  strands  comigrate.  Incompatible  exons  are (45,48),  (17,3),  (45,  19),
(45,  S),  and  (44,  53).  Alternatively,  PCR  products  from  the  multiplex  reaction
can be run  dtrectly  on an  SSCP  gel.  These  are dtfticult  to  interpret,  even  with  the
use of  single-exon  controls.  Any  nonresolved  exons  can be  reamplified  and  run
on  a second  gel.
Moun  tford
10.  If  female  samples  are  used,  then  there  are  sufficient  heteroduplexes  produced
during  the  30  rounds  of  amplification.  If  male  samples  are  used,  two  unrelated
samples  must  be mixed  to produce  heteroduplexes  This  increases  the  number  of
affected  males  that  can be tested,  but  any positive  result  must  be further  analyzed
to  determine  which  of  the  two  samples  contained  the  putative  mutation
11.  Loading  double-stranded  and  smgle-stranded  DNA  in  the  same  well  means  het-
eroduplex  analysis  and  SSCP  analysis  both  can be performed  on  the  same  gel.  It
1s not  always  necessary  to  load  any  nondenatured  sample,  smce  there  1s always
some  double-stranded  DNA  present  after the  sample  has been denatured  and  snap
cooled.  However,  addition  of  nondenatured  sample  to  the  same  well  Improves
the  efficiency  of  the  heteroduplex  analysis.
12.  Temperature  is  a very  important  parameter  in  SSCP  analysis.  The  gel  system
should  be  assembled  and  precooled  at  4°C  for  at  least  1 h  before  loading  the
samples.  The  gel  should  be  run  as slowly  as possible,  usually  overnight,  to  avoid
any  increase  m  temperature.  The  exact  running  condrtions  depend  on  the  prod-
ucts  bemg  analyzed  and  should  be determined  empirrcally
13.  If  it  is  not  possible  to  perform  the  analysis  at 4°C  then  the  system  can  be run  at
room  temperature  wrth  the  addrtron  of  10%  glycerol  to  the  gel.  Again  the  gel
should  be  run  slowly,  and  resolutron  is  improved  by  usmg  buffer  precooled  to
4°C  Single-stranded  DNA  can show markedly  different  migration  patterns  usmg
these  two  alternative  approaches
14  Detailed  notes  on  srlver  staining  are  given  in  Chapter  3.  This  technique  is  only
applicable  to  gels  approx  1 mm  thick.  Handlmg  a large  gel  for  silver  stammg  can
be  difficult.  The  gel  should  be  gently  rolled  off  the  plate  into  the  solution  of  fix
Stammg  is  then  straightforward.  After  staining,  the  gel  can  be  trimmed  to  size
before  being  transferred  to  the  drying  frame
15.  If  a  heteroduplex  or  a  change  in  the  migration  of  the  single-stranded  DNA  is
detected  (see Fig.  2),  then the  rest of the family  of the  individual  concerned  should
be  analyzed  to  exclude  the  presence  of  a polymorphism  rather  than  a  genuine
mutation.  There  are  a number  of  polymorphisms  described  in  the  exon-specific
products  of  the  multiplex  system  (see Table  4)
16.  If  the  change  appears  not  to  be  the  result  of  polymorphism  the  sample  should
be  sequenced.
17.  If  a mutation  is  found,  then  an alternative  test  should  be  devised  to  confirm  it  in
the  original  sample  This  can  be  a restrictron  enzyme  digestion  if  the  mutation
alters  a  recognition  site,  or  a modified  primer  can  be  designed  that  creates  a
restriction  site  in  the  presence  or  absence  of  the  mutation.  Alternatively,  an
ARMS-based  system  may  be  used  with  primers  designed  for  the  normal  and
mutant  sequences.
18.  SSCP  or heteroduplex  analysis  should  not  be used  to  screen  other  family  mem-
bers  for  the  mutation,  since  the  presence  of  polymorphisms  in  other  members
may  alter  the  mutation-specific  pattern  seen on  the  original  gel.
19.  In  addition  to  the  obligatory  no  DNA  control,  always  use  samples  that  are
heterozygous  (+/-)  and homozygous  (+/+)  for the  restriction  site  as controls.  The
PC/?  Techniques  for  DMD/BMD  31
Fig.  2.  Detection  of  dystrophin  point  mutations  by  SSCP  analysis.  Analysis  of
single-stranded  PCR  products  containing  exon  3 of the  dystrophin  gene.  Tracks  1 and
5  show  the  normal  pattern  seen with  this  exon  (two  bands  corresponding  to  the  two
single  strands  of  DNA).  Track  4  shows an abnormal  pattern  in  an affected  male.  This
is  due  to  a point  mutation  (2-bp  deletion  at nucleotide  382).  Tracks  2 and  3 are  from
the  boy’s  mother  and  sister  (both  carriers  of the  mutation).
+/+  control  sample  should  always  be  fully  digested.  If  it  is not,  the  results  of the
test  are  invalid.  The  fragment  intensities  should  be  constant  in  any  +/-  test
samples  compared  to  the  +/-control.  Any  deviation  is  indicative  of  sample-spe-
cific  partial  digestion,  and  further  enzyme  should  be  added  to  the  PCR  products
or the  analysis  should  be  repeated.
20.  All  of  the  dystrophin-specific  microsatellite  markers  listed  in  Table  3  can  be
resolved  on  14-cm  nondenaturing  polyacrylamide  gels.  This  system  is capable  of
resolving  2-bp  differences  in  PCR  products  up  to 200  bp  in  size.  Above  this  size,
a longer  gel  is required  or the product  can be predigested  with  a restriction  enzyme
(see Table  3) to  give  a smaller  product  containing  the  dinucleotide  repeat  unit.
21.  The  marker  STR49  has  alleles  that  only  differ  by  1 bp.  This  is  on  the  limit  of
resolution  of this  system.  If  1-bp differences  are present and the  alleles  are unclear
32  Mountford
Table  4
Polymorphisms  Detectable  Using  SSCP  Analysis
of  the  18  Dystrophin  Exon-Specific  PCR  Products
Used  in  the  Multiplex  Deletion  Assaya
Exon  Polymorphism  Frequency
3  302-9  ins  T  0.31
13  1539-68  A+T  0  12
13  1539-73  T+C  0.08
43  6326-60  ins  TT  0.20
45  6647-  143  G+A  0.21
45  6671  C+T  0.05
48  7121-113  A+T  0.08
48  7304  C+A  0.27
53  7936  T+C  0.15
aAdapted from  ref.  13
on  the  above  system,  the  products  should  run  out  on  a 30-cm  gel  and  be  silver-
stained  as described.
22.  The  silver-staining  method  also stains proteins  present  in  the PCR  reaction.  These
migrate  through  the  gel  as a broad  front  corresponding  to  double-stranded  DNA
of  mol  wt  140  bp  and  above.  If  the  microsatellite  PCR  product  is  >120  bp,  the
resolution  will  be  disrupted  by  the  protein.  Therefore,  it  is  necessary  to  remove
the  protein  by  phenol/chloroform  extraction  prior  to  electrophoresis
23.  It  can be  difficult  to  remove  an ahquot  of the  middle  phase  after  phenol/chloro-
form  extraction.  This  can be made  easier by  increasing  the  volume  of the reaction
to  20  p.L after  amplification.  An  alternative  method  1s to  remove  the  PCR  prod-
ucts  to  a new tube  before  phenol/chloroform  extraction.
24.  Nondenaturing  gel  conditions  are used because the  degree  of resolution  is greater
over  a shorter  distance  compared  to  a denaturing  system.  This  has an  effect  on
interpretation  of  dinucleotide  repeats  (see Note  26).
25.  The  electrophoresis  time  depends  on  the  mtcrosatellite  in  question.  In  an  8%
polyacrylamide  gel,  xylene  cyanole  migrates  at  a  rate  equivalent  to  80  bp  of
double-stranded  DNA.
26.  Interpretation  of  dinucleotide  microsatellites  (CA  repeats)  is not  straightforward.
The  phenomenon  of  “stuttering”  is  seen  where  for  reasons  that  are  at  present
unknown,  amphcation  of  an  allele  of  a  CA  repeat  yields  decreasing  amounts  of
products  that  are 2 and 4 bp (and  occasionally  6 bp)  smaller  than  the  expected  size.
In  addition,  when run  on nondenaturmg  gels bands migrating  behind  the  allele  and
its  stutter  bands  are seen. These  are due  to  the  double-stranded  DNA  forming  an
alternative  conformation  with  reduced  mobility  and are not  seen under  denaturing
conditions.  Therefore,  the key  to  interpretation  is first  to  distinguish  the  bands that
represent  the allele  from  the “stutter”  and “conformational  bands”  (see Fig.  3). This
can be  difficult  if  the  sample  IS heterozygous  for  alleles  that  differ  by  2 bp.
PCR  Techniques  for  DMD/BMD  33
1  2  3  4  5
Conformation  band  —
Allele  (n)
n-2  shmer


n4  stutter  –  –



A  B  C  A-B  A-C
Fig.  3. Analysis  of microsatellite  markers  on nondenaturing  gels.  Tracks  1 ,2, and  3
represent  alleles  A,  B,  and  C  that  each  differ  by  2  bp.  Track  4  is  heterozygous  for
alleles  A  and  B.  Note  the  presence  of  two  conformation  bands  and  allele  B  is  rein-
forced  by  the  n-2  stutter  from  allele  A.  Track  5  is heterozygous  for  alleles  A  and  C.
Note  that  a  third  conformation  band  is  sometimes  seen  between  the  two  expected
bands.  The  reason  for  this  is  unknown.
Fig.  4. Recombination  frequencies  across the  dystrophin  gene.  Abbreviations:  ~84,
pERT84;  ~87,  pERT87.
27.  Ideally,  when  performing  DMD/BMD-linked  marker  analysis,  a  family  should
be  made  informative  with  three  markers-one  at either  end  of  the  gene  plus  one
in  an  intermediate  position.  The  intermediate  marker  should  preferably  be
between  the  two  recombination  hot  spots  in  introns  3  and  45  (see Fig.  4).  The
first  choice  of markers  are DYSII,  STR44,  and  3’-DYS.  The  latter  is  often  unin-
formative  in  which  case STRHI,  STR49,  or  STRSO  should  be  used.  If  these  are
used,  the  error  rate  is  increased,  since  there  is  a small  chance  of  recombination
between  the  marker  and  the  3’ end  of  the  gene.
References
1.  Koenig,  M.,  Monaco,  A.  P.,  and  Kunkel,  L.  M.  (1988)  The  complete  sequence  of
dystrophin  predicts  a rod-shaped  cytoskeletal  protein.  Cell  53,2  19-228.
2.  Roberts,  R.  G.,  Coffey,  A.  J.,  Bobrow,  M.,  and  Bentley,  D.  R.  (1993)  Exon  struc-
ture  of the  human  dystrophin  gene.  Genomics  16,536-538.
34  Mountford
3.  Abbs,  S., Roberts,  R.  G.,  Mathew,  C.  G.,  Bentley,  D.  R.,  and  Bobrow,  M.  (1990)
Accurate  assessment  of mtragemc  recombination  frequency  within  the  Duchenne
muscular  dystrophy  gene.  Genomrcs  7,602-606.
4.  Oudet,  C.,  Hanauer,  H.,  Clemens,  P.,  Caskey,  T.,  and  Mandel,  J  L.  (1992)  Two
hot  spots  of  recombmation  in  the  DMD  gene  correlate  with  the  deletion  prone
regions.  Hum  Mol.  Genet  1,599-603.
5  Bakker,  E., Veenema,  H  , Den  Dunnen,  J. T.,  van Broeckhoven,  C.,  Grootscholten,
P.  M.,  Bonten,  E.  J.,  and  van  Ommen,  G.  J.  B.  (1989)  Germmal  mosaicism
increases the  recurrence nsk  for new DMD  mutations.  J. Med  Genet.  26,  W-559
6  van  Essen,  A.  J., Abbs,  S., Baiget,  M  , Bakker,  E.,  Boileau,  C.,  van  Broeckhoven,
C.,  et al.  (1992)  Parental  orlgm  and germline  mosalclsm  of  deletions  and  duplica-
tions  of  the  dystrophin  gene:  a European  study.  Hum  Genet.  88,  249-257.
7  Den  Dunnen,  J. T.,  Grootscholten,  P.  M.,  Bakker,  E.,  Blonden,  L.  A.,  GmJaar,  H.
B.,  Wapenaar,  M  C.,  et al.  (1989)  Topography  ofthe  DMD  gene,  FIGE  and cDNA
analysis  of  194  cases reveals  115  deletions  and  13  duplications  Am  J  Hum.
Genet  45,835-847
8.  Forrest,  S , Cross,  G.  S.,  Speer,  A.,  Gardner-Medwm,  D.,  Burns,  J.,  and  Davies,
K.  E.  (1987)  Preferential  deletion  of  exons  in  Duchenne  and  Becker  muscular
dystrophies.  Nature  329,638-640.
9  Beggs,  A.  H.,  Koenig,  M.,  Boyce,  F. M  , and  Kunkel,  L.  M  (1990)  Detection  of
98%  of  DMD/BMD  gene  deletions  by  polymerase  chain  reaction.  Hum  Genet.
86,45-48.
10  Roberts,  R.  G.,  Barby,  T.  F.  M.,  Manners,  E.,  Bobrow,  M.,  and  Bentley,  D.  R.
(1991)  Direct  detection  of  dystrophin  gene  rearrangements  by  analysis  of
dystrophin  mRNA  m  peripheral  lymphocytes.  Am.  J  Hum  Genet.  49,298-3  10.
11.  Roest,  P  A.  M.,  Roberts,  R  G  , Sugino,  S , van Ommen,  G  J  B.,  and Den  Dunnen,
J  T  (1993)  Protein  truncation  test (PTT)  for  rapid  detection  of  translation  termi-
nating  mutations.  Hum  Mel  Genet.  2,  1719-1721
12  Roberts,  R.  G.,  Gardner,  R.  J.,  and  Bobrow,  M.  (1994)  Searching  for  the  1  in
2,400,OOO:  a review  of  dystrophin  gene  pomt  mutations.  Hum.  Mutat  4,  l-l  1.
13.  Rinisland,  F.  and  Rerss,  J  (1994)  Microlesions  and  polymorphisms  in  the
DMD/BMD  gene.  Hum  Genet  94,11  l-l  16.
14  Clemens,  P.  R.,  Fenwlck,  R.  G.,  Chamberlain,  J  S., Gibbs,  R  A.,  de Andrade,  M.,
Chakraboty,  R.,  and  Caskey,  C. T.  (I  99 1) Carrier  detection  and prenatal  diagnosis
in  Duchenne  and  Becker  muscular  dystrophy  families  using  dmucleotide  repeat
polymorphisms.  Am.  J.  Hum.  Genet.  49,951-960.
15.  Reid,  T.,  Mahler,  V.,  Vogt,  P.,  Blonden,  L.,  van  Ommen,  G.  J. B.,  Cremer,  T.,  and
Cremer,  M.  (1990)  Direct  carrier  detectlon  by  in-situ  hybrldisation  with  cosmld
clones  of  the  DuchennelBecker  muscular  dystrophy  locus.  Hum  Genet  85,
581-586.
16.  Kodaira,  M.,  Hlyama,  K.,  Karakawa,  T.,  Kameo,  H.,  and  Satoh,  C. (1993)  Duph-
cation  detection  in  Japanese  Duchenne  muscular  dystrophy  patients  and  identlfi-
cation  of  carriers  of  partial  gene  deletions  using  pulsed-field  gel  electrophoresls.
Hum  Genet  92,237-243.
PCR  Techniques  for DMDlBMD  35
17.  Schwartz,  L.  S.,  Tarleton,  J.,  Popovtch,  B.,  Seltzer,  W.  K.,  and  Hoffman,  E.  P.
(1992)  Fluorescent  multiplex  linkage  analysis  and carrier  detection  for  Duchenne/
Becker  muscular  dystrophy.  Am.  J.  Hum.  Genet  51,721-729.
18.  Mansfield,  E.  S.,  Robertson,  J.  M.,  Lebo,  R.  V.,  Lucero,  M.  Y.,  Mayrand,  P.  E.,
Rappaport,  E.,  et al.  (1993)  Duchenne/Becker  muscular  dystrophy  carrier  detec-
tion  using  quantitative  PCR  and fluorescence  based  strategies.  Am  J  Med  Genet
48,2C@-208.
19.  Lathrop,  G.  M.  and  Lalouel,  J.  M.  (1984)  Easy  calculation  of  LOD  scores  and
genettc  risks  on  small  computers.  Am  J.  Hum.  Genet  36,46M65.

3
Detection  of  Unstable  Trinucleotide  Repeats
Andrew  J.  Wallace
1. Introduction
Unstable  trinucleotide  repeats  are  a newly  recognized  class of  disease
mutation.  Several  major  human  single  gene  disorders  are  now  attributed  to
expansions of these highly  unstable sequences (I-4).  Their  molecular  analysis
is particularly  challenging,  since:
1.  Accurate allele sizing is essential;
2.  Polymerase chain reaction (PCR) amplification across the repeat 1s hampered by
extreme guanme cytosme (GC) content and strong secondary structure, and
3.  Size differences between normal and mutated alleles may be great, for instance,
in fragile X  they can range from 6 to over  1000 repeats
In  this chapter  the analysis of  four  important  diseases for  a service  labora-
tory, fragile  X  syndrome, myotonic  dystrophy (MD),  Huntington  disease (HD),
and spinal  bulbar  muscular  atrophy  (SBMA)  is detailed.  All  four  diseases are
amenable to analysis by a modified  PCR reaction  followed  by polyacrylamide
gel  electrophoresis  and  visualization  using  a simple  silver  staining  protocol.
With  the exception  of  SBMA,  Southern blotting  is necessary in  at least some
diagnostic  cases to visualize  the larger  repeats.
A low  magnesium  buffer  is used for  PCR amplification;  this maintains  high
levels  of  Taq  polymerase  activity  while  facilitating  amplification  of  GC-rich
templates. These are notoriously  refractory  to PCR because of  a combination
of  high  strand  dissociation  temperatures  and strong  secondary structure,  Ten
percent dimethyl  sulfoxide  (DMSO)  is added to the reactions to lower  the dls-
sociation temperature  of dsDNA  and to reduce secondary structure effects. The
nucleotide  analog, 7-deaza-guanosine triphosphate  (GTP),  is also incorporated
where the template is particularly GC-rich and the repeat length is large. Silver stain-
From  Methods  m  Molecular  Medmne  Molecular  Dlagnosrs  of  GenetIc  Dfseases
Edlted  by  R  Elles  Humana  Press  Inc  ,  Totowa,  NJ
37
38  Wallace
ing  is  used  to  visualize  the  amplified  PCR  products.  This  is the  method  of  choice
since  it  is  cheap,  rapid,  relatively  safe,  and  5-10  times  more  sensitive  than
ethidnun  bromide  staining.  Also  it  1s capable  of  staining  both  ssDNA  and  dsDNA.
Southern  blotting  is  employed  to  detect  the  presence  of  the  largest  trinucle-
otide  repeats.  Southern  blotting  is  a  form  of  direct  genome  analysis,  Genomic
DNA  is  cut  by  an  appropriate  Type  II  restriction  endonuclease  to  yield  the
sequence  of  interest  within  a suitably  sized  DNA  fragment  (usually  500-l  2,000
bp).  The  DNA  is  size  fractionated  by  electrophoresrs  on  agarose  gels  and  trans-
ferred  as ssDNA  from  the  gel  onto  an  inert  (usually  nylon)  membrane  by  cap-
illary  action,  forming  a faithful  replica  of  the  gel.  The  fragment  of  interest  is
revealed  by  probing  the  membrane  with  a radioactively  labeled  DNA  fragment
of  complementary  sequence.  An  adaptation  of  standard  Southern  blotting
where  PCR-amplified  DNA  IS transferred  from  a gel  is  used  to  detect  mterme-
diate  trinucleotide  repeats  m  MD.
2.  Materials
2.7.  PCR  Amplification,
Polyacrylamide  Gel  Electrophoresis,  and  Silver  Staining
Analytical  grade  reagents  should  be used at all  stages unless  otherwise  indicated.
1.  20X  PCR  amplification  buffer  l.OM  Tris-HCl,  pH  9.0,  400  mM  ammonium
sulfate,  30  mA4magnesium  chloride.  Filter  sterilize  and  store  as  1 ml-ahquots
at -2Q’C.
2.  Deoxynucleoside  triphosphates  (dNTPs):  These  can be purchased  individually  at
100  mMconcentration,  i.e.,  Boehringer  Mannheim  (Mannheim,  Germany).  Pre-
pare  for  use  by  diluting  down  to  10 mM  concentration  in  sterile  dHzO  and  mix
together  to  form  an equimolar  mix  of all  four  dNTPs  (or dATP,  dCTP,  and dTTP
if  7-deaza-GTP  is  to  be used  in  the  PCR  reaction).  Store  frozen  as ahquots  at
-2OY!,  avoid  excessive  freezing  and thawing,
3.  7-deaza-GTP:  Store  at -2O”C,  aliquot  to  avoid  excessive  freeze-thaw  cycles,  do
not  use  beyond  expiration  date,  and  do  not  store  as  a  solution  with  other
deoxynucleoside  triphosphates.
4.  Tug  polymerase:  The  author  recommends  Tuq  polymerase  from  Perkin-Elmer
Cetus  (Buckinghamshire,  UK),  Boehringer  Mannhelm,  or Life  Technologies  Inc.
(Gaithersburg,  MD).  Store  at -20°C  Quantities  recommended  for  PCR  assume  a
Taq  polymerase  activity  of  5 U/uL.
5.  DMSO.
6.  Formamide  loading  buffer:  10 rnL  formamide,  200  uL  OSM  EDTA,  pH  8.0,  15  mg
xylene  cyanole,  3 mg  bromophenol  blue
7.  Ammonium  persulfate  (AMPS):  Prepare  a 10% solution  that  can be stored  at 4°C
for  up  to  24  h.
8.  Six  and  8%  (19:l)  sequencing  grade  acrylamide,  ready  to  use,  i.e.,  Sequagel  6
and  Sequagel  8 (National  Diagnostics,  Atlanta,  GA).
Detection  of  Trinucleotide  Repeats  39
9.  Polyacrylamide  mimgel  system.  ATT0  AE6210  slab  gel  system  (Genetic
Research  Instrumentation,  Essex, UK).
10  Electrophoresis  power  pack:  This  should  be  capable  of  maintaining  a constant
current  of  50  mA  and  voltage  400  V.
11.  Silver  staining  solution  A.  10%  ethanol  (industrial  grade)  0.5%  acetic  acid.  Pre-
pare  on the  day  of  use. Store  at  room  temperature.
12.  Silver  staining  solution  B:  0.1%  AgNO,.  Prepare  a  10X  stock  solution  of  1%
AgNO,  and  store  at  room  temperature  in  a brown  bottle.  1X  solution  should  be
stored  in  clear  bottles  at room  temperature  but  away from  light.  The  1X  solution
may  be  reused  to  stain  up  to  five  gels.
13.  Silver  staining  solution  C:  1.5% NaOH,  0.15%  formaldehyde.  This  solution  is labile,
add  the  formaldehyde  immediately  (i.e.,  within  3 min)  before  use (see Note  1).
14.  Silver  staining  solution  D:  0.75%  NazCO,.  Prepare  a 10X  stock  of 7  5% Na,CO,.
Store  at room  temperature.
15.  Cellophane  sheets (i.e.,  part  no.  SE1202  Hoefer  Scientific  Instruments,  San Fran-
cisco,  CA).
16.  Drying  frame  and platform  (i  e., part  nos  SE1210  and  SE1214  Hoefer  Scienttfic
Instruments).
17.  Flat  capillary  gel  loading  tips,  1.e ,  Stratatips  (Stratagene  Cloning  Systems,  La
Jolla,  CA).
2.2.  Southern  Blotfhg
Purity  of  reagents  is  of  utmost  importance  for  success,  ensure  that  analytical
grade  reagents  are  used  for  the  preparation  of  all  solutions.
1.  A  20  x 20-cm  submarine  gel  electrophoresis  tank  suitable  for running  agarose gels
is essential,  i.e.,  Horizon  20.25  system  (Life  Technologies).  Buffer  recirculation  IS
a very helpful  feature because of the long  electrophoresis  times  involved,  although  in
tanks  without  this  facility  the electrophoresis  buffer  may  be changed  during  the run.
2.  An  electrophoresis  power  pack:  Most  cheaper  basic  models  should  be  adequate,
i.e.,  model  400L  (Life  Technologies).
3.  A  temperature  controlled  rotisserie  style  hybridization  oven,  i.e.,  midihybridiza-
tion  oven  (Hybaid,  Middlesex,  UK)  (see Note  2).
4.  Agarose:  This  is available  from  many  manufacturers  but  should  be  electrophore-
sis grade.
5.  Restriction  enzymes:  EcoRI  and EcZXI  are needed  for  fragile  X  analysis.  EcoRI
alone  is used for  MD  analysis,  whereas PstI  is used for  HD.  The  author  has expe-
rience  with  enzymes  supplied  by  Boehringer  Mannheim,  Life  Technologies,  and
New  England  Biolabs  (Beverley,  MA).  Restriction  enzymes  are  supphed  with
their  own  reaction  buffers.  Store  at -2OY!.
6.  Probes:  0X1.9,  fragile  X  (S), pGB2.6,  MD  (6) (see Note  3),  4g6Pl.8,  HD.
7.  TBE  electrophoresis  buffer:  Make  as a  10X  stock  solution,  0.89M  Tris,  0.89M
boric  acid,  0.02h4  EDTA,  pH  8.0.  Store  at room  temperature
8.  5X  TBE  gel  loading  buffer:  5 mL  10X  TBE,  4.9  mL  glycerol,  0.1%  SDS,  3 mg
bromophenol  blue,  and  15 mg  xylene  cyanol.  Store  at room  temperature.
40
9.
10
11
12
13
14.
15.
16
17.
18
19.
20.
21.
22.
Wallace
Phosphate  prehybridization/hybrldlzation  solution  (PPH):  Prepare  prehybridiza-
tion  solution  as a 2X  stock,  0.5MNaH,PO,,  O.SMNaCl,  and  1 mMEDTA,  adjust
pH  to  7.5  with  5A4 NaOH  Store  2X  stock  solution  at room  temperature.  When
ready  to  use, dilute  with  dH,O  and  add  SDS  to  0.5%.  For  hybridization  solution
add  polyethylene  glycol  (PEG  6000)  to  6%  The  probes  PGB2.6  and  4g6P1.8
require  further  blocking  with  Denhardt’s  solution  and  herring  sperm  (HS)  DNA
(see Notes  4 and  5).
50X  Denhardt’s  solution:  0.5%  ficoll,  0.5%  polyvmylpyrrohdone,  0.5%  bovine
serum  albumm  (BSA)  (Pentax  fraction  V)  Filter  sterilize  and  store  as aliquots
frozen  at -20°C.
HS  DNA:  Prepare  as a 5 mg/mL  stock  solution,  shear by repeatedly  syringmg  the
solution  through  a fine-gage  needle  Store  frozen  in  ahquots  at -20°C.
Random  primer  labeling  kit:  A  commercially  manufactured  kit  is  the  easiest
option,  ones  based  on  random  hexanucleotide  primers  are  adequate,  i.e.,
Multiprime  (Amersham  International,  Buckmghamshue,  UK).  There  are  others
on  the  market  that  use random  nonanucleohdes  as primers.
a32PdCTP  radioisotope  label  (Amersham  International).  Store  at  -20°C  Note
that  storage  and  use  of  radioactive  materials  is  governed  by  national  and  local
safety  regulations
Denaturing  solution.  1 5MNaC1,  0  5MNaOH  Store  at  room  temperature.
20X  SSC.  3M  NaCl,  0 3M  Na-citrate.  Store  at  room  temperature.
Positively  charged  nylon  membrane  for  DNA  transfer,  i  e.,  Hybond  N+  (Amer-
sham  International).
500-Gage  polythene  layflat  tubing  (P&B  Plastics,  Stockport,  UK).
Autoradiograph  cassettes fitted  with  blue  emitting  mtensifymg  screens, i  e , High
Speed  X  (X-Ograph,  Wiltshire,  UK).
X-ray  film:  Fuji  RX  (FUJI  Photo  Film  Co.,  Tokyo,  Japan).
A -70°C  freezer.
A  slow  orbital  shaker,  1 e , The  Swuler  (Hybaid,  Middlesex,  UK)
A  shortwave  UV  transilluminator
2.3.5’  End  Labeling  of  a  (CTG),  Oligonucleotide  Probe
for  Detection  of  intermediate  MD  Trinucleotide  Expansions
1.  A  synthetic  oligonucleotide  (CTG)s  probe.  Dilute  down  to  10  ng/pL  in  sterile
dH20  and  store  at -20°C.
2.  20X  SSPE:  3MNaC1,O  2MNaH2P04,  0.02MEDTA  Adjust  pH  to  7  6 with  5M
NaOH  Store  at room  temperature.
3.  T4  polynucleotide  kmase  (Amersham  International).  Store at -20°C
4.  10X  Polynucleotide  kmase  buffer  0.5M  Tris-HCl,  pH  7 6,  100  mM  MgCl,,
100  mM  dithiothreitol,  500  ug/mL  BSA  (fraction  V)  Filter  sterilize  and  store  as
1-mL  ahquots  at -20°C.
5.  y32PdATP  radioisotope  label  (Amersham  International).  Note  that  use and  stor-
age of radioactive  materials  is governed  by  national  and  local  safety regulations.
6  100 mMEDTA,  pH  8.0  stop  solution.  Store  at  room  temperature
Detection  of  Tr~nucleotide  Repeats  41
3.  Methods
3.1.  PC/?  Amplification,  Polyacrylamide  Gel  Electrophoresis,
and  Silver  Staining  of  Trinucleotide  Repeats
3.1.1.  PCR  Amplification
1  This  has been  covered  in  detail  in  Chapter  2.  The  components  of the  PCR  reac-
tion,  however,  do  differ  for  optimal  ampliticatton  of  trinucleotide  repeats  For
amplifications  not  requiring  7-deaza-GTP  (see Table  1) reactions  should  be pre-
pared  as follows  0.5  pL  20  x  PCR  buffer,  1 .O pL  forward  and  reverse  primer
(5  weach),  1 .O pL  10 mA4dNTPs  (2.5  mMdATP,  dCTP,  dGTP,  dTTP),  0  1 pL
Z’aq polymerase  (0  5 U),  1 .O PL  genomm  DNA  (5-25  ng),  and  6 4  uL  dH20
2.  The  following  mastermix  substituting  7-deaza-GTP  for  GTP  is recommended  for
GC-rtch  trmucleotide  repeat  templates  (see Table  1)  0.5  pL  20X  PCR  buffer,
1 .O pL  forward  and  reverse primer  (5  @4 each),  0.75  PL  10 mM  dNTPs  (3.3  mA4
dATP,  dCTP,  dTTP),  0.25  pL  7-deaza-GTP  (10 mM),  1 .O pL  DMSO,  0.1  pL  Tuq
polymerase  (0.5  U),  1.0  pL  genomic  DNA  (5-25  ng),  and  5.4  pL  dH,O.
3.  “Hot  Start”  PCR  gives  optimal  amphfication  with  the  Huntington  primers  A  and
B  (Table  1)  This  can  be  done  cheaply  by  omitting  Tuq  polymerase  and  dHzO
from  the  reactions  and  adding  them  to  the  PCR  reactions  while  they  are passing
through  the imttal  denaturation  at 95’C  on the thermal  cycler.  Alternattvely,  propn-
etary wax plugs  may  be purchased for this  purpose.
4  When  thermal  cycling  1s complete,  samples  should  be  electrophoresed  on  the
same  day,  or,  if  this  is not  possible,  stored  frozen  at -20°C.  Prior  to electrophore-
sis,  the  samples  should  be  removed  to  a  fresh  microcentrifuge  tube  and  mixed
with  an equal  volume  of  formamide  loading  buffer.
3.1.2.  Polyacrylamide  Gel  Electrophoresis
1,  Assemble  a clean  set of glass plates  with  gasket  in the  casting  tray.  No  sihcomzing
treatment  is necessary.
2.  Pour  30  mL  of  the  appropriate  concentration  Sequagel  acrylamide  into  a  clean
beaker.
3,  Add  240  uL  of  freshly  made  10%  ammonium  persulfate  solution  to the  Sequagel
and  swirl  gently  to  mix.
4  Draw  the  acrylamide  solution  carefully  into  a 50-mL  disposable  syringe.  Try  to
avoid  introducing  an  bubbles.
5.  Place  the  assembled  glass  plates  and  casting  tray  vertically  on  the  bench  and
slowly  pour  the  acrylamide  between  the  glass plates.  Any  air  bubbles  introduced
while  pouring  can be removed  by carefully  tilting  the meniscus  of the acrylamtde
solution  down  to  the  level  of the  bubbles.
6.  Insert  an  appropriate  comb,  taking  care  not  to  trap  any  air  bubbles  and  leave  to
polymerize  horizontally  for  1 h (see Notes  6 and  7).
7.  Dismantle  the  casting  tray  and  carefully  pull  the  sillcone  rubber  gasket  from
between  the  edges  of  the  glass  plates.
Table  1
Conditions  for  PCR  Amplification  and  Polyacrylamide  Gel  Electrophoresis
Disease  Primer  sequences
PCR  Product  size  Acrylamide  7-deaza-GTP
amplification  with  no  concentration,
conditions  repeats,  bp  %  d:;P
Fragile  X  S-TCCGGTGGAGGGCCGCCTCTGACC-3’
5’-TTCAGCCCTGCTAGCGCCGGGAGC-3’
MD  S-CTTCCCAGGCCTGCAGTTTGCCCATC-3’
5’-GAACGGGGCTCGAAGGGTCCTTGTAGC-3’
e
HD  Primer  A
5’-GCCTTCGAGTCCCTCAAGTCCTTC-3’
Primer  B
5’-GGCGGTGGCGGCTGTTGCTGCTGC-3’
Primer  C
5’-AAACTCACGGTCGGTGCAGCGGCTC-3’
SBh4A  S-TCCAGAATCTGTTCCAGAGCGTGC-3’
5’-GCTGTGAAGGTTGCTGTTCCTCAT-3’
95°C:  1 min
65°C:  1 min
72’C:  2 min
35  cycles
95°C:  1 min
62°C:  1 min
72°C:  2 min
30  cycles
95°C:  1 min
60°C:  1 min
72°C:  2 min
30  cycles
95°C:  1 min
60°C:  1 min
72°C:  2 min
30  cycles
159  6  7-deaza-GTP
113  6  Either
(A  +  B)  42  S(A+B)  7-deaza-GTP
(A  +  C)  188  6(A+C)
218  6  dGTP
Detection  of  Trinucleotide  Repeats  43
8.  Make  800 mL  of  1X  TBE  electrophoresis  buffer  from  the  10X  TBE  stock  solution
and  pour  into  the bottom  of an electrophoresis  tank  until  its  level  just  reaches the
gasket  that  forms  the  upper  buffer  chamber  when compressed  by  the  gel  plates.
9.  Place  the  gel  plates  in  the  electrophoresis  tank  taking  care  not  to  introduce  any
bubbles  along  the  bottom  edge  of the  plates,  insert  the  wedge/compressor  in  the
appropriate  orientation  for  l-mm  gels.
10.  Place  the  remaining  electrophoresis  buffer  in  a large  conical  flask  and  heat  in  a
microwave  oven  until  it  reaches a temperature  of approx  60°C.  Fill  the top  buffer
tank  with  hot  electrophoresis  buffer.  (This  has  the  effect  of  heating  the  gel
obviating  the  need  for  pre-running.)  Remove  the  comb  and  flush  urea  and
unpolymerized  acrylamide  from  the  wells  with  a dtsposable  syringe  and  hypo-
dermic  needle.
11.  Place  the  samples  on  a heated  block  or thermal  cycler  set at  95°C  for  5  min  and
cool  on  ice  to  quench  reannealing  of the  ssDNA.  Load  6-10  pL  of  the  sample  in
each well  (depending  on  the  size of the  wells  and  amplificatron  efficiency)  using
thin  gel  loading  trps.  Place  the  cover  and  leads  on  the  electrophoresis  tank  and
electrophorese  at  50  mA  constant  current.  See  Table  1 for  details  of  expected
molecular  weights  of  DNA  fragments.
3.1.3.  Silver  Staining
1.  Gently  prize  the  glass  plates  apart,  avoiding  using  metal  instruments  that  may
cause  the  plates  to  chip.  Mark  the  orientation  of  the  gel  by  cutting  the  corner
adjacent  to  lane  no.  1. Place  in  a plastic  tray  containing  300  mL  of  solution  A,
leave  on  a slow  orbital  shaker  for  3 min,  pour  off,  and  reimmerse  in  a further  300
mL  of solution  A  (see Note  8).
2.  Pour  off  solution  A  and  add  400  mL  of  solution  B  and  gently  shake  for  15 min
Pour  off  solution  B  (remember  to  recover  and  reuse  solution  B  until  staining
efficiency  declines).  Rinse  the  gel  quickly  wrth  two  changes  of  distilled  water
(see Note  9).
3.  Add  300  mL  of@e&ly  made  solution  C  and  leave  the  gel  to  develop,  shaking
gently,  in  a fume  cupboard  for 20  min.  A  small  amount  of powdery  metallic  silver
precipitate  should  be observed when this  solution  is added  to the gel.  Brown/black
bands  on  a yellow  background  slowly  appear  on  the  gel  during  this  stage.
4.  Pour  off  solution  C and  add  300  mL  of  solution  D and  leave  for  15 min.
3.7.4.  Drying  and  Storing  Gels
1.  Cut  two  sheets of  cellophane  to  size and  soak  in  a sink  or  tray  of tap  water  for  a
few seconds.  The  sheets will  become  heavy  and pliable  when wetted.  Ensure  that
the  whole  sheet  is thoroughly  wetted.
2.  Place  one morstened  cellophane  sheet flat  over an assembled  platform  and drying
frame  inner  section  Ensure  that  the  inner  section  is  facing  correctly  upward.
3.  Carefully  transfer  the  gel  onto  the  surface  of the  cellophane  sheet and  trim  away
any unwanted  areas using  a ruler  pressed  hard  onto  the  gel  surface.  Thoroughly
wet the  gel  and  cellophane  by  spraying  with  a wash bottle.
44  Wallace
4.  Lay  the  second  cellophane  sheet  on  top  of  the  gel  and  frame,  takmg  care  to
exclude  au  bubbles  Place  the  outer  section  of the  drymg  frame  firmly  in  over  the
inner  frame’s  rubber  gasket,  drawing  the  cellophane/gel  sandwich  taut
5.  Lrft  the  drying  frame  off  the  platform  and  turn  the  retaining  screws to  hold  the
cellophane/gel  sandwtch  m  place  Sponge  excess water  from  the  cellophane  sur-
face using  a tissue  and  place  to  dry  m  a 37’C  incubator  for  approx  6 h or  alterna-
ttvely  on  a benchtop  m  a warm  room  for  approx  20  h
6  When  the  gel  is  thoroughly  dry,  dtsmantle  the  frame  and  cut  the  gel  from  the
excess cellophane  with  scissors, leaving  a border  of  l-2  cm  around  the  gel.  Seal
the  perimeter  of  the  cellophane  by  folding  strtps  of  adhesive  tape  over  all  the
edges  This  prevents  peeling  of  the  drted  gel
7  Do  not  bend  or fold  the dried  gels  and store flat  away from  moisture,  avoid  abrad-
mg  the  surface  of  the  cellophane  (see Note  10)
3.2.  Southern  Blotting
for  Analysis  of  Large  Trinucleotide  Expansions
3.2.1.  RestrIction  Digest/on  and  Gel  Electrophoresis
1.  The  genomic  DNA  samples  need  to  be  cut  with  restrrctron  enzymes  prior  to
electrophoresis.  The  restriction  enzyme(s)  used  depends  on  the  disease  being
studied  (see Table  2).  Prepare  restnctton  digests  of all  the  samples  to  be analyzed
in  etther  0 6-  or  1.6-mL  microcentrrfuge  tubes as follows:  5 pg  of genomtc  DNA,
3  pL  of  10X  restriction  enzyme  buffer,  10  U  of  each  restriction  enzyme  (typi-
cally,  1 uL),  add  sterile  dH,O  to  30  uL,  and incubate  m  a water  bath  at  37°C  for
at  least  4  h
2  While  the  samples  are dlgestmg,  prepare  an agarose gel  for  electrophoresis  of the
samples  (see Table  2)  For  a typical  20  x  20-cm  format,  the  following  amounts
should  be  sufficient.  35  mL  of  10X  TBE,  3 15 mL  of  dHzO,  2.8  g  (0.8%  gel),
3  15g (0.9%  gel)  or 4  2 g (1.2%  gel)  of  agarose.  The  gel  should  be heated  gently
to  drssolve  the  agarose  either  in  a microwave  oven  or  on  a hotplate  with  a mag-
netic  stirrer bar. Once the agarose has completely  dtssolved  add  17 5 pL  of a 10 mg/
mL  solution  of ethidium  bromide,  swirl  gently  to mrx,  and  allow  the  gel  solutton
to  cool  to  65°C
3.  Place  an appropriate  comb  in  the  gel  former  and  seal the  open  ends  with  plastic
tape.  When  the  gel  has cooled  down  pour  carefully  mto  the  former.  Check  for an
bubbles,  especially  around  the  comb.  These  can be removed  using  a Pasteur  ptpet.
Allow  the  gel  to  set  for  at  least  1 h  before  runnmg;  tf  the  gel  IS  not  requrred
nnmedlately  it  may  be  wrapped  in  cling  film  and  stored  m  a refrigerator  at 4°C
for up  to 48  h  When  ready  to  run  remove  the tape  and  immerse  m  1X  TBE  buffer
to  a depth  over  the  gel  surface of approx  1.5 mm.  Only  remove  the  comb  once the
gel  is  fully  submerged  m  the  runnmg  buffer.
4.  The  samples  should  be monitored  for  complete  drgestton  before  runnmg.  Take
3  pL  of  each  restrictton  digest  and mix  with  1 p,L of  5X  TBE  loading  buffer  and
run  for  30  min  at  60  mA  on  a 0.8-1.0%  agarose  monitor  gel  (monitor  gels  can
Table  2
Conditions  for  Southern  Analysis
Size
of  fragment
Restriction  containing  Electrophoresis  Prehybridization  Hybridization  Stringent
Disease  Agarose,  %  enzyme(s)  repeats,  kb  distance  Probe  solution  solution  wash
Fragile  X  0 9  EcoRI  and  2.8-10  2 kb-20  cm  0X1.9  1X  PPH,
E&U
0.5%  SDS
MD  08  EcoRI  9-14  3 kb-20  cm  pGB2.6  1X  PPH,
e
5X  Denhardt’s
100 l&nL
denatured
HS  DNA,
0.5%  SDS
HD  1.2  PstI  1.2-1.6  0.5  kb-20  cm  4g6Pl  8  1X  PPH,
5X  Denhardt’s,
100 ug/mL
denatured
HS  DNA,
0.5%  SDS
1X  PPH,  1-0.5x  ssc
0.6%  PEG,
0.5%  SDS
1X  PPH,  0.5x  ssc
0.6%  PEG,
5X  Denhardt’s
100 pg/mL
denatured
HS  DNA,
0 S%SDS
1X  PPH,  0.2x  ssc
0.6%  PEG,
5X  Denhardt’s
100 pg/mL
denatured
HS  DNA,
O.S%SDS
46  Wallace
either  be mimgels  made  specifically  for momtoring  purposes  or alternatively  sim-
ply  use two combs  at opposite  ends of your  main  gel  and run  the  main  samples  in
the  opposite  direction  to the monitor  samples).  The  digested  samples  should  then
be vtsuahzed  on  a UV  transtlluminator.  Undigested  or partially  digested  samples
have  a characteristic  streaky  appearance.  Add  an  additional  10 U  of  restriction
enzyme  to  any  uncut  samples  and  reincubate  for  at  least  2 h  (see Note  11).
5.  Once  the  samples  are completely  digested,  mix  each with  9 pL  of dH,O  and  9 pL
of  5X  TBE  loading  buffer.  Load  the  whole  sample  onto  the  gel  using  a  fresh
microplpetor  tip  for  each  sample.  A  mol-wt  standard,  i.e.,  1-kb  ladder  (Life
Technologies)  should  also be loaded  m  one  of the  outer  wells.  Set the  gel  to  run  at
55  mA  in  constant  current  mode  for  at  least  16 h  (see Table  2  for  details  of  the
distance  the  gels  should  be  electrophoresed).
3.2.2.  Southern  Blotting
1.  When  the  gel  has electrophoresed  the  correct  distance  (see Table  2), place  the  gel
on  a UV  transilluminator.  Cut  off  the  mol-wt  marker,  the  wells,  and  any  waste
agarose.  Remember  to  slice  off  a comer  of the  gel  to allow  it  to  be orientated  and
note  the  dimensions  of  the  trimmed  gel.  Transfer  the  gel  into  a plastic  tray  and
submerge  in  denaturing  solution.  Denature  on  a slow orbital  shaker  for  1 h.
2.  Whtle  the  gel  IS  denaturing,  cut  a piece  of  charged  Nylon  membrane  and  two
preces of  Whatman  (Maidstone,  UK)  3MM  filter  paper  to  a size  slightly  larger
than  the  gel.  Mark  or  cut  one  comer  of  the  membrane  to  correspond  to  the  cut
comer  of  the  gel.  Transfer  the  gel  onto  an inverted  gel  casting  tray  and  carefully
place  the  nylon  membrane  onto  the  gel  avoiding  introducing  air  bubbles.  Briefly
wet  the  sheets  of  filter  paper  in  denaturing  solution  and  place  on  top  of  the
membrane.  Complete  the  blot  by  adding  a  stack  of  paper  towels  to  a  depth  of
approx  6  cm  and  compress  with  a suitable  weight  (approx  500  g).  Leave  to  blot
for  12-l  6 h  (see Note  12).
3.  Dtsmantle  the  blot  and  discard  any  damp  paper  towels.  Place  the  membrane  into
a tray  containing  200  mL  of  3X  SSC  and  shake  gently  for  2  min,  pour  off  the
3X  SSC  and  repeat  twice.  The  filter  should  now  be  of  neutral  pH  and  may  be
probed  immediately  or  sealed  in  plastic  while  still  damp  and  stored  at  4°C.
3.2.3.  Probe  Labeling  and  Hybridization
1.  The  mstructions  supplied  with  the  labeling  kit  need to  be followed  with  care  for
successful  labeling.  You  will  be  handlmg  dangerous  radioisotopes  and  need  to
use  adequate  protection  in  the  form  of  perspex  shields.  Remember  to  monitor
both  the  working  area  and  yourself  adequately  after  handling  radioisotopes.
Between  50  and  100  ng  of  probe  should  be  labeled  for  each  Southern  blot  and
most  kits  recommend  that  2.5  to  5  uCi  of  a32PdCTP  be  used  per  labeling  reac-
tion.  Remember  that  single-stranded  DNA  is needed  as a template  for  the  label-
ing  reaction  so you  must  denature  the probe  by  heating  to  100°C  in  a dry  block  or
water  bath  before  adding  to  the  rest  of  the  reaction.  For  safety  reasons  labeling
reactions  should  always  be  carried  out  m  screw-capped  microcentrifuge  tubes,
Detection  of  Trinucleotide  Repeats  47
2.  Make  up  100  mL  of prehybridization  solution  per  filter  by  diluting  down  the  2X
stock  to  1X  and  adding  SDS  to  a final  concentration  of 0.5%.  Place  each filter  in
a separate  hybridization  bottle  from  the  rotisserie  oven,  add the  prehybridization
solution,  and  seal  the  lid  tightly.  Place  in  the  rotisserie  oven,  which  should  be
equilibrated  at 65V.  Set to  rotate,  and  leave  for  at least  1 h to  prehybridize.
3.  Make  up  10 mL  of hybridization  solutron  per  filter  by  adding  0.6  g (0  6%)  PEG
6000  to  10 mL  of prehybridization  solution  in  a clean  Universal  tube.  Place  in  the
rotisserie  oven  for  1 h to  allow  the PEG  to  fully  dissolve.  The  probes  pGB2.6  and
4g6P1.8  require  extra  blocking  (see Note  4).
4.  After  the  required  labeling  time  check  that  the  PEG  has  dissolved  fully  in  the
hybridization  solution  before  pouring  the  prehybridization  solution  away  and
adding  10 mL  of  hybridization  solution.  (Take  care  not  to  allow  the  filter  to  dry
out  at this  stage.) Add  500  pL  of hybridization  solution  wzthout SDS  to the  labeled
probe  and  mix.  Heat  the  probe  to  100°C  for  6 min,  then  cool  for  3 min  in  a water
bath  at  37’C  (this  quenches  reannealing  of  the  probe).  Qurckly  add  the  cooled
probe  to  the  hybridization  solution  in  the  bottle  avoiding  splashing  the  filter.
Replace  the  cap firmly  and place  in  the rotisserie  oven  to rotate  at 65°C  overnight.
3.2.4.  Filter  Washing  and  Autoradiography
1,  Prepare  1 L  of  a wash solution  for  each filter  comprising  SSC  of  the  appropriate
concentration  and  0.1%  SDS  and  equilibrate  at  65°C.  The  strength  of  SSC  used
varies  with  probe  (see Table  1).
2.  Pour  off  the  hybridization  solution  down  a sink  designated  for  the  disposal  of
radioactive  waste and  add  about  100 mL  of wash solution,  Replace  m  the  rotls-
serie  oven  for  approx  30  min.
3.  Remove  the  filter  after  the  first  wash with  a pair  of  forceps  and  place  on  a clean
surface. Monitor  the  radioactivity  using  a Geiger  counter,  if  this  IS >lO  counts  per
second (cps) (with  the  plastic  shield  left  over  the Geiger  detection  window)  wash
in  fresh  solution  for  another  30 min.  Keep  repeating  this  step until  the activity  IS
between  5 and  10 cps or until  no  drop  in  activity  is observed  between  washes.
4.  Esther  heat  seal  the  filter  in  500-gage  plastic  or  wrap  in  cling  film  Place  with  a
sheet  of  X-ray  film  inside  an  autoradiograph  cassette  fitted  with  intensifying
screens in  a darkroom.  Remember  to mark  the  film  in  some  way to  allow  rt to be
properly  orientated,  i.e.,  by  folding  a corner.
5.  Leave  to  expose at -70°C  for  l-5  d before  developing.  The  film  is usually  devel-
oped  after  an overnight  exposure  to  Judge  the  length  of  time  needed  for  a good
result  (see Note  13).
3.3.5’  End  Labeling  of a  (CTG)5 Oligonucleotide  Probe
for  Detection  of  Intermediate  MD  Trinucleotide  Expansions
3.3.1.  Gel  Electrophoresis  and  Southern  Blotting
1,  PCR  amplify  target  DNAs  in  a  1 0-pL  volume  as described  in  Section  3.1.1.
2.  Pour  a  1.2%  20  x 20  cm  agarose  gel  as described  in  Section  3.2.1
48  Wallace
3.  Mix  samples  with  2.5  pL  of 5X  TBE  loading  buffer  and electrophorese  at  100  mA
(see Section  3.2.1.)  until  100 bp  reaches  the  end  of  the  gel.
4.  Blot  the  whole  gel  onto  a  sheet  of  positively  charged  nylon  membrane  as
described  m  Section  3 2.2.
3.3.2.  5’  End  Labeling
and  Hybridization  of  an  Oligonucleotide  Probe
1  Prehybridize  the  filter  by  placing  in  a hybridization  bottle  and  adding  50 mL  of a
solution  compnsmg  5X  SSPE,  5X  Denhardt’s,  and  0.5%  SDS.  Prehybndize  for  1 h
m  a rotating  hybridization  oven  set at 42’C.
2  Prepare  a  labeling  reaction  m  a  1.5-n&  screwcapped  microcentrifuge  tube  as
follows:  1 pL  10X  polynucleotide  kmase  buffer,  1 uL  (CTG)S  ohgonucleotide
probe  (10  ng/pL),  2  pL  y32PdATP  label,  5  pL  sterile  dH,O,  and  1 pL  T4  poly-
nucleotide  kinase  (10  U).
3.  Mix  the  labeling  reaction,  briefly  spin  down,  and  incubate  at 37°C  for  30  mm
4.  After  30  min  stop  the  reaction  by  adding  10  pL  of  100  mA4  EDTA  stop
solution.
5.  Pour  away  the  prehybridizing  solution  and  add  an  additional  10  mL  of  5X
SSPE,  5X  Denhardt’s,  and  0  5%  SDS  solution.  Carefully  add  the  labeling  reac-
tion  to  this  solution  at  the  bottom  of  the  bottle,  avoidmg  touching  the  filter.
Firmly  seal the  bottle  and  hybridize  for  at least  1 h while  rotatmg  m  the  oven  at
42°C  (see Note  14).
6.  Pour  off  the  hybridization  solution  down  a smk  designated  for  disposal  of  radio-
isotopes.  Wash  away  the  unbound  probe  with  3  x  100  mL  room  temperature
rinses  with  2X  SSPE,  0.1%  SDS.  For  the  stringent  wash add  50 mL  of  2X  SSPE,
0  1%  SDS,  and  incubate  while  rotating  at 42OC for  20  min.
7.  Pour  off  the  stringent  wash and carefully  remove  the  filter  from  the  hybridization
bottle.  (Protective  screens must  still  be  used smce  the  filter  should  still  be radio-
active  ) Seal  the  filter  while  still  damp  m  plastic.
8.  In  a darkroom  place  the  filter  with  a sheet  of  X-ray  film  in  an  autoradiograph
cassette.  The  first  autoradiograph  can  be  developed  after  a  l-h  incubation  at
room  temperature  Further  exposures  can  then  be judged  depending  on  the  ini-
tial  result
3.4.  Interpretation  of  Results
3.4.1.  Appearance  of  Trinucleotide  Repeat  Alleles
on  Silver-Stained  Gels
Trmucleotide  repeat alleles  do not appear as single discrete DNA  bands on
polyacrylamide  gels but  as an  allelic  band  accompanied  by  one  to  several
“stutter”  bands.  This  IS owing  to  an artifact  originating  during  PCR.  Most
Taq  polymerases  do  not  have  proofreading  activity  and  occasionally  slip-
page occurs during  replication  of the trmucleotide  repeat. This  leads to omis-
sion of  multiples  of  the repeat unit.  The  allehc  band  should  be interpreted  as
Detection  of  Trinucleotide  Repeats  49
the  strongest  band  (e.g.,  mol-wt  IZ bp)  the  accompanying  stutter  bands  are
progressively  weaker  at multiples  of n minus the length  of  the repeat unit  (for
trinucleotides,  3 bp).  The  number  of  stutter bands does not  remain  constant
but mcreases with  increasing  repeat length.  Furthermore,  once a certain  limit
is reached  this pattern  breaks down  and stutter bands at multiples  of  n plus  3
also  occur.  When  determinmg  the  size of  these larger  alleles  the  strongest
band  should  still  be used. Given  these circumstances  identifying  heterozy-
gotes for  closely  spaced alleles  is difficult  but  with  experience  they  can be
reliably  recognized  (see Fig.  1 for  examples).
3.4.2.  Allele  Sizing
Alleles  can be sized provided  a suitable mol-wt  marker  is also run  on each
gel. The  logi  bp of  each fragment  of  the marker  should be plotted  against the
distance migrated  from  the origin  (the wells)  to create a calibration  curve  spe-
cific  to the gel. The molecular  weights  of  the alleles can then be calculated  by
mterpolation  on the calibration  curve.  Provided  care is taken at all  stages, this
method  of  stzmg is usually  reproducible  to one repeat unit  (+3 bp). Allele  siz-
mg IS usually not necessary since most alleles clearly  fall  into  either the normal
or the expanded range.
3.4.3.  Fragile  X  Interpretation
3.4.3.1.  FRAGILE  X  REPEAT SIZE  RANGE
The  common  fragile  X  mutation  is an expanding  (CGG),  repeat located  in
the  5’  untranslated  region  (UTR)  of  the  FMR-1  gene.  The  FMR-1  gene  is
located  on the long  arm of  the X-chromosome  at location  Xq27.3.  The  nor-
mal  size of  the FMR-  1 trinucleotide  repeat is considered  to lie between  6 and
54 repeats  (7).  The  most common  alleles  are between  28 and 30 repeats and
over  98%  of  all  normal  alleles  are below  46 repeats. Some alleles  within  the
transitional  range,  from  46-54  repeats,  are  unstable.  However,  there  is no
evidence  to  suggest that  these alleles  are capable  of  expansion  into  the full
mutation  range  with  a single  transmission  (81. Unstable  alleles  within  the
intermediate  range  are thought  to lack  interspersed  AGG  repeats within  the
CGG  repeat array  (9).  In families  with  fragile  X  syndrome  the allele  is larger
than  54  repeats and  is unstable  when  transmitted  from  parent  to  offspring.
More  than  95%  of  mutations  of  these alleles  result  in  an  increase  in  size.
Alleles  are considered  to be premutations  up to a size of  200 repeats since up
to  this  size they  are not  hypermethylated  and have  no phenotypic  effects  in
both  sexes. Above  this length  hypermethylation  occurs and the allele  IS refer-
red  to  as a full  mutation.  Full  mutations  are almost  always  accompanied  by
mental  retardation  in  males  and  significant  but  milder  symptoms  in  about
one-half  of  females.
Fig.  1.  PCR  amplification  and  silver  staining  of  the  fragile  X  CGG  repeat:  (A)
Lanes  6  and  7  are  heterozygous  female  samples.  The  remaining  samples  are  from
normal  males,  although  amplification  in  lane  4 is weak.  (B)  Lane  14 is a female  sample
with  an  allele  within  the  transitional  range  (50  repeats)  and  a premutation  allele  (74
repeats).  Note  how  the  premutation  allele  appears  as a  smear,  this  is  owing  to  the
presence  of stutter  bands  of higher  molecular  weight  than  the  allele.  (C)  Lanes  2,3,4,
6,  and  10  are  all  female  heterozygotes.  Lanes  2  and  3  are  heterozygous  for  alleles
differing  by  one  repeat  unit.  The  remaining  samples  are all  normal  males.
50
Detection  of  Trinucleotide  Repeats  51
c  ten
I
EcoRl
(CGG)n  ter *
0x1.9
I  1
I  I
EclXl  EcoRl
t  I
lkb
Fig.  2.  Genomic restriction map of the region flanking the expanding CGG repeat
that causes fragile X  syndrome. The position of the probe 0X1.9  IS indicated by an open
bar. The EclXI  site immedrately adjacent to the CGG repeat IS SubJect to methylanon on
the lyonized X  in normal females and on chromosomes carrying a full mutation.
3.4.3.2.  HYBRIDIZATION  PATTERN OF PROBE  0X1.9
The probe  0X1.9  hybridizes  to a 5.2 kb EcoRI  fragment  encompassmg the
CGG repeat that undergoes expansion in the majority  of  fragile  X  cases. Within
this fragment  lies an EclXI  site centromeric  of  the FMR-1  gene and the CGG
repeat (Fig.  2). EcZXI  is sensitive  to methylation  and only  cuts at an unmeth-
ylated recognition sequence. Consequently, normal male and female DNA  samples
give  rise to different  hybridization  patterns with  this probe. Males giving  rise to
a single 2.8-kb band, whereas females give  a 2.8- and 5.2-kb band  correspond-
mg to the active  and lyonized X-chromosomes,  respectively.  Variations  within
the normal  range can often be discerned in the 2.8-kb band and expansions into
the premutation  range up to 200 repeats are clearly  associated with  this band.
Interpretation  of premutation  carrying  females can be compounded  by skewed
methylation,  especially  so when  the expanded  allele  is preferentially  methy-
lated. Great care should be taken to ensure that the 5.2-kb band is clearly  in line
with  the neighboring  tracks to exclude this possibility.  Since expansions above
200 repeats (full  mutations)  are accompanied by hypermethylation,  the signal
from  these large  alleles is associated with  the 5.2-kb  band. Full  mutations  are
highly  unstable and often  exist as mosaics within  the peripheral  lymphocytes,
giving  rise to  a diffuse,  smear-like  signal  (Fig.  3). Other  forms  of  mosaicism
can occur,  for  instance,  a  typical  diffuse  methylated  full  mutation  may  be
accompanied  by an unmethylated  premutation  repeat sequence. Very  rarely  a
full  expansion can be accompanied by a small population  of  cells with  alleles in
the normal  range. This  would  lead to a false-negative  result if  PCR  alone was
used to exclude fragile  X.  Preliminary  data from  a collaborative  study in the UK
has estimated that 1% of full  mutation males have PCR amplifiable  alleles within
the normal  range (G. Cross, personal communication).
52
A
Wallace
5.2kb
2.8kb
B  1  10
5.2kb
2.8kb
Fig.  3.  Autoradiographs  produced  by  probing  Southern  blots  from  EcoRIIEclXI
digests  with  0X1.9:  (A)  Lanes  1,2,5,6,  10, and  11 are all  from  normal  females  (note
the  5.2-kb  fragment  originating  from  the  lyonized  X  chromosome).  Lanes  3 and  4  are
from  normal  males  (note  the  slight  variation  in  mobility  owing  to  normal  variation  in
CGG  repeat  size).  Lane  7  is  weak  but  is  from  a premutation  carrier  female  with  a
Detection  of  Trinucleotide  Repeats  53
3.4.3.3.  DIAGNOSIS  IN  FRAGILE X
PCR and Southern blotting  complement  each other in the diagnosis of  frag-
ile  X.  Only  alleles  in  the  normal  range  and  those  at the  lower  end  of  the
premutation  range can be detected reliably  by PCR and silver  staining, whereas
all premutation  and full  mutation  alleles can be detected using  Southern  blot-
ting.  For  the purposes of  excluding  a diagnosis of  fragile  X,  the normal  range
must be considered to lie below  46 repeats because of  the possibility  of  muta-
tional  instability  of  alleles above  this size (unless there is clear evidence  from
other family  members of  stable transmission of  an allele 46-54  repeats in size).
In  samples at low  prior  risk  of  being  affected  by fragile  X  syndrome,  it  is
acceptable to exclude fragile  X  by demonstrating the presence of  a single allele
in  the  normal  range  m  males  or  heterozygosity  within  the  normal  range  in
females. In  order  to eliminate  the possibility  of  mosaicism it is still essential to
screen by  Southern  blot  all  samples  with  a family  history  of  the  disease.
Extreme  care  must  be  taken  when  interpreting  female  heterozygotes  with
closely spaced alleles by PCR and if  there is any doubt,  exclusion by Southern
blot  1s essential. The absence of PCR amplification  never  should be interpreted
as confirming  the presence of  a full  mutation,  confirmation  by  Southern  blot
should  always be carried  out.
3.4.3.4.  CONTROL  SAMPLES
The  following  control  samples should be run alongside  all diagnostic  cases:
1.  Polyacrylamide  gels:
a.  A  mol-wt  standard  against  which  alleles  can be  sized;
b.  A  male  sample  with  a full  mutation,  in  which  no  amplification  should  occur;
c.  A  female  carrier  with  an expansion  at the  lower  end  of the premutation  range;
the  expanded  allele  should  be visible;  and
d.  A  distilled  water  control  containing  all  other  elements  of  the  PCR  reaction
except  target  DNA;  no  amplification  should  be  observed.
2.  Southern  blots:
a.  A  sample  with  an allele  at  the  transitional  range  (4654  repeats);  and
b.  A  sample  with  a diffuse  full  mutation.
Fig.  3  (continued)  degree  of  skewed  methylation.  Lane  8  IS  a premutatlon  carrying
male  (often  referred  to  as a normal  transmitting  male).  Lane  10 is  from  a male  with  a
till  mutation  (note  that  the  EclXI  site  is now methylated  in  this  sample).  Lane  12 is a
full  mutation  carrying  female.  (Note  that  the  normal  allele  in  this  case remains  largely
umnethylated.)  (B)  a  selection  of  premutation  carrying  males  and  females.  Lanes  9
and  10 are  both  premutation  carrying  males,  the  remaining  samples  are premutation
carrying  females.  Lane  1 shows skewed methylation  of the premutation  allele  whereas
track  6  shows skewed  methylation  of  the  normal  allele.  Skewed  methylation  as dem-
onstrated  by  lane  1 can be misleading  and  lead  to  diagnostic  error.
54
e  ter
Wallace
ten  P
I  (CTG)n
I  I
EcoRl  EcoRl
I  I
lkb
Fig.  4.  Genomrc restrrctron map of  the region encompassmg the expanding CTG
repeat  that  causes MD.  The  posltlon  of  the  I-kb  insertion  polymorphism  (I)  1s mdt-
cated.  The  region  to which  probe  pGB2.6  1s complementary  is also  indicated  by  a bar.
The  shaded  region  of pGB2.6  1s removed  when the  insert  1s released  from  the  plasmid
vector  by  digestion  with  both  BumHI  and  EcoRI  (see Note  3)
3.4.4.  MD  interpretation
3.4  4.1.  MD  REPEAT  SIZE  RANGE
MD  is an autosomal  dominant  disease that causes myotonia  and progres-
sive  muscular  weakness, other  associated symptoms  also frequently  occur.
The  mutation  causing  MD  IS an  expanding  (CTG),  repeat  located  in  the  3’
UTR  of  a gene encoding  a protein  kinase  (2). The  MD  gene is located  on the
long  arm of  chromosome  19 at 19q 13.3. The  normal  range  of  the MD  repeat
is considered  to lie  between  3 and 37 repeats (20).  The most common  alleles
are those with  5,  11-14,  and  18-22  CTGs  (‘2). In  nonmanifesting  or  mildly
affected  myotomc  patients  the  repeat  size varies  between  42  and  150  (11).
Expansions  in  severely  and congenitally  affected  patients  can be up to 2000
repeats (2).
3.4.4.2.  HYBRIDIZATION  PATTERN  OF PROBE  ~Gf32.6
The  probe  pGB2.6  hybridizes to a 9.0- or  lO.O-kb EcoRI  fragment  contain-
ing  the MD  CTG  repeat. The  size varration  is due to a 1-kb  msertional  poly-
morphism,  the  larger  allele  occurring  at  a  frequency  of  0.6  in  the  normal
population  (6)  (Fig.  4).  The  lo-kb  allele  is associated with  virtually  all  MD
chromosomes.  Consequently  expansions  are almost  exclusively  greater  than
10 kb in size. Only the larger  expansions, from approx 130 repeats upward, are
discernible  with  this  probe-enzyme  combination.  Mosaictsm  is also  present
with  the  larger  MD  expansions but  this  is usually  less pronounced  than  the
smearing experienced  with  fragile  X  and probe  0X1.9  (Fig.  5).
Detection  of  Trinucleotide  Repeats  55
Fig.  5.  Autoradiograph  produced  by  probing  a  Southern  blot  from  EcoRI  digests
with  pGB2.6.  Lanes  1,2,  and  8 are from  samples  heterozygous  for  the  1-kb  insertion
polymorphism.  Lane  7 is blank.  Track  5 is homozygous  for  the 9-kb  allele.  Lanes  3,4,
and  6 all  carry  large  expansions  and  are thus  affected  by  MD.
3.4.4.3.  SOUTHERN  BLOT ANALYSIS  OF PCR-AMPLIFIED  MD  EXPANSIONS
A  series  of  exposures  is  usually  necessary  to  properly  interpret  these  gels.
The  signal  from  the  normal  alleles  will  be  very  strong  and typically  will  be
visualized  after an exposure of  1 or 2 h. Longer  exposures are required  to prop-
erly  visualize  the  larger  normal  and  small  disease-causing expansions. Dis-
ease-causing  expansions  tend  to  smear heavily  on  the  autoradiograph  (see
Fig.  6). This  is an effect  of  secondary structure, owing  to the DNA  fragment’s
high  GC  content, rather  than reflecting  extreme mosaicism. Samples negative
for  MD  expansions  in  the intermediate  range  show  no in-track  hybridization
outside  the normal  range.
3.4.4.4.  DIAGNOSIS  IN  MD
For accurate diagnosis  of MD  the three complementary  techniques of  direct
PCR,  Southern  blotting  of  PCR  products,  and Southern  blotting  of  genomic
DNA  need to be employed.  Direct  PCR detection on polyacrylamide  gels will
only  reliably  detect  the  smallest  disease-causing  expansions.  Whereas  the
probe-enzyme  combination  described  here  only  detects larger  expansions.
Southern blotting  of  PCR-amplified  products is necessary to cover  intermedi-
ate expansions. MD  can be excluded using the direct PCR approach only if  the
sample  is  heterozygous  for  alleles  within  the  normal  range  (3-37  repeats).
Southern  blotting  can exclude  MD  in  those cases homozygous  for  the  9  kb
pGB2.6  (EcoRI  digest)  allele.  Samples that do not fall  into either  of  these cat-
egories  must show  no  expansion  after  Southern  blotting  of  PCR  products  to
56  Wallace
1  4  1  4
Fig.  6. Autoradiographs  produced  by  Southern  blotting  MD  repeat  PCRs  and prob-
ing  with  a  (CTG)s  oligonucleotide.  Different  exposures  of  the  same  four  samples.
Lanes  1  and  4  both  have  expansions  too  large  to  be  visualized  by  PCR  and  silver
staining  but  too  small  to  be reliably  detected  on  Southern  blot  with  probe  pGB2.6.  (A)
A  short  exposure.  Note  the  strong  hybridization  to  the  normal  alleles  and  that  the
smaller  expansion  in  lane  3  is  picked  out  clearly.  (B)  A  five  times  longer  exposure.
The  normal  alleles  and  the  small  expansion  in  lane  3 are now  overexposed;  however,
the  larger  expansion  in  lane  1 is now  visualized  as an  in-track  smear.  The  smearing  is
an effect  of  secondary  structure,  not  mosaicism.
exclude  MD.  Positive  diagnosis  of  MD  rests on  detecting an allele  exceeding
the normal  range of  37 repeats using any of  these techniques. Although  there is
good  evidence  that the  size of  expansion is related  to the severity  of  clinical
features,  this should never  be used as a prognostic  indicator.
3.4.4.5.  CONTROL  SAMPLES
The  following  control  samples should be run alongside  all diagnostic  cases:
1.  Polyacrylamide  gels:
a.  A  mol-wt  standard  for  sizing  alleles;
b.  A  sample  with  an allele  at the upper  end of the  normal  range;  the  large  normal
allele  should  be clearly  visible;
Detection  of  Trinucleotide  Repeats  57
c.  A  sample with  a small  disease-causmg  expansion,  the  expanded  allele  should
be  visible; and
d.  A  distllled water control containing all other elements of the PCR reaction
except target DNA;  no amplification should be observed.
2.  Southern  blots  of PCR  products:
a.  A  sample  with  an  allele  at the  upper  end  of  the  normal  range;  strong  probe
hybridization should be observed;
b.  A sample with a small disease-causing expansion Just detectable on Southern
blots with probe pGB2.6; probe hybridization should be observed on longer
exposures;  and
c.  A  distilled  water  control  containing  all  other  elements  of  the  PCR  reaction
except  target  DNA;  no hybridization  with  the  probe  should  occur  in  this  lane.
3.  Southern blots of genomlc DNA:
a.  Samples heterozygous for the insertion polymorphism in every fifth  lane; and
b.  A sample with an expansion small enough to be detectable on Southern blots
of  PCR  products,  a clear  difference  should  be  observed  in  the  mobility  of the
expansion and the lO.O-kb allele in neighboring tracks.
3.4.5.  HD  Interpretation
3.4.5.1.  HD  REPEAT SIZE  RANGE
HD  is a progressive  neurodegenerative  disorder  of  late onset. It  is inherited
as a fully  penetrant  autosomal  dominant  condition.  The  HD  mutatron  is an
expanding  (CAG),  repeat located within  the coding  sequence of  the Hunting-
tin  gene (3)  located  on 4~16.3. The  range of  the HD  CAG  repeat varies  from
10-37  repeats m unaffected  individuals  and over  97%  of  normal  alleles  have
<28 repeats (12).  Alleles  found  in HD  affected  individuals  range  in  size from
37-121  repeats, with  the size of  allele  related  to age of  onset (12).  Alleles  in
the range 30-3 8 repeats are considered to be intermediate  alleles and appear to
be  at raised probability  of  undergoing  expansion  into  the HD  range  (13,24).
Taking  this factor  mto account, the normal  range of the HD  repeat can only be
considered to extend to 32 repeats for  diagnostic purposes, although  those alle-
les in the intermediate  range are unlikely  to cause HD.
3.4.5.2.  HYBRIDIZATION  PATTERN OF 4G6P1.8
The  probe  4G6P1.8  hybridizes  to  a PstI  fragment  encompassing  the  HD
CAG  repeat. It  detects a fragment  of  approx  1.8 kb  in HD  normal  alleles  that
becomes larger  on  HD-affected  chromosomes  (up  to  2.2  kb).  4g6Pl.8  also
shows strong secondary hybridization  at an unknown  locus, however  this frag-
ment is much larger  and does not  interfere  with  interpretation.
3.4.5.3.  DIAGNOSIS  IN HD
Diagnosis of HD  rests heavily  on PCR, although  Southern blotting  of genomic
DNA  is necessary when  dealing  with  the  largest expansions or  in  the small
proportion  of  suspected cases that are homozygous after  PCR. Most  cases will
58  Wallace
Fig.  7.  PCR  amplification  and  silver  staining  of  the  HD  CAG  repeat  using  primer
pair  A  +  B.  Lanes  1 and  3  are  from  samples  with  expansions  into  the  HD  affected
range.  The  sample  in  lane  2 is  from  an unaffected  heterozygote  in  which  HD  can now
be  excluded.
be amenable to analysis with  the primer  pair  A  + B (see Table  1). HD  can be
excluded  for  those samples that are heterozygous in  the normal  range  and the
vast majority  of  HD  expansions will  amplify.  A positive  diagnosis of  HD  can
be made providing  there is an allele  of  >38  repeats (Fig.  7).  Those cases that
appear homozygous with  A  + B can be amplified  with  A  + C, which  produces a
larger  fragment  containing  a polymorphic  CCG repeat immediately  3’ of the HD
CAG  repeat (IS).  The  size of this polymorphic  CCG  repeat has no effect  on HD
but can be useful  in detecting heterozygosity in the normal  range at the HD  lo-
cus. Primer pair  A + C should not routinely  be used for  sizing HD  alleles since
the variability  of  the CCG  repeat may confound  HD  CAG  sizing causing errors
of  up  to  15 bp  (15).  Any  remaining  cases that are still  homozygous should  be
Southern blotted and probed with  4g6P1.8. HD  may be excluded if only  a single
band  in  the normal  range  is present.  At  present  HD  cannot  be  excluded  in
patients with  an allele in the range 32-38  repeats, although the probability  of them
Detection  of  Trinucleotide  Repeats  59
being affected  is small. A multicenter  study is presently underway  in the United
Kingdom  to  determine  the HD  risk  to  individuals  with  alleles  in  this  range
(D.  C. Rubinsztein, personal communication),  Although  the correlation  between
HD  CAG  repeat size and age of  onset is strong (12),  this should not be used as
a prognostic  indicator.
3.4.5.4.  CONTROL  SAMPLES
The  following  control  samples should be run  alongside all  diagnostic  cases:
1.  Polyacrylamide gels:
a.  A mol-wt standard for sizing alleles;
b.  A sample with an allele at the upper end of the normal range; the large normal
allele should amplify clearly;
c.  A sample with a large HD expansion; the HD allele should be visible; and
d.  A distilled water control containing all elements of  the PCR reaction except
target DNA;  no amphfication should be observed.
2.  Southern blots:
a.  A sample with an allele at the top of the normal range (over 30 repeats); and
b.  A sample with a large HD  expansion.
3.4.6.  SBMA
3.4.6.1.  SBMA  REPEAT  SIZE  RANGE
SBMA  is caused by an expanding  (CAG),  repeat in the coding  sequence of
the androgen  receptor  gene situated on the long  arm of  the X-chromosome  at
location  Xql  l-12  (4). The  normal  range of  the SBMA  repeat is 13-30  repeats
and its heterozygosity  exceeds 90%  (16).  The  SBMA  repeat size in  affected
males and carrier  females  lies within  a narrow  range  of  40-62  repeats. Large
expansions  and  intermediate  alleles  have  not  been observed  (16).  SBMA  is
inherited  as an  X-linked  recessive  disorder,  males  with  expansions  show
progressive  muscle  weakness  and  atrophy  that  may  be  accompanied  by
gynecomastia and infertility.
3.4.6.2.  DIAGNOSIS  IN SBMA
Since SBMA  expansions are small diagnosis can be carried  out solely using
PCR. A male sample with  an allele in the normal range excludes SBMA.  Female
samples ideally  should be heterozygous to exclude the carrier  state. However,
provided  amplification  is efficient  and the relevant  controls are run alongside the
test sample, the absence of  an expansion can be taken as excluding  SBMA.
3.4.6.3.  CONTROL  SAMPLES
The  following  control  samples should be run alongside  all diagnostic  cases:
1.  A mol-wt  standard against which alleles can be sized;
2.  A female carrier with an expansion at the upper end of the range; the expansion
should amplify clearly; and
3.  A distilled water control containing all other elements of the PCR reaction except
target DNA;  no amplification should be observed.
Wallace
4.  Notes
1.  Remember  that  formaldehyde  usually  is supphed  as a 37%  aqueous  solution  (for-
malin).  Take  this  into  account  when  calculating  amounts  for  silver  staining  solu-
tion  C.  The  formaldehyde  concentratton  is  critical.
2.  A  rotisserie  style  hybridization  oven  is  not  essential  for  Southern  hybridization.
The  hybridization  steps can  be  carried  out  in  heat  sealed  plastic  bags  m  a tem-
perature  controlled  oven.
3.  When  probe  pGB2  6 is  used  on  EcoRI  digests  without  modification,  a constant
fragment  is  visualized  that  coincides  with  the  range  of MD  expansions.  In  order
to  overcome  this  problem,  pGB2.6  insert  should  be  released  from  the  plasmid
vector  by  digesting  with  both  BumHI  and EcoRI  The  larger  of  the two  insert  frag-
ments  released  (approx  2  2 kb)  no  longer  hybridizes  to  the  constant  fragment.
4.  The  prehybridization  and  hybridization  solutions  described  here  are  suitable  for
most  probes;  however,  the probes  pGB2.6  and 4g6P1.8  contain  repetitive  elements
and  need  further  blocking  to  prevent  cross-hybridization  to  other  related  genonnc
sequences.  Both  prehybridization  and  hybridization  solutions  should  contain  5X
Denhardt’s  solution  and  100 ug/mL  of denatured  HS  DNA  for extra blocking.  The
HS  DNA  can be denatured by  standing  in a boiling  water bath for  10 min  prior  to use
5.  If  the  ambient  temperature  falls,  crystals  may  precipitate  out  m  the  prehybridiza-
tion  solution  used for Southern  blotting.  These may  be dispersed by gentle  reheating.
6.  Sometimes  polyacrylamide  gels  may  not  polymerize  fully,  especially  if  the  10%
AMPS  solution  was not  fresh. Since  the well  dividers  are usually  the  last parts  of
the gel  to polymerize,  this  can lead  to  the loss of the gel.  A partly  polymerized  gel
can  usually  be  saved  by  incubating  for  20  min  at  37°C  provided  this  is  done
before  the  gel  has been  poured  for  too  long.
7.  Polyacrylamide  gels  can  be  poured  the  day  before  use  provided  they  are  pre-
vented  from  drying  out.  Place  the polymerized  gel  inside  the electrophoresis  tank
with  running  buffer  before  leaving  overmght.  Alternatively,  cover  the  comb  end
of the  gel  with  damp  paper  towels  and wrap  in  cling  film.
8.  Pouring  away solutions  without  losing  the polyacrylamide  gel  during  silver  stam-
ing  can be difficult  The  gel  can be held  in  place  with  gloved  hands  while  pourmg
away solutions.  However,  the  talc  on  some  brands  of  disposable  gloves  can mark
the  gels  and  gloves  must  be  changed  once  they  have  come  into  contact  with  any
alkaline  solution  (especially  solution  C).  A  good  tip  is to  use an old  piece  of X-ray
film  to  hold  the  gel  in  place  while  changing  solutions.
9.  Sometimes  while  a gel  is  in  silver  staining  solution  2 (0.1%  AgNOs)  if  it  comes
into  accidental  contact  with  a strong  salt  or  alkali  solution  it  may  turn  a milky
white  color  as silver  chloride  precipitates.  Continuing  to  stain  a gel  such as this  is
bound  to  fail.  The  gel  can  be  saved  by  washing  the  gel  twice  briefly  in  dH1O,
immersing  in  a  2.5%  solution  of  ammonia  followed  by  rinsing  twice  in  dH*O.
Silver  staming  should  then  be restarted  using  solution  A  (see Section  3.1.3.).
10.  Silver-stained  gels  need  not  necessarily  be  dried  down  for  long-term  storage,
they  store  quite  adequately  when  sealed  damp  between  plastic.  Beware  of  dam-
aging  them  by  crushing  with  heavy  objects  (especially  elbows!).
Detection  of  Trinucleotide  Repeats  61
11.  Care  must  be taken  to  ensure  that  genomic  DNA  is  fully  digested  before  South-
ern  blotting.  The  distribution  of  DNA  within  partially  digested  tracks  will  be
skewed  to  higher  mol-wt  fragments.  Some  DNA  samples  are  consistently  diffi-
cult  to digest,  probably  because of carry-over  of contaminating  reagents  from  the
DNA  extraction.  This  problem  can often  be overcome  by  adding  Spermidine  to a
concentration  of 4 mA4 in  the restriction  digest.  If  this  does not  overcome  the prob-
lem,  a second phenol:chloroform  extraction  and precipitation  is the  only  remedy.
12.  Southern  transfer  of  DNA  from  a gel  to  nylon  membrane  need  not  be  an over-
night  step  if  there  is  some  urgency.  If  the  paper  towels  are  changed  every  half
hour  for the  first  2 h and subsequently  every hour,  transfer of fragments  up  to  12 kb
can be achieved  in  5 h. Consequently  the  membrane  can be probed  the  same  day.
13.  If  a membrane  binds  probe  nonspecifically,  as occasionally  happens,  tt  can usu-
ally  be  stripped  and  reprobed  successfully.  To  strip  a membrane,  place  in  a plas-
tic  tray  and  boil  200  mL  of  dH,O.  Once  the  water  has boiled,  remove  from  the
heat  source,  add  SDS  to  a concentration  of  OS%,  and  pour  onto  the  membrane.
Leave  on  an  orbital  shaker  for  10 min  and  repeat.  Monitor  the  membrane  with  a
Geiger  counter,  if  radiation  is  now  down  to  background  level  the  membrane  can
be reprobed.
14.  The  oligonucleottde  hybridization  step  described  m  Section  3.3.2.  can  be  left
overnight  without  any deterioration  in  quality  of results.  Short  hybridizatton  times
are often  quoted  for  this  technique.  Thts  is because the  kinetics  of hybridization
are much  faster  owing  to  the  small  probe  size.
15.  Some  DNA  samples  are refractory  to  PCR  amplification  Diluting  out  the  inhib-
rung  contaminant  is the  best way of circumventmg  this  problem.  Make  a dilution
series  of  genomic  DNA,  i.e.,  1:20,  1:40,  1:80,  I:160  and  try  amplifying  each
separately.  It  is surprising  how well  these  samples  amplify  once  the contaminant
is  diluted  out.
16.  Great  care  must  be  taken  to  avoid  cross  contamination  of  PCR  reactions.  The
most  potent  source of  contaminating  DNA  are old  PCR  reactions.  These  should
always be disposed  of carefully.  Pipets  are a major  medium  of contamination  and
a  set  of  pipets  should  be  dedicated  to  the  setting  up  of  PCR  reactions  alone.
Another  set can then  be used  solely  for  post-PCR  manipulations.  Setting  aside  a
special  area  of  benching  for  setting  up  PCRs  along  with  other  dedicated  items,
such as racks,  is good  practice  and  further  reduces the  chances of  PCR  contami-
nation.  If  primer  stocks  do  become  contaminated,  placmg  the  primers  m  a
microcentrifuge  tube  on a shortwave  UV  transilluminator  for  5-10  min  will  cure
all  but  the  most  severe cases. UV  irradiation  nicks  the  contaminating  DNA  mak-
ing  it  refractory  to  PCR  amplification.
References
1.  Verkerk,  A.  J. M.  H.,  Pieretti,  M.,  Sutcliffe,  J. S., Fu, Y.-H.,  Kuhl,  D. P.  A,  Pizzuti,
A.,  et al.  (199 1) Identification  of  a gene  (FMR-  1) containing  a CGG  repeat  coin-
cident  with  a breakpoint  cluster  region  exhibiting  length  variation  in  fragile  X
syndrome.  Cell  65,905-914.
62  Wallace
2.  Brook,  D.  J.,  McCurrach,  M  E.,  Harley,  H.  G.,  Buckler,  A  J.,  Churh,  D.,
Aburatani,  H.,  et al.  (1992)  Molecular  basis  of myotonic  dystrophy:  expansion  of
a trinucleotide  (CTG)  repeat  at the  3’ end  of a transcript  encoding  a protein  kmase
family  member.  Cell  68,799-808.
3.  Huntington’s  Disease  Collaboratrve  Research  Group  (1993)  A  novel  gene  con-
taining  a trmucleotrde  repeat  that  1s expanded  and  unstable  on  Huntington’s  drs-
ease chromosomes.  Cell  72,971-983.
4.  La  Spada  A  R.,  Wdson,  E  M.,  Lubahn,  D.  B.,  Harding,  A.  E.,  and  Frschbeck,  K.
H.  (I  99 1) Androgen  receptor  mutations  m  X-linked  spinal  and  bulbar  muscular
atrophy.  Nature  352,  77-79.
5.  Hirst,  M.  C., Nakahort,  Y., Knight,  S. J. L.,  Schwartz, C., Thtbodeau,  S  N.,  Roche,  A.,
et al. (1991) Genotype prediction  in the fragile X  syndrome. J, Med.  Genet. 28,824-829.
6.  Mahadevan,  M.,  Tsrltidis,  C.,  Sabourin,  L.,  Shutler,  G.,  Amemiya,  C  , Jansen,  G.,
et  al.  (1992)  Myotomc  dystrophy  mutatron:  an  unstable  CTG  repeat  in  the  3’
untranslated  region  of  the  gene.  Science  255,  1253-1255
7.  Fu,  Y.-H.,  Kuhl,  D.  P.  A.,  Przzuti,  A.,  Piereti,  M.,  Sutcliffe,  J.  S., Richards,  S.,  et
al.  (199  1) Variation  of  the  p(CGG)n  repeat  at the  fragile  X  site  results  m  genettc
instability:  resolution  of the  Sherman  paradox.  Cell  67,  1047-1058.
8.  Reiss,  A.  L.,  Kazazian,  H.  H.,  Krebs,  C  M.,  McAughan,  A.,  Boehm,  C.  D.,
Abrams,  M.  T.,  and  Nelson,  D.  L.  (1994)  Frequency  and  stability  of the  fragile  X
premutation.  Hum.  Mol  Genet.  3,393-398.
9.  Hwt,  M.  C.,  Prabjhit,  K.  G.,  and  Davies,  K.  E.  (1994)  Precursor  arrays for  tnplet
repeat  expansion  at the  fragile  X  locus  Hum.  Mol.  Genet  3,  1553-l  560.
10.  Brunner,  H.  G.,  Nillesen,  W.,  vanOost,  B.  A.,  Jansen,  G.,  Wieringa,  B.,  Ropers,
H.-H.,  and  Smeets,  H.  J. M.  (1992)  Presymptomatic  diagnosis  of  myotomc  dys-
trophy.  J  Med.  Genet.  29,  780-784.
11.  Hunter,  A.,  Tsilfidis,  C , Mettler,  G.,  Jacob,  P  , Mahadevan,  M.,  and Korneluk,  R.
G.  (1992)  The  correlation  of  age at  onset  with  CTG  trinucleotrde  repeat  amplrti-
cation  in  myotonic  dystrophy.  J.  Med.  Genet  29,774-779.
12.  Andrew,  S.  E.,  Goldberg,  Y.  P.,  Kremer,  B.,  Telemus,  H.,  Theilmann,  J  , Adam,
S.,  et  al.  (1993)  The  relationship  between  (CAG)  repeat  length  and  clinical  fea-
tures  of Huntington’s  drsease. Nature  Genet.  4,398-403.
13.  Myers,  R.  H.,  MacDonald,  M.  E.,  Koroshetz,  W.  J.,  Duyao,  M.  P.,  Ambrose,  C.
M.,  Taylor,  S. A.  M  , et al.  (1993)  De  novo  expansion  of  a (CAG),  repeat  in  spo-
radic  Huntington’s  disease.  Nature  Genet.  5,  168-173.
14.  Goldberg,  Y.  P  ,  Kremer,  B.,  Andrew,  S.  E.,  Theilmann,  J.,  Graham,  R.  K.,
Squitieri,  F.,  et al.  (1993)  Molecular  analysis  of  new mutations  for  Huntington’s
disease:  intermediate  alleles  and  sex of  origin  effects.  Nature  Genet.  5,  174-l  79.
15  Andrew,  S. E., Goldberg,  Y. P  , Theihnann,  J., Zeisler,  J , and Hayden,  M.  R.  (1994)  A
CCG  repeat polymorphism  adJacent to the CAG  repeat m me  Huntington  disease gene
implications  for diagnostic  accuracy and predictive  testing. Hum.  Mol.  Genet. 3,65-67.
16.  La  Spada,  A.  R.,  Roling,  D.  B.,  Hardmg,  A.  E.,  Warner,  C.  L.,  Spiegel,  R.,
Hausmanowa-Petrusewicz,  I.,  et al.  (1992)  Meiotic  stabilrty  and  genotype-pheno-
type  correlation  of  the trinucleotide  repeat  in  X-linked  spinal  and bulbar  muscular
atrophy.  Nature  Genet.  2,301-304.
4
Searching  for  Mutations
Familial  Adenomatous  Polyposis  as  a  Case  Study
Ian  M.  Frayling  and  Andrew  J.  Rowan
1.  Introduction
1.1.  Overview
The molecular  diagnosis of a genetic disease can be made by demonstrating
linkage  of suitable markers to the disease allele. However,  it is generally  agreed
that  it  is  better  to  define  the  mutation  responsible.  There  is  a plethora  of
techniques  available  for  the  detection  of  mutations  within  genes.  No  one
method  is predominant,  although  single-stranded  conformational  polymor-
phism  (SSCP) may  be the single most widely  used technique.  The  choice  in
any  given  situation  is a complex  function  of  a particular  method’s  efficiency
(i.e.,  the proportion  of  all  mutations  in  a given  set that  are detected),  repro-
ducibrhty,  ease, speed, and cost, coupled with  local considerations, such as the
equipment,  expertise, and budget available.  Factors specific  to the disease and
gene(s) concerned  also play an important  part:  genes can vary  greatly  in size;
mutations  may be clustered  in regions  or occur  in  “hot  spots”;  some specific
mutations  may  occur  at  a high  frequency  m a particular  population;  muta-
tions may be mostly either mis-sense or non-sense; some diseases may have  a
high  new  mutation  rate. In  addition,  the  nature  of  the  material  available  for
diagnosis (e.g., stored DNA  or lymphoblastoid  cell line, formalin-fixed,  or fro-
zen tissue) may be a deciding  factor.  The priorities  of providing  a clinical  ser-
vice  may be somewhat different  from  those of  a research laboratory,  but any
laboratory’s  decision on the methods it employs will  be governed  by the cost-
to-benefit  ratio.  All  these points are illustrated  when  considering  the molecular
diagnosis  of  familial  adenomatous polyposis  (FAP).  For  service  laboratories,
From  Methods  m  Molecular  Medmne  Molecular  Lbagnosls  of  Genebc  Diseases
Edited  by  R  Elles  Humana  Press  Inc  ,  Totowa,  NJ
63
64  Frayling  and  Rowan
however,  there  is the special consideration  regarding  whether  the expense of
mutation  detection can be justified  by the clinical  benefit,  but a discussion on
the assessment of  this is beyond  the scope of  this chapter.
Climcally,  FAP is characterized by the development  of  multiple  gastromtes-
tmal  (GI)  adenomas, usually  hundreds  to thousands, one or more  of  which  if
left  untreated  inevitably  progress to  carcinomas. FAP may  be one of  the first
inherited  predispositions  to cancer to have  been described given  the reports of
Cripps  and Bickersteth  over  a century ago (I,,?). This  propensity  to develop  GI
adenomas is  inherited  m  an autosomal  dominant  fashion,  a characteristic  of
germline  mutations  in tumor  suppressor genes (3-S).  The adenomas are gener-
ally  thought  of  as sited in the colorectum,  but they also occur  in the upper  GI
tract, where they are a source of  considerable morbidity  and mortality  now  that
most patients are treated by prophylactic  colectomy  (6,7). There is, in addition,
a wide  spectrum of  extramtestinal  manifestations,  including  desmoid  tumors,
retinal  hamartomas (congenital  hypertrophy  of the retinal  pigment  epithelium;
CHRPE),  sebaceous adenomas, osteomas, and dentiginous  cysts. Gardner  and
Richards  (8)  first  described  a syndrome  comprising  the  latter  three  features
occurring  in individuals  with  colornc polyposis from  the same family,  but most
patients  with  FAP  exhibit  at  least  one  of  the  extraintestinal  features  of
Gardner’s  syndrome  (9).
Germline  mutations  of the APC gene are responsible  for  FAP; the gene was
first  localized  to  5q22  by exploitmg  a combination  of  serendipitous  chromo-
somal deletions  and lmked  genetic markers, which  subsequently enabled  it to
be identified,  the cDNA  cloned, and its intron/exon structure determined (10-I  6).
The  early,  restriction  fragment  length  polymorphtsm  (RFLP)-based,  linked
markers  inevitably  suffered  from  being  mostly  dimorphic,  sited at some dis-
tance from  the  gene and requiring  Southern  analysis. There  are now  several
more  closely  linked  highly  polymorphic  polymerase  chain  reaction  (PCR)-
based microsatellite  markers  in the region,  and diagnosis  based on linkage  is
thus nowadays  easier and more  secure (17-19).  However,  successful linkage
analysis  is  dependent  on  a  suitable  pedigree  structure  and  material  being
available  from  as many  family  members  as possible,  including  those unaf-
fected  and/or  only  related  by  marriage;  conditions  that  often  cannot be  ful-
filled.  In  any event,  in those families  where  the disease has arisen owing  to a
so-called  new  mutation,  linkage  analysis is of  no help:  It  is estimated that be-
tween  10 and 30%  of  FAP cases arise as such (20-23).
The  APC  gene, and the spectrum and site of  germline  mutations  within  it
responsible  for  FAP,  show  certain  features  that  both  assist and  complicate
mutation  detection.  The APC  gene has a protein-coding  region  approx  8.5-kb
long  spread over  15 exons. These in turn  are spread over  some 100-l  50 kb of
genomic  DNA  (gDNA),  and the full-length  mature APC protein  is predicted  to
Searching  for  Mutations  65
be 2843  amino  acids long  with,  assuming no posttranslational  modifications,
an M,  of  311,658  (14).  The  APC  mRNA  shows  alternate  splicing  of  some
exons,  e.g.,  exons  7  and  9/9a  (14,2#).  Exons  l-14  vary  in  size from  78
(exon  12) to 379 bp (exon 9/9a). Together  they account for  23% of the protein-
coding  region  of  the  gene. Exon  15, however,  is remarkable  for  its  size. At
some 7.5 kb long, it is one of  the largest, if  not the largest, eukaryotic  exon yet
described.  On  the  basis of  the sites of  the  various  PCR primers,  which  they
used to amplify  exon  15 piecemeal, Groden  et al. (14)  divided  it into  23 over-
lapping  regions,  viz.  15A-15W.  The  5’ untranslated  region  (UTR)  of  the APC
mRNA  is encoded by a number  of  alternately  spliced exons; some are subject
to alternate  splicing  in conjunction with  exon 1; one is sited close to a candidate
promoter region (24-26).  The full  significance  of these findings  is as yet unclear,
but the alternate  splicing  appears, at least to some extent, to be tissue specific.
It may be that reports of  unequal  expression of APC  alleles in association with
FAP are owing  to mutations  in promoter  or related  regions,  but these are rare
and only  likely  to account for  a small proportion  of  FAP  families  (27).
What  is  evident,  however,  is  that  the  majority  of  APC  germline  mutations
responsible for  FAP are non-sense or frame-shift  in nature and result in prema-
ture  termination  of  the  APC  protein  (28-31).  Of  174  published  mutations
reviewed  by Nagase et al. (32),  only  six were  mis-sense. The  siting  within  the
gene  of  mutations  associated with  FAP  is also  of  interest.  FAP-associated
mutations have been described between codons 168 (3’ end of  exon 4) and 2839
(3’ end of  exon  15) inclusive.  However,  most are found  in the region  between
codons I68  (exon 4) and codon  1640 (exon  15), with  a particular  concentration
in a 2-kb region  of  exon 15 between codons 900 and 1600 (‘32). Two  mutations,
at codons 106 1 and 1309 (both 5-bp deletions), are the most commonly  observed,
together accounting for  maybe one-fifth  of all FAP  mutations, and they probably
represent germline  mutational  “hot  spots” (28). It  should be borne  in mind  that
all present estimates of the prevalence,  and even types, of  individual  mutations
are biased. The  direction  and extent of the bias depend on the particular  muta-
tion  detection method(s)  used and/or the proportion  of  the gene searched.
Some clues to  the site of  a family’s  mutation  may be gained  from  pheno-
type. Olschwang  et al.  (33)  found  that the likelihood  of  finding  CHRPE  in  a
family  was related to the position  of the mutation with  respect to exon 9 (codons
3 12-412):  CHRPE was associated with  mutations located 3’ to exon 9 (although
by  no  means all  mutations  3’  of  exon  9 were  associated with  CHRPE),  and
mutations  5’ to  exon  9 had  a low  probability  of  association,  whereas  those
within  exon  9 had  an intermediate  likelihood.  Mutation  in  exon  6  has been
found  to be associated with  late age-of-onset  of colorectal  polyps (34,, whereas
a variant  of FAP in which  the number  of colorectal  adenomas is much reduced,
known  as attenuated adenomatous polyposis  coli  (AAPC),  seems to be associ-
66  Frayling  and  Rowan
ated with  mutations  located 5’ of  codon  160 (exon 4), at least as far  as codon  83
(exon  3)  (3.5,36). However,  the question  of  attenuated disease is complicated
by  some  interpreting  it  as necessarily  late  onset, which  may  not  be a  valid
distinction  (3 7). The  phenotype  associated with  complete  absence of  the APC
gene is still  the subject of  debate. It would  be reasonable to predict  that loss of
one APC  allele,  in  the absence of  any other  hemizygosity  in  the  surrounding
area, will  be associated with  an AAPC  or  AAPC-like  phenotype.  Almost  all
reported  cases to date have  a visible  cytogenetic deletion  involving  5q22 and,
as might  be expected, are associated with  some degree of  mtellectual  impair-
ment  (38).  It  is  mterestmg that  the intellectual  handicap  in  these individuals
seems to be an impaument  of  communication  of  abstract concepts. Hence,  an
assessment of  the level  of  handicap  based on purely  verbal  criteria  results m
these individuals  being  considered more handicapped  than they actually  are.
All  these different  correlations  are by no means absolute, but may be useful
in deciding  where  or how  to start looking  for  an individual  family’s  mutation.
The fact remains that for  the majority  of  FAP cases, there is only the balance of
probability  to go on, i.e., that the mutation  probably  lies between codons  168
and 1600, most likely  at codons 1309 or  106 1, but could be anywhere  between
codons 1 and 2843, or even outside of this. Finally,  it should be noted that there
may be genetic heterogeneity  m FAP (39-41).
1.2.  Choice  of  Methods
The methods described later m this chapter, which  we have used and adapted
to  screen for  germline  mutations  responsible  for  FAP,  will  be, we  hope,  of
use to those also working  m this area or who  wish  to apply  the techniques  to
other  genes. The  two  methods that we  initially  decided  to use were  chemical
cleavage of  mismatch  (CCM;  Fig.  1) (42-G)  and DNA  heteroduplex  analysis
(HDA)  (46,47).  Lately,  we  have  started to screen for  mutations  with  the pro-
tein  truncation  test (PTT;  Fig.  2) (27,48).  If  we were  starting  again now,  PTT
would  be our first choice, but as will  be seen, the other methods have their merits
and have  not been completely  supplanted. All  these techniques are dependent
on  the  amplification  of  DNA  by  means of  PCR,  usmg  as a  template  either
gDNA  or complementary  DNA  (cDNA),  the latter synthesized by reverse  tran-
scription  from  mRNA.  A major  consideration  in the initial  choice of  CCM  was
the desire to use the most efficient  (and inherently  least biased) method  avail-
able (49).  As is seen later, although  this might  involve  using  a technique  that
takes longer  to  perform,  there  is a payoff  when  screening  the APC  gene  in
being  able to  screen large  DNA  fragments,  thus requumg  rather  fewer  PCRs
than  if  using  the simpler,  but less efficient  method  of  SSCP. The  methods are
used m a complementary  fashion,  usually  depending  on the material  available
from  affected  members  of  a particular  family,  i.e.,  DNA  or  RNA.  DNA  is
Searching  for Mutations  67
Test DNA  1
-A
-=\
5’  end-labelled  DNA
f’P]-  G
-c~-[3zPl
(i)  DNA  Heteroduplex  formation
=c”-[?,
(ii)  Hydroxylamine  treatment
JI  t
==i&–[32P]
b+—;
4
I
(iii)  Hot  piperidine  treatment
~A__-___i3’pl  w—cg
I  .
(iv)  Denaturing  gel  electrophoresis
and  autoradiography
12NM



I-




Fig.  1.  Diagram  showing  the  principal  steps in  CCM:  (1) [32P]-End-labeled  probe
DNA  is  annealed  with  test  DNA;  (ii)  the  resulting  heteroduplexes  are  treated  with
either  osmium  tetroxlde  or, as in  this  example,  hydroxylamine,  which  reacts with  mis-
or unmatched  cytosine  residues  (osmium  reacts  similarly  with  thymine  residues);  (iii)
hot  piperidine  treatment  cleaves  the DNA  at those  sites where bases have  reacted;  and
(IV)  the  cleavage  products  are then  separated  by  PAGE  under  denaturing  conditions
and their  positions  determined  by  autoradiography.  Note  that  homoduplexes  that  form
in  step (i)  are not  shown;  normally  an  excess of  test DNA  over  probe  is  used to  mini-
mize  their  formation.  From  a comparison  between  the  positions  of  [32P]-labeled  DNA
size  markers  and  the  cleaved  products,  an  accurate  estimate  of  the  distance  of  the
mutation  from  the  end  of  the  DNA  fragment  can be obtained.
68  Frayling  and  Rowan
NOmMl
PCR:  -;+i
I
RNA:  -TAT
(i)  Test PCR product  1
Mutant
-W&
(ii)  Transcription  by
T7  RNA  polymerase
I
-TAA
I  (iii)  Translation
Protein:  M*ARGNlLYARIWRAM*NAIR
(iv)  SDS-PAGE  and
autoradiography
M  N  1  2
I M*ARGNILX

Fig.  2.  Diagram  showing  the  principle  steps  in  the  PTT:  (I)  the  DNA  sequence  of
interest  is  amplified  by  PCR  using  a sense-strand  primer,  including  a T7  RNA  poly-
merase  (transcription  start)  site  and  m-frame  start  codon  (ATG);  (ii)  RNA  is  synthe-
sized  by  T7  RNA  polymerase  using  the  PCR  product  as the  template;  (ni)  which  is
then  simultaneously  translated  into  protein  m  the  presence  of  a labeled  amino  acid
(in  this  example  [35S]-methlonine,  but  [3H]-leucine  or  biotm-labeled  lysine  can  be
used);  and  (iv)  the  labeled  polypeptide  reaction  products  are separated  by  SDS-PAGE
and  detected  by  autoradiography.  Mutant  DNAs  containing  premature  stop  codons
give  rise  to  smaller-stzed  products,  the  precise  size  of  which  can  be  used  to  give  an
estimate  of  the  site  of the  mutatron  (bearmg  m  mmd  that  the  stop  codon  generated  by
some  frame-shiftmg  mutations  can  be downstream  of  the  mutation  itself).
Searching  for Mutations  69
obtained,  whenever  possible, by purification  from  blood  (Nucleon’”  Genomic
DNA  Extraction  Kit;  Scotlab, Strathclyde, UK),  but in those instances where  a
living  affected  member  of  the family  is not  available,  it  is extracted from  the
wax-embedded  histologically  normal  tissue of a deceased affected relative  (50).
RNA  is usually  extracted from  a lymphoblastoid  cell  line,  but  could  be from
fresh blood  or  snap-frozen  normal  tissue, e.g., colonic  mucosa (51).
For  PCR  amplification  of  exons 1-14,  we use the oligonucleotide  primers
given  in  Groden  et al.  (14),  but omitting  the Ml3  universal  primer  sequence
tags. These  are mostly  sited within  the introns,  the exceptions being  the for-
ward  primers  for  exons  1 (immediately  adjacent to the start codon),  3, 4, and
9a, and the reverse  primer  for  exon 9, all  sited within  the exons themselves.
However,  Groden  et al.  (52)  subsequently published  replacements for  two  of
these, that for  exon  1 sited well  upstream of  the start codon and that for  exon 3
sited within  the intron  (Table  1). Exon 9/9a we amplify  in a single PCR, utiliz-
ing the forward  primer  for  exon 9 and the reverse primer  for  exon 9a, and usmg
the same conditions  as the exon  15 PCRs. The primers  Groden et al. (24)  origi-
nally  described  for  exon  15 amplify  the  exon  as a series of  23  overlapping
regions  (15A-W),  which  were  screened for  mutations  by SSCP and of  neces-
s~ty had to be no longer  than about 250 bp. One of  the advantages of  CCM  is
that it can screen DNA  fragments  as large as 1 S kb. For this reason, we amplify
exon  15 in only  six overlappmg  PCRs, of up to  1.4 kb at a time, which  we term
15. l-l  5.6 (Table  2). This  compares most favorably  with  the number  of  PCRs
originally  deemed necessary, especially  in view  of  the concentration  of  muta-
tions between  codons 900 and 1600 (covered  by our regions  15. l-l  5.3). Thus,
we screen 99.78% of the protein-coding  region  of the gene in 20 (14  + 6) PCRs
rather  than  the  38  that  Groden  et al.  (14)  described.  The  0.22%  that  is  not
screened corresponds to basepairs 423-442  (codons  141-147)  at the 5’ end of
exon  4, because of  the  forward  primer  being  sited partially  within  the  exon
(Table  1). The  order  m which  we screen PCR products has evolved  in response
to the likelihood  of  finding  mutations: we  screen 15.1-15.3  first,  followed  by
exons 6-14  and then 5-l  (in  that order),  finally  analyzing  15.4-15.6.
Before  carrying  out  CCM  analysis  of  the  exon  15 PCR-amplified  frag-
ments, we have found  it convenient  to screen them first by HDA  on MDE’”  gels,
a quick and simple method with  acceptable efficiency  (53,54). Although  the size
of  these fragments  might  be  thought  to  be  too  large  for  efficient  mutation
detection by this method, we are able to detect a worthwhile  proportion  of muta-
tions, not surprisingly  deletions and insertions rather than point  mutations. We
routinely  detect the common  5-bp  deletions at codons  1061 and  1309 by  this
method  (Fig.  3, p. 73).  It  ideally  requires  some form  of  low-temperature-con-
trolled  vertical  electrophoresis equipment, but this does not need to be sophisti-
cated. Samples screening negative  by HDA  are subsequently analyzed by CCM.
Table  1
The  APC  Gene:  Exons  l-148
Exon
1
2
3
4
5
8  6
7
8
9/9a
10
11
12
Length,  bpb
>135
85
202
109
114
84
105
99
379
96
140
78
Codonsd  PCR  primef,  5’-3’
-33-135
134-220
22 l-422
442-53  1
532-645
646-729
730-834
835-933
934-1312
13 lS1408
1409-l  548
1549-1626
l-45
46-74
7&141
148-177g
178-215
216-243
26278
279-3  11
3 12-438
438470
470-5  16
5 17-542
1F:  ATTAACACAATTCTTCTTAAACGTC”
1R:  TAAAAATGGATAAACTACAATTAAAAG
2F.  AAATACAGAATCATGTCTTGAAGT
2R:  ACACCTAAAGATGACAATTTGAG
3F:  GACCCAAGTGGACTTTTCAGGf
3R:  ACAATAAACTGGAGTACACAAGG
4F:  ATAGGTCATTGCTTCTTGCTGAT”
4R:  TGAATTTTAATGGATTACCTAGGT
5F:  CTTTTTTTGCTTTTACTGATTAACG
5R:  TGTAATTCATTTTATTCCTAATAGCTC
6F:  GGTAGCCATAGTATGATTATCT
6R:  CTACCTATTTTTATACCCACAAAC
7F.  AAGAAAGCCTACACCATTTTTGC
7R:  GATCATTCTTAGAACCATCTTGC
8F.  ACCTATAGTCTAAATTATACCATC
8R.  GTCATGGCATTAGTGACCAG
9F:  AGTCGTAATTTTGTTTCTAAACTC
9aR.  GCTTTGAAACATGCACTACGAT
1 OF: AAACATCATTGCTCTTCAAATAAC
1 OR:  TACCATGATTTAAAAA  TCCACCAG
11 F:  GATGATTGTCTTTTTCCTCTTGC
11R:  CTGAGCTATCTTAAGAAATACATG
12F:  TTTTAAATGATCCTCTTATTCTGTAT
12R:  ACAGAGTCAGACCCTGCCTCAAAG
13  117  1627-1743  543-58  1  13F.  TTTCTATTCTTACTGCTAGCATT
13R:  ATACACAGGTAAGAAATTAGGA
14  215  1744-1958  582-653  14F:  TAGATGACCCATATTCTGTTTC
14R.  CAATTAGGTCTTTTTGAGAGTA
aAs described  m Groden  et al  (14)
bLength of the exons themselves,  not the PCR products.
‘Those  basepaus within  each exon that are screened, numbered according  to the sequence in Joslyn  et al. (25)
%ose  codons partially  or wholly  screened
=As given in Groden  et al  (14)
fAs  in Groden et al. (52),  but omitting  the M 13 umversal  pruner  sequences
gExon 4 comprises  codons  141-177.
the  only primer  not  sited wholly  wlthm  au mtron,  showmg  underlined  the region sited in exon 4
Table  2
The  APC  Gene:  Exon  15  Regions  and  PCR  Primers
Region  Length,  bp*  Positionb  CodonsC  PCR  pnmers,  5’-3’
15.1  1018  (1959-14F2916  653-972  15.1F:  GTGACCTTAATTTTGTGATCTCT
15 1 R.  TTCATTTGACCTCTTTTACCATA
15.2  992  2874-3819  959-1273  15.2F:  TATGCCAAATTAGAATACAAGAG
15 2R  GACAAAGATGATAATGAACTACA
15.3  1152  3784-4886  1262-1628  15 3F:  TTAACCAAGAAACAATACAGACT
2  15 3R  CATCCCCCGGTGTAAAACTAACA
15.4  1197  4867-6017  1623-2005  15.4F.  ACAAACTTCTACCATCACAAAAC
15.4R:  CATGAAATGATTTAGGAGCATAG
15.5  1329  6005-7287  2003-2429  15.5F.  CTCACAGGGAGAACCAAGTAAAC
15.5R.  AATACAGGTCTTTCTGATCTATC
15.6  1415  7247-86  15  2417-2843  15.6F  TGGAGCCAATAAAAAGGTAGAAC
15 6R.  CCTATTTACAAAATTTTTCAGTC
“Length  of the PCR products.
bTh0s.e bases between  the primer  paws,  numbered accordmg to Joslyn  et al  (IS)
%ose  complete codons between  the pnmers.
Searching  for  Mutations
APC  Region:  15.1  15.2  15.3
NnNNnN34M
73
bp
2,645
1,198
Fig.  3. Analysis  of DNA  heteroduplexes  ofAPC  mutants  by MDE  gel  electrophore-
sis. PCR  products  from  four  individuals  known  to  have  a mutation  in  exon  15 (regions
15. l-l  5.3)  of  the  APC  gene  were heat  denatured  and  then  allowed  to  reanneal,  form-
ing  heteroduplexes  between  the  wild-type  and  mutant  alleles.  These  were then  sub-
jected  to  electrophoresis  under  native  conditions  (1X  MDE  gel,  0.6X  TBE,  150 g/L
urea;  20  cm  gel  run  at  20  V/cm  for  16 h).  The  gel  was  stained  after  running  with
ethidium  bromide  and  then  photographed  with  UV  transillumination.  All  lanes  were
loaded  with  10  pL  of  purified  PCR  product  (equivalent  to  20  pL  of raw PCR),  except
for  lane  “n,”  which  was  loaded  with  2  pL.  The  various  DNA  fragments  do  not  run
strictly  according  to  size,  because  this  is  a native  gel  run  without  ethidium  bromide.
Heteroduplexes  are evident,  which  have  retarded  migration  with  respect  to  the  wild-
type  homoduplexes,  in  the  samples  containing  mutant  product.  Two  homoduplex
bands  are seen  in  mutant  samples  3 and  4 corresponding  to  wild-type:wild-type  and
mutant:mutant  duplexes.  M,  pGEMTM  DNA  markers  (Promega);  N  and n,  PCR  prod-
uct  from  normal  individual;  1,2-bp  deletion  at codon  796  (CTATGCTG);  2,5-bp  de-
letion  at  codon  1061  (AACAAAGAG);  3,  5-bp  deletion  at  codon  1309
(AAAAGATAT);  and  4,3-bp  deletion  at codon  1396  (GAGAGGG).
74  Frayling  and  Rowan
Chemical  cleavage  of  mismatch  exploits  the fact  that hydroxylamine  (Hy)
and  osmium  tetroxide  (OS)  will  react  with  un-  or  mismatched  bases  in
heteroduplexed  DNA,  which  can then be cleaved at these sites with  hot piperi-
dine  (Fig.  1) (42,55,56).  If  the DNA  was end-labeled  with  [32P] before  hetero-
duplex  formation,  then  autoradiography  after  gel  electrophoresis  will  reveal
those DNA  fragments  that have been shortened, i.e., cleaved  at a mismatch. If
labeled  size markers are included  on the gel, then the site of  the mismatch  can
be deduced. Because hydroxylamine  is specific  for  mis-  or unmatched  C resi-
dues, and osmium tetroxide  is specific for  mis- or unmatched T-residues,  then
additional  information  regarding  the nature  of  the mismatch  is gained.  As  a
way of  screening for  mutations,  CCM  has been overshadowed  by superficially
quicker and simpler methods, such as SSCP. This is understandable since CCM
requires  the use of  toxic  and  carcinogenic  chemicals,  although  the  amounts
involved  are very  small, as well  as radioactivity.  What may be a greater disin-
centive  is the requirement  for  a fume-hood  suitable for  use with  toxic reagents,
carcinogens,  and [32P], which  could  involve  considerable  expense if  a labora-
tory  does not already have  one. On paper, CCM  appears more time consummg
than  many  other  mutation  detection  methods,  but  some steps can be  semi-
automated or circumvented,  and it is possible to use fluorescently  labeled prim-
ers and analyze the reaction products  on an automated sequencer (57).  Where
larger  DNAs  can be screened (as with  exon 15 ofAX),  CCM  compares favor-
ably  with  other  methods. Chemical  cleavage  of  mismatch  also gives  precise
mformation  on the position  and nature of the possible mutation  detected, which
is often  most useful  during  subsequent sequencing.
Mutation  detection methods based on biochemical  or functional  tests of gene
products  are also being  developed,  and are likely  to prove  to be of  increasing
utility.  One of  these, the PTT,  is an application  of  the technique  of  in  vitro-
coupled  transcription  and translation  (IVTT),  which  exploits the protein-trun-
cating nature of  some mutations (Fig.  2)  (27,#8,58).  There  are two  features of
FAP  and  the APC  gene  that  make  PTT  a particularly  attractive  method  in
this  instance. First, most FAP mutations  result  in either  novel  stop codons or
frame  shifts, which  lead to premature  termination  of  the APC  protein.  Second,
the large  size of  exon  15, where  a high  proportion  of  mutations  happen  to be
located, means that gDNA  can be used as the PCR template, rather than having
to use cDNA.  A major  feature  of PTT,  which  is more generally  useful,  is that it
can be used to  screen a number  of  exons simultaneously,  although  this  does
necessitate a source of mRNA;  for AK,  this allows  screening of exons 1-14  in
just  two  tests. When  performed  using  cDNA,  the  PTT  is  also  potentially
capable  of  detecting  abnormalities  of  message splicing,  which  may  not  be
picked  up using other techniques, but it is not, at present, capable of  detecting
mis-sense  mutations.  It  should  also be mentioned  that PTT  does not  detect
Searching  for Mutations  75
all  those  mutations, which  would  be predicted  from  the genomic  sequence to
cause premature  termination  of the protein,  The reasons for  this are not appar-
ent, but may involve  message stability  in  vivo  or in vitro,  or close proximity  of
the mutation  to one end of the PCR fragment.
In  a small minority  of  cases in which  a mutation  is not  apparent within  the
protein-coding  region,  other techniques will  need to be employed, e.g., studies of
allele-specific  expression, Gross cytogenetic deletions involving  5q22 will  prob-
ably have been picked up in cases with  intellectual  impairment.  Otherwise  chro-
mosomal microdeletions  should be suspected in cases where linked markers show
unexpected apparent homozygosity. Chromosomal  deletions also might be found
by pulsed-field  gel electrophoresis or fluorescence in situ hybridization.
1.3.  Linkage  Analysis
In  those instances when  mutation  detection  is not possible,  not successfLI1,
or is limited  in extent and does not find  the mutation  responsible, then hnkage
analysis can be carried  out. It also can be of use when  a mis-sense mutation  has
been found  and additional  evidence  is needed that it is pathogemc, i.e., respon-
sible  for  FAP  in  a  particular  family.  Chromosomal  microdeletions  are  a  rare
cause of  FAP. They  should be suspected when  the lmked  marker  pattern  sug-
gests nonpaternity  or  nonmaternity,  but analysis of  markers  on other chromo-
somes has excluded  these hypotheses.  If  an  individual  has not  inherited  a
chromosomal  marker  allele  from  a parent, this almost certainly  means that he
or  she is hemizygous  and has a deletion  involving  one copy of  the APC  gene.
Although  it  is possible  to  use the Southern  analysis-based RFLPs,  the  PCR-
based microsatellites  are far more convenient  and more likely  to be informative.
We would  advocate  the use of  flanking  markers,  e.g., the distal  markers  LNS
(D5S346  [DP-I]  [.59])  and/or  MBC  (&KC  [60]),  together  with  the proximal
markers  CB26  (D5S299  [60/j  and/or  CA83A  (D5S122  [61/j.  It  is possible  to
multiplex  these (see Chapter  10). There  are a number  of  intragenic  polymor-
phisms  (62-65),  but  they  are in  linkage  disequilibrium,  which  reduces their
utility  (Bodmer,  W. F. and Cottrell,  S., personal  communication,  1995). How-
ever,  they can be of  use, for  example, in studying  allele-specific  expression.
2. Materials
2.1.  PCR
1.  Tuq  DNA-polymerase  (5  U/pL),  store  at -20°C.
2.  10X  Tuq  DNA-polymerase  buffer:  100  mM  Tris-HCl,  500  mM  KCI,  15 mA4
MgC&,  1% (v/v)  Trrton-X  100, pH  9.0  (2O”Q  store  at -20°C.
3.  dNTP  Mix  (100  mMtota1  dNTPs):  25 mi’vfeach  of  dATP,  dCTP,  dGTP,  and  TTP,
make  from  equal  amounts  of  100 mM  stock  dNTPs  (Pharmacia,  Milwaukee,  WI),
and store at -20°C.
76  Frayling  and  Rowan
4.  Oligonucleottde  primers’  For  CCM  and  HDA,  see Tables  1 and  2,  and  for  PTT,
see  Table  3  Stock  250-PM  solutions  of  primers,  in  20  mM  Tris-HCI,  1 mM
Na,EDTA,  pH  8.0,  are stored  at -20°C  Each  primer  pair  is diluted  with  water  m
a forward  and  reverse  primer  mix,  with  each primer  at  10 @4
5.  Water  water for qections,  1 0-mL  polyethylene  ampules,  store at room  temperature
6.  Mineral  oil  (Sigma,  St.  Louts,  MO),  store  at room  temperature.
7.  Loading  dye:  0  1% (w/v)  bromophenol  blue,  0.1%  (w/v)  xylene  cyanole,  25  rr.uV
Na,EDTA  (pH  8.0),  80%  (w/v)  sucrose, make  by adding  dyes to  the boded  syrup,
and  store  at  room  temperature.
8.  Electrophoresis  buffer  (TBE):  89 mMTns-borate,  1 mMNa,EDTA  (pH  8.0). Make
as 5X  stock  and  dilute  prior  to use with  addition  of  300  pg/L  of  ethtdium  bromide
(using  10 g/L  stock  ethidmm  bromide  [Sigma]),  and  store  at room  temperature
9  Agarose  1.5%  (w/v)  solution  of  LE  Seakern@  Agarose  (FMC  Bioproducts,
Rockland,  ME)  in  1X  TBE  containing  300  pg/L  of  ethidium  bromide.
10.  WizardTM  PCR  Preps  DNA  Purification  System  (Promega,  Madison,  WI).
2.2.  Heteroduplex  Analysis
(HDA)  on  MDE  (tiydrolinkTM)  Gels
1.  2X  MDETM  gel  concentrate  (FMC  Btoproducts),  store  at room  temperature.
2  0.5MNa,EDTA,  pH  8.0.
3.  Ammonium  persulfate  (Sigma):  10%  (w/v)  solution  m  distilled  water,  store  at
4°C.  Keep  for  1 wk  only.
4.  N,N,N’,N’-tetramethylethylenediamine  (TEMED)  (Sigma),  store in  the dark  at 4OC
5.  Urea  (Ultrapure  enzyme-grade;  Gibco  BRL,  Paisley,  UK)
6.  Electrophorests  buffer  (TBE)  (see Section  2  l.,  item  8)
7  Loading  dye  (see Section  2.1.,  item  7)
8.  Ethidmm  bromide  solution  1 mg/L  ethidium  bromide  in  0.6X  TBE,  make  using
10 g/L  stock  ethidmm  bromide  (Sigma).  Store  at room  temperature,  either  in  the
dark  or  a dark  glass bottle
2.3.  CCM
1.  T4  Polynucleotide  kmase,  10 U/yL  (Promega),  store  at -20°C.
2.  1 OX  T4  Polynucleotide  kinase  buffer  (Promega),  store  at -20°C.
3.  RedivueTM  [Y-~*P]-ATP  (3000  Ci/mmol;  Amersham,  Little  Chalfont,  UK),  store
at 4°C
4.  TE  buffer:  10 mJ4  Trts-HCl,  1 rr&f  Na,EDTA,  pH  7  5,  autoclave  and  store  at
room  temperature.
5.  Sephadex*  G-50  (Pharmacta):  make  up  in  TE  buffer  as per  manufacturer’s
mstructions,  and  store  at 4°C.
6.  2X  Annealing  buffer  O.GMNaCl,  7 rruVMgCl,,  6 mMTris-HCl,  pH  7.7, store at 4°C.
7.  Hydroxylammonium  chloride  (HO  . NH&l;  BDH)  or hydroxylamme  hydrochlo-
ride  (Sigma),  store  at room  temperature.
8.  Diethylamme  (Sigma),  store at room  temperature.
9  Pyridme  (Sigma),  store  at room  temperature.
Table  3
The  APC  Gene:  PlT  Primers
Region  Length,  bp”  Positionb  CodonsC  PCR  primers,  5’–3’
Exons  l-6  707  25-73  1  S243
(28,000)
Exons  1-15.2  2383  25-2326  !S775
(86,000)
15pl  1922  19793819  661-1273
Y
(70,000)
15~2  2655  3385-5955  1129-1985
(95,000)
15p3  3049  5680-8645  1894-2843
(103.000)
114pF:  T74GCTGCAGCTTCATATGATCAG
7Re.  ATGCTTGTTCTGAGATGAC
114pF:  T7-GCTGCAGCTTCATATGATCAG
114pR:  CCTTGGGACTTAAATTGTCTA
15~ 1F:  T7-CAAATCCTAAGAGAGAACA
15.2R:  GACAAAGATGATAATGAACTACA=
15p2F:  T7-AATCAAAATGTAAGCCAGTCT
15p2R:  GGGCTCAGTCTCTTTGATAGG
15p3F:  T7-AATAAGGAATCAGAGGCTAAA
15~3R:  CAGAACAAAAA  CCCTCTAACAAG
aLength of the PCR  products.
!Ihose  bases between  the pnmer  patrs,  numbered accordmg  to Joslyn  et al. (IS)
‘Those  complete codons  between  the primers,  wrth  (in parentheses)  the M,.  of the predicted full-size polypepttde product (calculated from the
sequence).
dT7-,GGATCCTAATACGACTCACTATAGGAACAGACCACCATG.
=As used for regron 15.2; see Table 2
78  Frayling  and  Rowan
10.  Osmium  tetroxide,  4%  (w/v)  solution  (Sigma),  store  at room  temperature.  This  is
supplied  in  glass  ampules  that  are  opened  and  the  contents  aliquoted  into  small
(4-mL)  glass  bottles  with  polypropylene  lids,  which  are then  wrapped  in  alumt-
num  for1 (to  exclude  light)  and  stored  m  a sealed  plastic  box  at 4°C.  For  waste
disposal,  see Note  2 1.
11  Stannous  chloride  solution:  100 g/L  SnCI,  (BDH,  Poole,  UK)  m  1M  HCI.
12.  Mussel  glycogen,  20  mg/mL  (Boehringer  Mannheim  GmbH,  Mannhelm,  Ger-
many),  store  at -20°C.
13.  Precipitation  solution:  0.3M  sodium  acetate,  0.1  mMNa,EDTA,  make  from  3M
sodmm  acetate  @H  5.0)  and  0.5M  Na,EDTA  (pH  8.0),  store  at 4°C.
14.  Ethanol,  store at  room  temperature.
15  Piperrdine  (Sigma),  store at  room  temperature.
16.  Formamrde  loading  buffer:  96%  (v/v)  formamtde  (Sigma),  20  mM  Na,EDTA
(pH  S.O), 0.05%  (w/v)  each bromophenol  blue  and  xylene  cyanole,  store  at 4°C
17.  Electrophoresrs  buffer  (TBE)  (see Sectton  2.1.)  Item  8).
18.  Stgmacote@  (Sigma),  store  at 4’C.
19.  SequagelTM  Sequencing  System  (National  Dragnostrcs,  Atlanta,  GA).
20  Ammonium  persulfate  (see Sectton  2 2.,  item  3).
2 1.  TEMED  (see Section  2.2.,  item  4).
2.4.  Reverse  Transcription  of  RNA
1.  Oligonucleotide  primer  15. lR,  stock  solution  of 250  pM,  as in  Section  2.1.) item  4,
dilute  to  10 pA4 m  sterile  water,  and  store  at -20°C.
2  M-MLV  Reverse  transcriptase,  RNase  H  Minus  (Promega).
3.  5X  Reverse  transcription  buffer  (Promega).
4.  Dithtothrertol  (DTT):  0. 1M  solution  in  sterile  water,  store  at -20°C.
5.  RNasm  ribonuclease  inhibrtor  (Promega),  store  at -20°C.
6.  dNTP  Mix  (100  mM  total  dNTPs)  (see Section  2.1.)  item  4).
7.  Water  (see Section  2. l.,  item  5).
8.  First-Strand  cDNA  Synthesis  Ktt  (Pharmacia;  see Note  33)
2.5.  PTT
1.  TNT@  T7  Coupled  Reticulocyte  Lysate  System  (Promega),  store  per  manu-
facturer’s  instructrons.
2  L-[35S]-Methionine  in  vivo  cell  labeling  grade  (>lOOO  Ci/mmol;  Amersham),
store  at -20°C
3.  RNasinTM  ribonuclease  inhibitor  (Promega),  store  at -20°C.
4.  TE  buffer  (see Section  2.3.,  item  4).
5.  2X  SDS-PAGE  loadmg  buffer.  20%  (v/v)  glycerol,  6%  w/v  SDS,  O.lM  DTT,
0.05%  (w/v)  bromophenol  blue,  store  at -20°C.
6.  Trrs  buffer  (for  resolving  gel):  1.5M  Tris-HCl,  0.4%  (w/v)  SDS,  pH  8.8,  store  at
room  temperature.
7.  Tris  buffer  (for  stacking  gel):  0 5M  Tris-HCI,  0 4%  (w/v)  SDS,  pH  6.8,  store  at
room  temperature.
Searching  for  Mutations  79
8.  Stock  acrylamide  solution:  30%  (w/v)  acrylamide,  0.8%  (w/v)  bis-acrylamide
(BDH),  store  at 4°C.
9.  Ammonium  persulfate  solution  (10%  [w/v])  (see Section  2.2.,  item  3)
10.  TEMED  (see Section  2.2.,  item  4).
11.  Rainbow’”  Protein  markers:  high  range  (Amersham),  store  at -2O’C
12.  SDS-PAGE  running  buffer:  25 mMTris  base (3 0 giL),  192 mA4glycme  (14.4  g/L),
0.1%  (w/v)  SDS  (5 mL  of  20%  [w/v]  SDS/L),  store  at room  temperature.
13.  SDS-PAGE  gel  fix  solution.  aqueous  10%  (v/v)  methanol,  10%  (v/v)  acetic  acid.
3. Methods
3.7.  PC/?
1.  Prepare  a master  PCR  mix,  referring  to  Table  4  for  the  volume  of  each  reagent
per  sample  to  be amplified.  Keep  on  ice until  dispensed.  Add  the  Tag  DNA-poly-
merase  immediately  before  use (see Note  1).
2.  To  0.6-mL  microcentrifuge  tubes,  add  2  pL  of  each  DNA  solution  to  be  ampli-
fied  (equivalent  to  200-1000  ng  DNA)  or,  for  PTT  from  cDNA,  add  10  pL  of  a
cDNA  reaction  (Section  3.4.).
3.  Add  the appropriate  volume  of the  master PCR  mix  to each tube,  ensurmg  thorough
mixing  with  the  DNA.  Add  sufficient  mineral  011 to  overlay  the  reaction  mix.  Cap
the  tubes  and  store  on  ice  until  ready  to  place  m  the  thermal  cycler  (see Note  2).
4.  Place  the  tubes  in  the  thermal  cycler,  and perform  the  PCR  For  conditions,  see
Table  5 (and  Note  3)
5.  When  finished,  check  for  satisfactory  amplification  by  agarose gel  electiophore-
sis.  Include  a suitable  DNA  size  marker,  e.g.,  1$X174 Hinf  I  digest  or  pGEMTM
(Promega)  (see Notes  4 and  5).
6.  It  is  necessary  to  purify  the  PCR  products  for  use in  CCM,  using  the  WizardTM
PCR  Preps  DNA  Purification  System  (Promega)  and  followmg  the  manu-
facturer’s  instructtons.  Elute  from  the  resin  with  50  pL  of TE  buffer,  and  store  at
4OC or  lower  (see Note  6).
3.2,  HDA  on  MDE  Gels
1.  Pipet  20  pL  of  each  unpurified  PCR  (Section  3.1.,  step  5)  into  0.6  ml-micro-
centrifuge  tubes  containing  1 ltL  of  0.5MNa2EDTA,  ensuring  thorough  mixing.
Cover  the reactions  with  some  mineral  oil,  which  can conveniently  be taken  from
the  original  PCR  (see Note  7).
2.  Form  DNA  heteroduplexes  by  heating  the tubes  to  95’C  for  3 min  and  then  cool-
ing  to  37’C  over  approx  30  min  (e.g.,  30  SK).  This  reaction  is best  carried  out
using  a thermal  cycler.
3.  Add  4  pL  of  loading  dye,  and  mix  thoroughly.
4.  Cast  an  MDE  gel  in  a  suitable  vertical  electrophoresis  system  (e.g.,  Bio-Rad
[Richmond,  CA]  Protean  IIxi,  using  20-cm  plates  and  l-mm  spacers),  with
1X  MDE  gel  concentration,  0.6X  TBE,  and  150  g/L  urea,  as per  manufacturer’s
instructions  (see Note  8).
5.  Wash  out  the  wells  and  load  the  samples.  Keep  the  tank  cool  with  a  suitable
supply  of  cold  water  (see Note  9).  Run  the  gel  at  20  V/cm.  An  18-20  h  run  1s
80  Frayling  and  Rowan
Table  4
Master  PCR  Mixes:  Reagent  Volumes/Sample
CCMHDA  PTT
Exons  From  From
Reagent  l-l  5a, pL  cDNA6,  pL  gDNA”,  pL
Water  76.7  29.1  37.1
1 OX  PCR  buffer  10.0  50  5.0
250  mM  M&l,  –  –  –
dNTP  mrxd  0.8  0.4  0.4
Forward  and  reverse  mtxe primer  100  5.0  5.0
Tuq DNA-polymerase  (5  U/pL)  0.5  05  0.5
Total  volume  (per  sample)  98  40  48
aE~~n~ 1-14  (see Table 1) and regions  15.1-15  6 of exon  15 (see Table 2).
bExons  l-6  and  1-15.2  (see Table 3)
CExon 15, regions  15~1-15~3  (see Table 3)
d25 n-&4 each dNTP
“2 5 p&leach
Table  5
PCR  Conditions  for  the  APC  Genea
Region  Denaturing  Annealing  Extension
Exons  1,2,3,5,7,8  and  10-14  94°C  x  60  s  55°C  x  60  s  72’C  x  60  s
Exons  4 and  6  94°C  x  60  s  58°C  x  60  s  72’C  x  60  s
Exons  9 and  15.1-15  6b  94°C  x  60  s  52°C  x  60  s  72°C  x  120  s
PTT  94°C  x  60  s  52°C  x  80  s  72OCx  180s
OAll PCRs  should  be performed  with  a single mltial  denaturatron  step of  94’C  x  120 s, fol-
lowed  by 34 cycles  of denaturing, annealing, and extensron, followed  by a single  final extension
step of 72’C  x 300 s
bThe PCRs  for exon 9 and regrons  15 l-l  5 6 can be camed out using the PTT conditrons,  1.e ,
an extension  trme of  180 s (see Note  3)
needed  for  the  exon  15 regions  15  l-15.6,  but  only  6-8  h  for  the  smaller  exons:
Refer  to  the  manufacturer’s  mstructions.
6.  When  finished,  separate the  glass plates,  and  stain  the  gels  by  immersing  them  m
the ethidium  bromide  solution  (1 mg/L  m  0.6X  TBE)  for  15-20  min  (see Note  10).
Destam  m 0.6X  TBE  for 20-30  mm.  Vtew the stained  gel  on a W-transilluminator.
7.  Wild-type  homoduplex  DNAs  usually  migrate  as a single  band,  but  occasionally
as a  doublet.  Heteroduplex  DNAs  give  an  additional  doublet  of  bands  (which
may  be  close  together  appearing  as one),  almost  always  migrating  more  slowly
than  the  wild-type  homoduplex  (Fig.  4,  pp.  82,83).  Sequencing  1s necessary  to
determine  whether  the  sequence  difference  is  a polymorphism  or  mutation.
Searching  for  Mutations  81
3.3.  CCM
There  are  essentially  five  steps  in  CCM  (not  including  the  preliminary  PCR
and  purification):
1.  Labeling  of  the  probe  DNA  (usually  wild  type).
2.  Formation  of  heteroduplexes  between  the  probe  and  test  samples.
3.  Reaction  of  the  heteroduplexes  with  hydroxylamine  or  osmmm  tetroxide.
4.  Reaction  with  hot  piperidme  (to  cleave  sites  of mtsmatch).
5.  Separation  of  the reaction  products  by  DNA-denaturmg  polyacrylamide  gel  elec-
trophoresis  followed  by  autoradiography  (Fig.  1).
3.3.1.  Labeling  DNA  for  Use  as  the  Probe
1  In  a 0.6~mL  microcentrifuge  tube on ice  and using  the PCR  product  amplified  from
wild-type  DNA,  set up the  following  labeling  reaction:  2 pL  punfied  PCR  product
(50-100  ng),  I&  1 OX polynucleotide  kmase buffer, 6 pL  Y-~~P-ATP  (3000  Ci/mmol;
60 pCi),  and  1 pL  T4  polynucleotlde  kmase  (10  U/pL)  (see Notes  11 and  12).
2.  Incubate  at  37°C  for  30-60  mm
3  Add  50  pL  of  TE  buffer  to  stop  the  reaction,  and  place  the  tube  on  ice.
4.  Remove  unincorporated  Y-~~P-ATP  by gel  filtration  through  Sephadex  G-50.  This
IS conveniently  performed  by  filling  a 0.45~pm  pore-size  Ultrafree@-MC  filter-
spm  column  (Millipore,  Bedford,  MA)  with  the  Sephadex,  washing  three  times
with  0.2  mL  of TE  buffer,  each time  spinning  the  column  m  a mlcrocentrlfuge  for
10 s. The  labeling  reactlon  is  then  put  onto  the  column  and  spun  for  20  s at  full
speed  in  the  mlcrofuge  (see Note  13).
5  Make  up  the  volume  of  the  eluate  (typically  70-80  pL)  to  100 pL  with  water,  If
not used immediately,  the probe  should  be stored at -20°C  or lower  (for up to  2 wk
depending  on  the  labeling  efficiency).
3.3.2.  DNA  Heteroduplex  Formation
Each  test  DNA  is  now  heteroduplexed  with  the  labeled  wild-type  DNA  (see
Note  14).
1.  In  0.6~mL  microcentrifuge  tubes,  mix:  3 FL  purified  PCR  product  (100-200  ng),
8 PL  2X  annealing  buffer,  and 5 pL  [32P]-labeled  probe.  The  probe  and  annealing
buffer  can  be premixed  and  dispensed  in  13-pL  aliquots,  prior  to  addition  of  the
PCR  product.  Ensure  the  tubes  are tightly  capped  (see Note  15).
2.  Form  heteroduplexes  by  heating  the tubes  to  95°C  for  5 mm  and then  annealing  at
42°C  for  lO(rl20  min  (see Note  16). This  is best carned  out usmg  a thermal  cycler.
3.  Briefly  spin  the  tubes  in  a microcentrifnge  to bring  down  any condensation  from
the  mstde  of  the  lids  (see Note  17).
3.3.3.  Hydroxylamine  Treatment
Either  this  step,  or  the  next  (Section  3.3.4.),  is  carried  out  on  each  hetero-
duplexed  sample  (but see  Note  14).
82  Frayling  and  Rowan
N  ?ln  la  ?lQ  us  ?/Q  m  ?h  ?fn  M
bp
249
128
118
Fig.  4.  CCM  analysis  of FAP  families  with  APC  exon  6 mutations.  Autoradiographs
of  CCM  gels.  Testing  carried  out  on  members  of two  FAP  families  with  mutations  in
APC  exon  6:  (A)  a  Q233X  mutation  (CAG+TAG),  and  (B)  an  R216X  mutation
(CGA+TGA).  All  reactions  with  hydroxylamine,  and  products  run  out  on  6%  dena-
turing  polyacrylamide  gels.  Note  the full-size  PCR  product  at 204  bp  and the  cleavage
products  in  (A)  at  128 bp,  and  (B)  at 76,77,  and  78 bp.  Autoradiograph  (B)  also  shows
the  generally  consistent  pattern  of background  bands,  which  is more  obvious  in  films
exposed  for  longer  periods.  Subsequent  sequencing  has shown  the  mutation  in  (B)  to
be  at  77  bp,  indicating  that  cleavage  also  took  place  at the  guanine  residues  flanking
Searching  for  Mutations  83
151
..I.  I
140
:,:r,
,  ,.I
.,,_
,
Fig.  4  (continued)  the  mutation.  M,  [32P]-labeled  markers;  N,  normal  DNA  (from
which  [32P]-labeled  probe  was made);  KA,  sample  from  individual  known  to  be
affected  with  FAP;  US,  sample  from  unaffected  spouse; ?/n,  sample  from  individual  at
risk  of  inheriting  the  mutant  allele  testing  negative;  and  ?/p,  sample  from  individual
at  risk  of  inheriting  the  mutant  allele  testing  positive.
84  Fraying  and  Rowan
1,  Make  a solution  of hydroxylamine  (approx  5M)  by  dissolving  1.4 g of hydroxyl-
ammomum  chloride  in  1.6  mL  of  distilled  water,  and  adjust  to  pH  6.0  wtth
diethylamme  (between  2  and  2.4  mL,  depending  on  the  batch  of  hydroxylam-
momum  chloride)  (see Note  18).
2.  To  each  16-pL  heteroduplex  reaction,  add  55  pL  of the  hydroxylamine  solution.
3  Incubate  at  37°C  for  90  mm  Proceed  immediately  to  the  cleavage  step  (Sec-
tion  3.3.5.)
3.3.4.  Osmium  Tetroxide  Treatment
1.  In  a  1.5-mL  microcentrifuge  tube,  mrx  1 mL  of  TE  buffer  (pH  8.0),  45  pL  of
pyridme,  and  I  pL  of osmium  tetroxide  (4%  w/v),  takmg  appropriate  precautions.
This  mixture  should  be  used  mnnediately  after  mixing  It  cannot  be  stored.
2  Add  40  uL  of  the  osmmm/pyrrdme  mix  to  each  16-uL  heteroduplex  reaction.
Ensure  each  tube  is  capped  tightly,  and  then  incubate  at  37°C  for  90  mm  (see
Note  19).  Proceed  immedtately  to  the  cleavage  step  (Section  3.3.5.).
3.3.5.  Heteroduplex  Cleavage
1  Add  60  pL  of  mussel  glycogen  (20  g/L)  to  2 mL  of  precipitation  solution  (Sec-
tion  2 3.,  item  12)
2  To  each heteroduplex  reaction,  which  has been  treated  with  either  hydroxylamine
(Section  3.3.3.)  or  osmium  tetroxide  (Section  3.3  4.)  add  100  pL  of  the  precipi-
tation  solution  containing  mussel  glycogen.  Then  add 400  pL  of  ethanol,  cap the
tubes,  and mix  well.  Cool  to  -20°C  or  lower  for  at  least  15 mm  (see Note  20).
3  Spm  the  tubes  at  full  speed  m  a microcentrifuge  for  10 mm  at  4°C  Tip  off  the
supematant  into  a glass beaker,  and,  while  keeping  the  tube  inverted,  touch  it  on
some  paper  tissue  to  blot  off  the  excess and  prevent  contamination  of the  outside
of the  tube  (see Note  2 1).
4.  Add  250  yL  of  70%  (v/v)  ethanol,  cap, and  spm  for  10 mm  at 4°C  (see Note  22).
5.  Carefully  remove  the  70%  ethanol  with  a pipet,  and  allow  the  tubes  to  dry  for  a
few minutes  at room  temperature  with  their  lids  open.
6.  Make  up  a  1M  solution  of  piperidine  by  adding  110  yL  of  the  pure  liquid  to
1 mL  of  distilled  water,  and  add  50  pL  to  each  tube,  ensuring  that  each  tube  is
tightly  capped.
7.  Vortex  mix  each  tube  for  at  least  30  s to  ensure  that  the  pellets  are  completely
dissolved.  This  is most  important.
8.  Heat  the  tubes  to  90°C  for  30  min.  Use  a heavy  block  to  prevent  any  tube  lids
from  opening,  or  else  carry  out  the  reaction  in  a thermal  cycler  with  a ltd.
9.  Remove  the  tubes  from  the heating  block  and allow  to cool  briefly  before  addmg
100 pL  of precipitation  solution  (without  glycogen),  followed  by 400  uL  of etha-
nol,  to  each tube.  Place  at -20°C  or  colder  for  at least  15 min.
10  Repeat  step  3, and  then  wash twice  with  70%  ethanol  as m  steps 4  and  5
11.  Now  dissolve  the  pellets  m  5 pL  of  TE  buffer.  It  1s critical  to  ensure  that  the
pellets  are dissolved  before  the  final  addition  of 3 pL  of formamide  loading  buffer
to  each  tube  (see Note  23).
Searching  for  Mutations
3.3.6.  Electrophoresis
85
The chemically cleaved end-labeled heteroduplex DNAs  are now  separated by
electrophoresis  under  denaturing  conditions,  and their  positions  are revealed
by autoradiography  of  the gel.
1.  Scrupulously  clean  the  glass  plates  of  the  sequencing  apparatus  (e g  , Bio-Rad
Sequi-Gen).  A  suggested  procedure  is  to  clean  the  plates  with  dilute  (3-5%  v/v)
Decon90TM  (BDH),  followed  by  thorough  rinsing  m  hot  tap  water,  and  then  a
final  wash with  70%  ethanol,  wrpmg  with  lint-free  paper  tissue.  When  completely
dry  and  dust-free,  the  back  plate  is  silamzed  with  Sigmacote@  so that  the  gel  ~111
separate  cleanly  off  after  electrophorews,  but  adhere  to  the  front  plate  The  back
plate  1s then  given  a final  wipe  clean  with  70%  ethanol  to  remove  the  residues
from  the  sllamzatlon.
2  Assemble  the sequencmg  apparatus,  and cast a 0 4-mm  thtck  denaturing  6%  poly-
acrylamlde  gel  m  1X  TBE  (see Note  24).  Use  a  sultable  comb  to  form  discrete
wells  in  the  gel  for  loading  individual  samples  (see Note  25)  Before  the  pre-run,
the  wells  must  be  flushed  out  thoroughly  (see Note  26).
3.  Pre-run  the  gel  at  1 7 kV  (equivalent  to  approx  60  W  for  a 40  cm  wide  x  50  cm
high  gel)  for  about  30 min  or  until  the  gel  has reached  a temperature  of 50°C  (see
Note  27).
4.  While  the  gel  is pre-running,  the  samples  are denatured  by  heating  them  to  95°C
for  5 min  in  a hot  block  or thermal  cycler.  They  are then  snap-chilled  by transfer-
ring  them  from  the  block  at  95°C  straight  mto  an  ice-water  bath,  and  leaving
them  for  5 mm  or  until  the  gel  is ready  for  loading  (see Note  28).
5.  Dilute  some  [32P]-labeled  DNA  size marker,  so that  in  a volume  of around  5  pL
(including  3  pL  of  formamide  loading  buffer),  there  is  approx  0 5-1x  the  radio-
activity  m  a  sample,  as assessed by  holding  the  tube  up  to  a p-monitor.  Do  not
denature  the  size  marker,  since  It  results  in  multiple  unmterpretable  bands  on
the  autoradiographs!
6.  After  the  pre-nm,  the wells  must  be flushed  out  again,  before  loading  the  samples
and  size marker;  it  is convenient  to  flush  and  load  three  or  four  wells  at a time.
7.  When  all  wells  are loaded,  start  the  electrophoresls  (see Note  29)
8.  When  the  electrophoresls  has fimshed,  separate  the  plates  and  transfer  the  gel  to
an  X-ray  film  cassette with  intensifying  screens.  This  can  be  achieved  without
resorting  to  having  to  fix  and  dry  the  gel.  Cut  two  pieces  from  sheets of  3MM
paper  (Whatman,  Maidstone,  UK):  40  x 26 and 26  x  15 cm  Apply  the short  edge
of the  larger  sheet to  the  lower  edge  of the  gel  (adherent  to  the  front  glass  plate),
and  smooth  it  out  over  the  rest  of  the  gel.  Cut  across  the  gel  with  a  scalpel
along  the  top  edge  of  the  sheet  (usually  about  10 cm  from  the  top  of  the  gel).
Now,  by  carefully  lifting  the  long  edge  of  the  sheet,  the  gel  ~111 peel  away
from  the  glass  adherent  to  the  paper.  This  1s then  wrapped  in  a single  layer  of
Saran WrapTM  (Dow-Corning,  Midland,  MI)  and placed  in  the X-ray  cassette, gel
uppermost.  The  smaller  sheet can then  be used to pick  up the  top  piece  of  the gel,
and  after wrapping  it  is placed  m  the cassette next to the  larger  sheet (see Note  30).
86  Frayling  and  Rowan
9.  After  ensuring  that  the  inside  of the  cassette is completely  dry,  load  it  with  X-ray
film  (e.g.,  Kodak  X-OMAT  AR,  Hemel  Hempstead,  UK),  and  place  it  wzthout
delay  in  a freezer  at -70°C.  This  is essential  to  prevent  diffusion  of the  bands  in
the  gel,  but  it  also  enhances  the  effect  of  the  intensifying  screens (see Note  3 1).
3.3.7.  Interpretation
1.  The  usual  banding  pattern  seen  on  CCM  autoradiographs  is  one  or  two  major
bands,  together  with  a background  of  relatively  low-mtensity  bands,  present  in
all  samples.  The  background  pattern  is probably  the  result  of cleavage  at sites  of
DNA  damage  that  has occurred  in  vitro  during  sample  processing,  such as oxida-
tive  lesions  and  depurination  (66).  When  a mismatch  has been  cleaved,  it  results
in  an  extra  smaller  band  (Figs.  1 and  4A).  A  plot  of  migration  distance,  from  a
suitable  datum  line  agamst  loglo  (marker  size in  bp)  should  be made.  The  size  of
this  smaller  fragment  gives  an estimate  of the  distance  from  one  end  or the  other
of the  PCR  product  that  the mismatch  occurred;  because both  strands  of the  DNA
were  labeled,  it  is  not  possible  to  say which  end  the  mismatch  was closest  to
Sequencing  is  always  necessary to  determine  the  exact  nature  of  any  mismatch,
and  decide  whether  it  represents  a mutation  or  polymorphism.
2.  If  the  cleavage  occurs  in  the  hydroxylamine  reaction,  then  the mismatch  involves
a mis-  or unpaired  C (i.e.,  C:A,  C:T,  C:C  or C:-).  If  cleavage  occurs in  the osmmm
tetroxide  reaction  then  the  mismatch  involves  a  mis-  or  unpaired  T  (i.e.,  T:C,
T:G,  T:T  or T:-).  Unpaired  bases result  from  the  looping  out  of  a short  stretch  of
ssDNA  in  heteroduplexes  formed  between  wild-type  and  deletion/insertion
mutants.  Indeed,  cleavage  m  both  reactions  is usually  good  evidence  that  such  a
mutation  has been  found  (the  alternative  posstbihty  1s a C:T  mismatch).  With  end
labelmg  it  is theoretically  possible  for  two separate mismatches  (e.g.,  a polymor-
phism  and  a mutation)  to  be  observed  m  different  parts  of  the  same  DNA  frag-
ment  if  they  result  in  cleavage  of  opposite  strands.  Two  sites  sensitive  to  the
same  agent  on  the  same  strand  should  appear  as a  single  site,  1 e.,  that  of  the
mismatch  nearer  to  the  label,  assuming  100%  cleavage
3,  Occasionally,  a variant  pattern  is seen, in  which  two  or more  short  bands  are seen
close  together.  This  probably  represents  cleavage  at  and  around  the  site  of  the
mismatch  (Fig.  4B),  not  necessarily  following  the  “rules”  in  Section  2.
3.4.  Reverse  Transcription  of  RNA
To  carry  out  a PCR  using  an mRNA  template, the RNA  must  first  be used to
direct  synthesis of  cDNA.  This  is achieved  with  reverse  transcriptase, because
Tuq-DNA-polymerase  does not  have  RNA-directed  DNA-polymerase  activ-
ity. As with  all work  involvmg  RNA,  the greatest possible care should be taken
to  avoid  contamination  with  RNases. Wear  gloves  at  all  times  (and  change
them frequently),  and use clean disposable plasticware  whenever  possible. The
method  described  below  uses separately  sourced components.  However,  we
have  achieved  satisfactory  results using the First-Strand  cDNA  Synthesis Kit
(Pharmacia);  see Note  33.
Searching  for Mutations  87
1.  Mix  in  a 0.6  mL  microcentrifuge  tube:  12.0  pL  5X  reverse  transcriptase  buffer,
4.0  yL  RNasin  (40  U),  6.0  pL  oligonucleotide  15,lR  (10  J.&Q, 0.6  pL  dNTP  mix,
x  pL  RNA  (2-5  pg),  y  yL  M-MLV  reverse  transcriptase  (600  U),  and  water  to
60.0  pL.  Incubate  at  37°C  for  1 h.
2.  Use  immedtately  in  PCR  (Section  3.1.),  or  store  at -2O’C  until  needed,
3.5.  PTT
Using  suitable  oligonucleotide  primers,  i.e., a forward  primer  containing  a
T7  RNA-polymerase  binding  site and an in-frame  start codon, together  with  a
compatible  reverse primer,  the PCR is used to amplify  the required  sequence,
either  from  gDNA  (for  exon  15) or cDNA  (for  exons 1-14).
1  Thaw  the  reagents  and place  on  ice.
2.  Combine in a 0.6-mL microcentrifuge tube (this is sufficient for  12 reactions):
125  uL  TNT rabbit  reticulocyte  lysate,  10 pL  TNT reaction  buffer,  5  pL  RNasm
(50  U),  10  pL  [35S]-methionme  (1000  Ci/mmol),  5  pL  ammo  acid  mix  (mmus
methionine),  40  uL  TE  buffer,  pH  7.5,  5  pL  TNT T7  RNA-polymerase  (50  U).
Mix  gently  but  thoroughly.  Distribute  15 pL  to each 0.6~mL  microcentrifuge  tube.
3  Add  4 pL  of unpurified  PCR  product  (see Note  34), mix,  and incubate  at 30°C  for  1 h.
4.  Add  20  pL  of  2X  SDS-PAGE  loading  buffer.
5.  Cast two  15% polyacrylamide  gels using  the following:  resolving  gel  mix  (lower):
7.5  mL  1.5MTris-HCI  buffer,  pH  8.8,  15 mL  stock  acrylamide  solution,  7.5  mL
distilled  water,  40  yL  TEMED,  100 pL  10%  (w/v)  ammonium  persulfate.  Over-
lay  with  distilled  water  (to  exclude  oxygen),  and when  set, cast the  upper  stack-
ing  gels.  Stacking  gel  mix  (upper)  consists  of:  2.5  mL  0.5M  Tris-HCl  buffer,
pH  6.8,2.5  mL  stock  acrylamide  solution,  8.5 mL  distilled  water,  40 l.tL  TEMED,
100  pL  10% (w/v)  ammonium  persulfate  (see Note  35).
6  Assemble  the  gel  apparatus,  remove  the  combs,  and  flush  the wells  out  with  SDS-
PAGE  running  buffer.
7.  Denature  the  samples  by  heating  them  to 99Y!  for  2 min  (conveniently  achieved
m  a thermal  cycler).  In  the meantime,  mix  10 pL  of 2X  SDS-PAGE  loading  buffer
with  10  pL  of the Rainbow’”  protein  markers,  and  load  10 pL  into  each “Marker”
lane (do not  heat denature this mix, since it bleaches the dye-labeled proteins).
Finally,  load  the  denatured  samples  into  the  wells  (see Note  36).
8.  Run the gels at constant current (40  mA  each  for  100  x  100  x 0.8  mm  Bio-Rad
MiniProteanTM  gels),  until  the  bromophenol  blue  reaches  the  bottom  of  the  gel
(see Note  37).
9.  Separate the glass plates and fix  the gels in gel fixing  solution for  10 min, with
occasional gentle agitation.
10.  Dry  down the gels on 3MM  paper (Whatman, Maidstone, UK), using a heated
vacuum  gel  dryer  (e.g.,  Model  853,  Bio-Rad).  Place  the  dried  gels  in  an  X-ray
film  cassette, and load  it with  film  (e.g., Kodak  X-OMAT  AR).  Expose for  12-24  h
(e.g., overnight)  at room temperature.
11.  Interpretation depends first on estimating the sizes of  any prematurely termi-
nated polypeptides (Frg. 5). A  very  approximate idea can be gamed by visual
88  Frayling  and  Rowan
A  Region:  Exons  1 –  6  Exons  1 –  15.2
1  2  3  1  2  3  N
–  Normal product
(Exons  I-  15.2)
–  Truncated
product  (3)
Nomml  product
–  (Exons  1 – 6)
c  Truncated
product (2)
–  Truncated
product  (1)
B  M,  N  ’  2  3  4  5  6  7  8  9  10  11
(x1(X3)  E**
66.0
N
–  Normal
product
I
,
ffy  ’  Truncated
cproduct
(A1061)
46.0  : 1: i  _
;  ,.
Fig.  5. PTT  analysis  of  individuals  with  FAP.  (A)  Mutations  in  exons  1-14;  and (B)
mutations  in  exon  15 (PCR  region  15~1). Autoradiographs  of PTT  gels.  Testing  carried
out  on  FAP  patients,  and  showing  [35S]-methionine-labeled  products  from  (A)  cDNA
PCRs  (spanning  exons  l-6  and  1-15.2;  see Table  3),  and (B)  products  from  gDNA  PCR
region  15~1  (codons  661-1273;  see Table  3),  analyzed  by  SDS-PAGE  on  10%  gels.
Note  in  gel  (A)  that  samples  truncated  in  exons  l-6  give  more  strongly  labeled  products
Searching  for Mutations  89
mterpolation  between  the  marker  proteins,  but  tt  1s better  to  calibrate  the  gels  by
plotting  the  migration  dtstances  of the  Rambow  protein  markers  (from  a suitable
datum  line)  against  then  loglo  (M,).  By  then  measurmg  the  migration  distance  of
candidate  bands,  their  M,  can  be  determined  with  reasonable  accuracy,  and  by
then  assummg  that  each  ammo  acid  has an average  M,  of  110 (see Note  38),  the
position  of  the  termmation  codon  can be  estimated.  It  is  strongly  recommended
to  include  some  defined  mutants  on  the  gels,  e.g.,  the  5-bp  deletions  at  codons
1061  and/or  1309  dependmg  on  the  PCR  region,  which  will  give  products  of
known  size  as well  as acting  as positive  controls  (Fig.  5B).  Note  that  the  stop
codon  generated  by  many  frame-shifting  mutations  can be some  way downstream
of  the  mutation  itself.  These  would  be  predicted  to  produce  mutant  truncated
versions  of  the  APC  protein  with  a novel  stretch  of  amino  acids  at the  carboxyl
terminal  As  an  example,  the  stop  codon  generated  by  a  smgle  base  deletion  at
position  3573  (in  codon  1191,  CAGA+CAA)  is  predicted  to  create  a novel  car-
boxy1  terminal  73  amino  acids  long  (30).
4.  Notes
4.1.  PCR
1.  Include  a sample  from  a known  normal  individual  (which  will  be  necessary  for
subsequent  labeling  m  CCM  analysis)  and  a “no  DNA”  control.  It  IS highly  rec-
ommended  to  include  a  sample  or  samples  from  known  mutants  In  any  event,
this  is essential  if  performing  predictive  testing.
2.  The  use of mechanical  (e.g., Eppendorf  Multipette,  Eppendorf,  Hamburg,  Germany)
or  electronic  (e.g.,  Gilson  EDP-2;  Gilson,  Villiers-le-Bel,  France)  pipets  allows
considerable  savmgs  in  time,  for  this  and many  other  steps, particularly  in  CCM.
Electronic  pipets  are recommended  because the volume  dispensed  is not  restricted
to  preset  values  and  the  dispensing  velocity  can be  varied.
Fig.  5  (continued)  when  tested  by  the  shorter  cDNA  PCR,  but  that  the  same  mutant
products  are detectable  in  the  1-15.2  PCR.  In  gel  (A)  sample  1, and  all  lanes  in  gel  (B),
note  that  in  addition  to  the  full-sized  normal  product,  there  are  shorter  bands  present.
These  arise  owmg  to  translation  initiation  at  “internal”  methionme  codons  (and  to  a
lesser extent translation  of RNAs  present in  the reticulocyte  lysate).  The  doublet  of bands
immediately  below  the normal  product  in  gel  (B)  is due to  Initiation  at mternal  sites, and
m  most  of those  samples  with  a truncated  product,  an equivalent  pair  of truncated  inter-
nally  initiated  products  is evident  below  the  mutant  product  (i.e.,  samples  1,3,5-7,  and
9). (A):  N,  sample  from  normal  individual;  1,2,  and  3, samples  from  affected  individu-
als  in  different  FAP  pedigrees-their  mutations  have  yet  to  be defined  by  sequencing.
(B):  N,  sample  from  normal  individual;  test  samples  with  known  mutations:  1, codon
969;  3, codon  1204;  4, codon  1309;  9, codon  1061  (truncated  product  with  M,. 44,000);
and  11, codon  1407.  Samples  2 and  10 have not  yet  had  an APC  mutation  detected  and
the  mutations  in  samples  5-8  have  yet to  be defined  by  sequencmg.
90  Frayling  and  Rowan
3.  The  PCR  thermal  cycling  parameters  have  been  determined  with  standard
thickness  0.6~mL  microcentrifuge  tubes  (Treff,  Scotlab,  Strathclyde,  UK)  in
OmniGene  thermal  cyclers  (Hybatd  TM, Teddington,  UK),  using  the  “Srmulated
Tube”  control  option.  The  conditions  may  need adjusting  if  other  tubes, machines,
and/or  control  options  are used.
4.  Using  small  (28-n&)  gels m  suitable  apparatus (HE33  Submarine  Agarose Gel  Units;
Hoefer  Scientific  Instruments,  San Francisco,  CA),  only  2-3  pL  of PCR  product  are
needed,  plus  2 pL  of  loading  buffer.  These  can be conveniently  mixed  in  V- or  U-
well  96-well  assay plates  (e.g.,  Falcon@ 39 11; Becton  Dickinson,  Oxnard,  CA)
5  It  is  recommended  that  the  PCRs  be stored  at 4’C  overnight,  or -2O’C  for  longer
periods,  until  purification  or  use in  HDA/PTT.
6.  Purification  is  necessary  to  remove  the  oligonucleotide  primers  and  dNTPs,
which  would  otherwise  interfere  with  the  subsequent  labeling  and  CCM  reac-
tions.  This  step can be semiautomated  with  the  Vat-ManrM  Laboratory  Vacuum
Manifold  (Promega),  which  then  enables  up  to  20  samples  to  be  processed  in
30-40  min  (with  minimal  handling)
4.2.  HDA  on  MDE  (HydrolinkTM)  Gels
7.  The  instructions  provtded  with  the  MDE  gel  concentrate  by  the  manufacturer
(AT  Btochem)  are most  comprehensive  and should  be read before using  the product
8.  The  use of  150 g/L  urea  in  the  MDE  gel  mtx  IS optional,  but  excluding  it  causes
band  broadening
9.  We  use  ordmary  cold  tap  water  to  cool  the  electrophoresis  tank.  This  keeps  the
gel  between  10 and  12’C,  depending  on  the  time  of  year.  The  precrse  tempera-
ture  does not  appear  to be critical.  It  might  be worth  experimenting  with  different
temperatures  tf  a suitable  apparatus  is available.
10.  The  0.6X  TBE  from  the  electrophoresis  tank  can  be  used  to  stain  the  gel,  after
addition  of  ethidium  bromide.  Destaining,  like  stammg,  can  be carried  out  with
water  or  0.6X  TBE.  Either  causes  the  gels  to  swell,  but  the  effect  is  greater
with  water,  which  may  be a problem.  The  stammg  solution  can be  kept  for  sev-
eral  weeks  if  stored  in  the  dark  (or  a dark  glass bottle).
4.3.  CCM
11.  All  the  quantities  quoted  for  CCM  analysis  are  sufficient  for  up  to  20  samples,
using  either  osmium  tetroxtde  or  hydroxylamine  They  can  be  scaled pro  rata.
12.  T4  polynucleotide  kinase  is labile  at temperatures  above  -2O’C.  Therefore,  keep
it  on  ice at  all  times  when out  of the  freezer.  Alternatively,  use a cold  block,  e g.,
Stratacooler  (Stratagene,  La  Jolla,  CA).
13.  Other  methods,  such  as differential  precipitation,  can  be  used  to  purify  end-
labeled  probes.
14.  Double-size  heteroduplex  reactions  can be carried  out  and then  divided  into  two
separate tubes,  if  it  is desirable  to  carry  out  both  the  hydroxylamine  and  osmmm
reactions  on  the  same  samples  with  the  same  batch  of probe.
Searching  for  Mutations  97
15.  The  mass  ratio  of  1abeled:test  DNA  is  approx  1:5-20.  This  biases  the  mutant
DNA  mto  taking  part  in  heteroduplexes  and  thus  helps  to  maximize  the  efli-
ciency  of  the  procedure.
16.  DNAs  larger  than  1 kb  only  need  60  min  to  anneal.  The  tubes  can be  left  to  cool
to  room  temperature  after  the  42°C  step.
17.  Heteroduplexes  can be stored  at 4°C  overnight  if  convenient,  before  the hydroxy-
lamine  or osmium  treatment
18.  The  pH  should  be  measured  with  a pH  electrode,  and adjusted  to  withm  *O.  1 pH
units.  The  solution  should  be  stored  at 4”C,  but  for  no  longer  than  1 wk.  Tubes
containing  1.4 g of  hydroxylamine  can be  conveniently  weighed  out  m  batches,
taking  appropriate  precautions,  and  stored  at  room  temperature  for  up  to  3 mo.
19.  Some  batches  of  microcentrifuge  tubes  turn  a  gray  color  during  the  osmmm
tetroxide  treatment.  This  does not  affect  the reaction  and  is a useful  indicator  that
osmium  was added  to  all  the  tubes.
20.  Cooling  can  be achieved  by  using  a suitable  freezer  or  a dry-me/methanol  bath
However,  if  using  the  latter,  the  tubes  must  be  labeled  with  a suitable  pen,  e.g.,
Securiline  Biotech  MarkerTM  (Radleys,  Saffron  Walden,  UK),  which  has  alco-
hol-resistant  ink.
21.  Waste  containing  osmium  tetroxide,  e.g.,  glass  vials  and  supernatants,  can  be
neutralized  with  the  acid  stannous  chloride  solution,  but  local  disposal  regula-
tions  should  always  be  followed.
22.  The  precise  volume  used for  the  ethanol  wash is not  critical,  but  it  is important  to
remove  as much  as possible  before  proceeding  to  the  next  step.  Care  should  be
taken  to  avoid  disturbing  the  DNA/glycogen  pellet,  which  should  be just  visible.
In  any  event,  the tubes  can be quickly  and easily  checked  by  holding  in  front  of  a
S-monitor.  The  pellets  can be  stored  in  the  second  wash overnight  at -20°C
23.  Failure  to  dissolve  the  pellets  in  TE  buffer  first,  before  addmg  the  formamide
loading  buffer,  results  m  a sticky  mass m  the  bottom  of  the  tubes,  which  blocks
the  fine  pipet  tips  used  to  load  the  samples  onto  the  gel.
24.  The  range  of  SequagelTM  concentrates  (National  Diagnostics)  is  ideal  and  most
convenient  for  this  purpose.  We  use 22  x  50  cm  (w x h)  plates  for  running  up  to
20  samples,  and  40  x  50-cm  plates  for  running  up  to  36  samples.
25.  The  use of “sharkstooth”  combs  is not  recommended.  The  lack  of a gap between
lanes  when  using  these  makes  the  interpretation  of  the  subsequent  autoradio-
graphs  rather  difficult.
26.  Wells  can be  flushed  using  a fine  needle  (e.g.,  21-gage  or  smaller)  on  a 50-mL
syringe  filled  with  1X  TBE.
27.  Pre-running  time  can be  considerably  reduced  by  filling  the  top  electrophoresis
tank  with  1X  TBE  buffer  which  has been  preheated  (e.g.,  in  a microwave  oven)
to  55-60°c.
28.  If  after  denaturing  the  condensation  in  the  lids  is excessive,  then  the tubes  can be
briefly  spun  m  a refrrgerated  microfuge.  Otherwise  it  is  usually  found  that  the
volume  of  the  samples  has conveniently  reduced  itself  to  about  5 pL.  Loading
volumes  much  greater  than  this  causes excessive  band  broadening.
92  Frayling  and  Rowan
29.  Electrophoresis  conditions  will  vary  depending  on the  size of  the DNAs  concerned
For  regions  15.1-15.6  run  on  a  50-cm  long  gel  at  1.7 kV,  then  2.5-3.5  h  (or  until
15 mm  after the  bromophenol  blue  runs out  of the  gel)  are suitable.  Shorter  regions
only  need  1.5-l  .75 h, but these parameters  need to be decoded by some trial  and error
depending  on  the  fragment  size(s), apparatus,  ambient  air  temperatures,  and  other
local  factors. If a temperature-controlled  electrophoresis  power-pack  is avatlable  (e.g.,
BmRad  PowerPack  3000),  try wtth  a set temperature  of 45°C  as a starting  point
30.  With  50 x 40-cm  gels, leave  some wells unloaded  in the  center, use two 40  x 26-cm
sheets side  by  side,  and  cut the  gel  down  the  middle  and  across the  top  (in  a “T”
shape).  Fmally,  use a third  sheet to  pick  up  the  top  section  of the  gel.
3 1  Depending  on  the  efficiency  of  the  labeling  and  amount  of  probe  used,  we usu-
ally  make  three  exposures  one  overnight,  another  the  next  day  for  a few hours
(in  case  there  are  any  cleavage  bands  close  to  the  main  band,  which  are
“swamped”  by it  at longer  exposures),  and a third  for a few/several  days (to reveal
any  products  cleaved  with  reduced  effctency).
4.4.  Reverse  Transcription  of  RNA
32.  RNA  can  be  purified  from  lymphocytes  extracted  from  fresh  blood,  lympho-
blastotd  cell  lines,  or  tissue  samples  snap-frozen  in  liquid  nitrogen  (51)
33.  We  have  achieved  equally  good  results  using  either  separately  sourced  compo-
nents  or  the  First-Strand  cDNA  Synthesis  Ktt  (Pharmacia).  The  choice  comes
down  to  one  of  cost and/or  availability
4.5.  PTT
34.  Best  results  are  obtained  with  PCRs  that  have  gtven  a  specific  product  in  high
yreld  (1 e., without  spurtous  bands owmg  to mu-prtmmg);  poor-quality  PCRprod-
ucts encourage  the  syntheses of  spurious  polypepttdes  and,  hence,  result  m  poor-
quality  protein  gels  We  design  oligonucleotide  primers  with  the  aid  of  the
software  package  OLIGOTM  (MedProbe  AS,  Oslo,  Norway);  good  destgn  of
primers  is  essential  for  good  results  m  PCR.
35.  The  mix  volumes  given  are for casting  two Bio-Rad  MiniProtean  gels  (100  x  100
x  0.8  mm).  They  should  be  scaled pro  rata  if  usmg  other  apparatus.  It  1s recom-
mended  that  PTT  products  are analyzed  on a  10 as well  as a  15% polyacrylamide
gel  The  lower  strength  gel  gtves better  resolution  of  higher  mol-wt  polypeptides
assisting  in  detecting  mutations  close  to  the  3’ end  of  the  PCR  product.  The  vol-
umes  of  stock  polyacrylamtde  solutton  and  water  m  the  resolving  mix  should
simply  be  adjusted  accordingly.
36  There  will  be  condensation  m  the  tube  lids,  but  unless  it  is  excessive,  there  is no
need  to  centrifuge  the  tubes.  It  will  usually  be  found  that  the  volume  of  the  PTT
reaction  has been  conveniently  reduced  to  about  35  l.tL.  Load  all  of  tt  on the  gel.
37.  Bto-Rad  MinIProtean  gels typically  take  about  90 mm  to  run at a constant  40  mA
38.  This  value  of  110  for  the  average  n/i,  of  an  ammo  actd  is  calculated  from  the
predicted  M,  of  the  full-length  APC  protein  (3 11,658)  divided  by  the  number  of
ammo  acids  (2843).  It  1s m  contrast  to the  “weighted  mean”  figure  of  126.7  gtven
m  Sambrook  et al  (67)
Searching  for  Mutations  93
4.6.  DNA  Sequencing
When a possible mutation  has been localized  to a particular  exon or  region,
it is necessary to  sequence the DNA  involved  to determme  the precise nature
of  the putative  lesion.
39.  If  localized to a region, e.g., exon 15.3, then further  screening tests (HDA  or
CCM)  can be carried out first on subregions to narrow down the area. The  size  of
a truncated protein on PTT  analysis can also be used to localize the region con-
taining the mutation. However,  it should be remembered that  some  frame-shift
mutations can be quite a distance upstream of the site of premature termination
and  not  necessarily  in  the  same  exon.
40.  The exon/region 1s reampllfied  by PCR (as m Section 3. l.),  but this time usmg
a S-biotinylated  prrmer  in  place  of one  of  the  ordinary  primers.  After  checking
the  PCR  on  a small  agarose gel, streptavldm-coated paramagnetlc beads (e.g.,
Dynabeads@  M-280;  Dynal  AS,  Oslo,  Norway)  are  used  to  purify  the  PCR
product.  There  is  no  need  to  isolate  the  product  from  the  excess biotmylated
primer  first.
41  After  washing,  as per  the bead  manufacturer’s  instructlons,  the biotmylated  PCR
product  can be  strand-separated,  and  by  further  manipulation  if  necessary,  both
strands  can  be  used  m  a sequencing  reaction,  e.g.,  Sequenase=M  (USB,  Cleve-
land,  OH).  We  have  found  results  with  [a-33P]dCTP  (Amersham)  to  be  better
than with  [a-35S]dCTP.  It  also  has the  advantage  of  speeding  up  the  process,
because  the  gel-fixing  and  drying  stages can be ehmmated  and  the  gels  handled
Just  like  CCM  gels  (Section  3.3.6.).
42.  For  those  with  access to  a  fluorescent  DNA  analyzer  (e.g.,  ABI  373,  Applied
Brosystems,  Foster  City,  CA),  it  IS not  necessary to  re-PCR  with  a blotmylated
primer,  but  it  is recommended  to  LMP-agarose  gel-purify  the  PCR  product,  par-
ticularly  If  using  the  ABI  Prism  TM Dye-Deoxy  Sequencmg  Kit.  The  accuracy
with  which  CCM  gives  the  site  of  a  mismatch  1s extremely  useful  for  calling
heterozygotes with  such systems. It  is in  fact possible to combme CCM  with
fluorescent  DNA  analysis,  with  the  advantage  that  using  a different  dye  on  each
strand  (by  the  use  of  appropriate  PCR  primers)  allows  any  mismatches  to  be
located unambiguously, minimizing subsequent sequencing (57).
Acknowledgments
The  authors thank David  Bicknell,  Sally Cottrell,  Victoria  Johnson, Juliette
Smith-Ravin,  and Kevin  Pack for  their  help  m setting up the CCM  and HDA
methods, discussions about them, and performing  some of  the analyses seen in
the various  figures.  We also thank Sir Walter Bodmer  (Director  General  of  the
Imperial  Cancer Research Fund, and Head of the ICRF  Cancer Genetics Labo-
ratory)  for  his original  suggestions regarding  the methods and his most helpful
critical  comments. Thanks are also due to Rob B. van der Luijt  (Department  of
Human  Genetics, Leiden  University,  The Netherlands),  for  giving  us prepubli-
94  Fraying  and  Rowan
cation access to his method for  PTT  analysis, and John Burn  (Division  of Medi-
cal Genetics, University  of  Newcastle  upon  Tyne,  UK)  for  helpful  discussion
about APC  gene deletions. We also give  thanks to Nigel  Webb (Medical  Illus-
trator  at St. Mark’s  Hospital)  and Bill  Bessant (Photographic  Unit,  Imperial
Cancer Research Fund)  for  their  help in preparing  the various  autoradiographs
and gel photographs  for  pubhcation.
Note  Added  in  Proof
Two  laboratories  have discovered  an additional  54-bp exon located between
exons 10 and 11, termed  Exon X  (68)  or Exon  1 OA (69).
References
I.  Cnpps, W. H. (1882) Two  cases of  disseminated polypus of  the rectum. Trans
Path01  Sot  Lond  33,  165-168
2.  Bickersteth,  R  A.  (1890)  Multiple  polypi  of the rectum  occurring  in  a mother  and
child.  St Bartholomew  ‘s Hosp  Rep  26,299-30  I.
3.  Knudson,  A  G  ,  Jr.  (1971)  Mutation  and  cancer:  statistical  study  of  retmo-
blastoma.  Proc  Nat1  Acad  Sci  USA  68,  820-823.
4  Fearon,  E.  R.  (1992)  Genetlc  alterations  underlying  colorectal  tumorigenesls.
Cancer  Surveys  12,  119-136.
5.  Koorey,  D.  J.  and  McCaughan,  G.  W.  (1993)  Tumour  suppressor  genes  and
colorectal  neoplasia.  J  Gastroenterol  Hepatol  8,  174-184.
6  Jagelman,  D.  G.,  DeCosse,  J. J.,  and  Bussey,  H.  J. (1988)  Upper  gastromtestmal
cancer  m  familial  adenomatous  polyposis.  Lancet  1,  1149-l  15 1.
7.  Nugent,  K.  P.,  Splgelman,  A  D.,  and  Phillips,  R.  K  (1993)  Life  expectancy  after
colectomy and rleorectal anastomosls for  famlhal  adenomatous polyposls.  Dzs.
Colon  Rectum  36,  1059-l  162.
8.  Gardner,  E.  J.  and  Richards,  R.  C.  (1953)  Multiple  cutaneous  and  subcutaneous
lesions  occurrmg  simultaneously  with  hereditary  polyposis  and osteomatosls.  Am
J  Hum  Genet.  5,  139-147.
9  Brett,  C.  A.  M.,  Her&man,  M  J.,  and  Glazer,  G.  (1994)  Other  manifestations  of
familial  polypos~s,  m  Famzlzal  Adenomatous  Polyposzs  and  Other  Polyposis  Syn-
dromes  (Phillips,  R.  K.  S.,  Spigelman,  A.  D.,  and  Thomson,  P.  S.,  eds.),  Edward
Arnold,  London,  pp.  143-158.
10.  Herera,  L.,  Kakatis,  S.,  and Gibas,  L.  (1986)  Gardner  syndrome  in  a man  with  an
interstitial deletion of 5q. Am.  J.  Med.  Genet.  25,473+76.
11.  Bodmer,  W.  F.,  Bailey,  C.  J.,  Bodmer,  J.,  Bussey,  H.  J.,  Ellis,  A,  Gorman,  P.,  et
al.  (1987)  Localization  of  the  gene  for  familial  adenomatous  polyposis  on  chro-
mosome  5.  Nature  328,614-616
12.  Leppert,  M.,  Dobbs,  M.,  Scambler,  P  , O’Connell,  P  , Nakamura,  Y.,  Stauffer,  D.,
et al.  (1987)  The  gene  for  familial  polyposis  coli  maps  to  the  long  arm  of chromo-
some  5  Science  238,  1411-1413.
Searching  for Mutations  95
13.  Nakamura,  Y.,  Nlshisho,  I.,  Kmzler,  K.  W.,  Vogelstein,  B.,  Miyoshi,  Y.,  Miki,  Y.,
et  al.  (1991)  Mutations  of  the  adenomatous  polypos~s  coli  gene  in  familial
polyposis  coli  patients  and  sporadic  colorectal  tumors.  Prmcess  Takamatsu  Symp.
22,285-292.
14.  Groden,  J.,  Thliveris,  A.,  Samowitz,  W.,  Carlson,  M  , Gelbert,  L.,  Albertsen,  H  ,
et  al.  (199  1)  Identification  and  characterizatron  of  the  familial  adenomatous
polyposis  colt  gene.  Cell  66,589-600.
15.  Joslyn,  G.,  Carlson,  M.,  Thliveris,  A.,  Albertsen,  H.,  Gelbert,  L.,  Samowitz,  W.,
et al.  (199  1) Identification  of deletion  mutations  and three  new genes  at the  famd-
ial  polyposis  locus.  Cell  66,601-613.
16.  Kinzler,  K  W.,  Nilbert,  M.  C.,  Su,  L.  K.,  Vogelstem,  B.,  Bryan,  T.  M.,  Levy,
D.  B.,  et  al.  (1991)  Identification  of  FAP  locus  genes  from  chromosome  5q21.
Science  253,661-665
17.  Tops,  C.  M.,  WiJnen,  J.  T.,  Griftioen,  G  , von-Leeuwen,  I  S , Vasen,  H  F  , den-
Hartog-Jager,  F.  C.,  et al.  (1989)  Presymptomatic  diagnosis  of famihal  adenom-
atous  polypos~s  by  bridging  DNA  markers.  Lancet  2,  136 I-1  363.
18.  MacDonald,  F., Morton,  D.  G.,  Rmdl,  P.  M.,  Haydon,  J.,  Cullen,  R.,  Gibson,  J.,  et
al.  (1992)  Predictive  diagnosis  of  familial  adenomatous  polyposis  with  linked
DNA  markers:  population  based  study.  Br  Med.  J  304,869-872.
19.  Dunlop,  M.  G.,  Wyllie,  A.  H.,  Steel,  C.  M.,  Piris,  J.,  and  Evans,  H  J  (1991)
Linked  DNA  markers  for  presymptomatic  diagnosis  of  familial  adenomatous
polyposis.  Lancet  337,3  13-3  16.
20.  Bisgaard,  M.  L.,  Fenger,  K.,  Bulow,  S., Niebuhr,  E.,  and  Mohr,  J. (1994)  Familial
adenomatous  polyposis  (FAP):  frequency,  penetrance,  and  mutation  rate.  Hum.
Mutat  3,  121-125
2 1.  Hodgson,  S. V.  and  Spigelman,  A.  D.  (1994)  Genetics,  m  Famdlal  Adenomatous
Polyposls  and  Other  Polyposis  Syndromes  (Phillips,  R.  K.  S.,  Spigelman,  A  D.,
and  Thomson,  J. P.  S , eds.),  Edward  Arnold,  London,  pp.  26-35.
22.  Maher,  E.  R.,  Barton,  D.  E.,  Slatter,  R.,  Koch,  D.  J.,  Jones,  M.  H.,  Nagase,  H.,  et
al.  (1993)  Evaluation  of molecular  genetic  diagnosis  m  the  management  of famil-
ial  adenomatous  polyposis  coli:  a population  based  study.  J  Med.  Genet.  30,
675-678.
23.  Rustin,  R.  B.,  Jagelman,  D.  G.,  McGannon,  E.,  Fazio,  V.  W.,  Lavery,  I.  C.,  and
Weakley,  F. L.  (1990)  Spontaneous  mutation  in  familial  adenomatous  polyposis.
Dls  Colon  Rectum  33,52-55.
24.  Horii,  A.,  Nakatsuru,  S.,  Ichii,  S., Nagase,  H.,  and  Nakamura,  Y.  (1993)  Multiple
forms  of the APC  gene transcripts  and their  tissue-specific  expression.  Hum.  Mol.
Genet.  2,283-287.
25.  Lambertz,  S.  and  Ballhausen,  W.  G.  (1993)  Identification  of  an  alternative  5’
untranslated  region  of  the  adenomatous  polyposis  co11 gene.  Hum.  Genet.  90,
650-652.
26.  Thliveris,  A.,  Samowitz,  W.,  Matsunami,  N.,  Groden,  J.,  and  White,  R  (1994)
Demonstration  of  promoter  activity  and  alternative  sphcmg  in  the  region  5’  to
exon  1 of the  APC  gene.  Cancer  Res.  54,299  l-2995
27.  Powell,  S. M.,  Petersen,  G.  M.,  Krush,  A.  J., Booker,  S., Jen,  J., Giardiello,  F.  M.,
et al.  (1993)  Molecular  diagnosis  of familial  adenomatous  polyposis.  N.  Engl.  J
Med  329,1982-1987
28  Mandl,  M.,  Paffenholz,  R  , Friedl,  W.,  Caspari,  R.,  Sengteller,  M.,  and  Propping,
P.  (1994)  Frequency  of  common  and  novel  inactivating  APC  mutations  in  202
families  with  familial  adenomatous  polyposis.  Hum.  Mol.  Genet.  3,  18 1-l  84.
29  Cottrell,  S.,  Bicknell,  D.,  Kaklamams,  L  , and  Bodmer,  W.  F  (1992)  Molecular
analysis  of APC  mutations  in  famihal  adenomatous  polyposis  and  sporadic  colon
carcmomas.  Lancet  340,  626-630
30  Miyoshi,  Y.,  Ando,  H.,  Nagase,  H.,  Nishisho,  I.,  Horn,  A.,  Mikt,  Y.,  et al  (1992)
Germ-line  mutations  of  the  APC  gene  in  53  familial  adenomatous  polyposis
patients.  Proc  Nat1  Acad  Scr  USA  89,4452-44X
31  Nakamura,  Y.,  Nishisho,  I  , Kinzler,  K  W  , Vogelstem,  B  , Miyoshi,  Y.,  Mike,  Y.,
et  al.  (1992)  Mutations  of  the  APC  (adenomatous  polyposis  ~011) gene  in  FAP
(familial  polyposis  ~011) patients  and  in  sporadic  colorectal  tumors  Tohoku  J
Exp.  Med.  168,  141-147
32.  Nagase,  H.,  Miyoshi,  Y.,  Horu,  A.,  Aoki,  T.,  Petersen,  G  M  , Vogelstein,  B  , et
al  (1992)  Screening  for  germlme  mutations  m  familial  adenomatous  polyposis
patients:  61  new patients  and  a summary  of  150 unrelated  patients  Hum  Mutat
1,467473
33.  Olschwang,  S., Tiret,  A.,  Laurent-Pmg,  P.,  Muleris,  M.,  Part,  R.,  and  Thomas,  G
(1993)  Restriction  of  ocular  fundus  lesions  to  a specific  subgroup  of APC  muta-
tions  in  adenomatous  polyposis  coli  patients.  Cell  75,  959-968
34.  Smith-Ravm,  J  , Pack,  K.,  Hodgson,  S , Tay,  S. K.,  Phillips,  R  , and  Bodmer,  W.
(1994)  APC  mutation  associated  with  late  onset  of  familial  adenomatous
polyposis  J  Med.  Genet.  31,  888-890.
35.  Spirio,  L.,  Otterud,  B  , Stauffer,  D.,  Lynch,  H  , Lynch,  P.,  Watson,  P.,  et al.  (1992)
Linkage  of  a  variant  or  attenuated  form  of  adenomatous  polyposis  co11 to  the
adenomatous  polyposis  coli  (APC)  locus  Am.  J.  Hum  Genet  51,92-100.
36.  Spirio,  L.,  Olschwang,  S , Groden,  J , Robertson,  M  , Samowitz,  W.,  Joslyn,  G.,  et
al.  (1993)  Alleles  of the APC  gene:  an attenuated  form  of  familial  polyposis.  Cell
75,95  l-957.
37  Varesco,  L.,  Gtsmondi,  V  , Presciuttim,  S , Groden,  J.,  Spirio,  L.,  Sala,  P.,  et  al
(1994)  Mutation  in  a splice-donor  site  of the APC  gene  m  a family  with  polyposis
and  late  age  of colonic  cancer  death.  Hum  Genet  93,28  l-286.
38.  Cross, I.,  Delhanty,  J  , Chapman,  P.,  Bowles,  L.  V.,  Griffin,  D.,  Wolstenholme,  J ,
et  al.  (1992)  An  intrachromosomal  msertion  causing  5q22  deletton  and  famihal
adenomatous  polyposis  co11 in  two  generations.  J,  Med.  Genet.  29,  175-l  79.
39.  Tops,  C. M.,  van-der-Khft,  H.  M.,  van-der-Luijt,  R.  B.,  Griffioen,  G.,  Taal,  B.  G  ,
Vasen,  H  F.,  and  Khan,  P.  M.  (1993)  Non-allelic  heterogeneity  of  familial
adenomatous  polyposis.  Am  J  Med  Genet.  47,563-567
40.  Stella,  A.,  Resta,  N.,  Gentile,  M.,  Susca,  F.,  Marem,  C.,  Montera,  M.  P.,  and
Guanti,  G.  (I  993)  Exclusion  of  the  APC  gene  as the  cause  of  a variant  form  of
familial  adenomatous  polyposis  (FAP).  Am.  J  Hum  Genet  53,1031-1037
96  Frayling  and  Rowan
Searching  for  Mutations  97
41.  Burn,  J. and  Chapman,  P.  (1994)  Familial  adenomatous  polyposrs:  heterogeneity?
Am  J.  Hum.  Genet.  S&412,413.
42.  Cotton,  R.  G  , Rodrigues,  N.  R.,  and Campbell,  R.  D.  (1988)  Reactivity  of cytosine
and  thymine  m  single-base-pair  mismatches  with  hydroxylamine  and  osmmm
tetroxide  and  Its  application  to  the  study  of mutations.  Proc  Natl.  Acad.  Scz  USA
85,4397-440  1.
43.  Grompe,  M.,  Muzny,  D.  M.,  and  Caskey,  C.  T.  (1989)  Scanning  detection  of
mutations  in  human  ornithine  transcarbamylase  by  chemrcal  mismatch  cleavage.
Proc  Natl.  Acad.  Sci.  USA  86,5888-5892.
44.  Dianzam,  I.,  Camaschella,  C.,  Saglio,  G.,  Forrest,  S  M.,  Ramus,  S.,  and  Cotton,
R.  G.  (1991)  Simultaneous  screening  for  beta-thalassemia  mutations  by  chemical
cleavage  of mismatch.  Genomics  11,48-53
45  Smooker,  P.  M.  and  Cotton,  R.  G.  (1993)  The  use  of  chemical  reagents  in  the
detection  of  DNA  mutations.  Mutat.  Res.  288,  65-77
46.  Keen,  J., Lester,  D.,  Inglehearn,  C.,  Curtis,  A.,  and Bhattacharya,  S. (1991)  Rapid
detection  of  single  base mismatches  as heteroduplexes  on  Hydrolink  gels  Trends
Genet.  7,  5.
47.  White,  M  B.,  Carvalho,  M.,  Derse,  D  ,  O’Brien,  S  J.,  and  Dean,  M.  (1992)
Detecting  single  base  substrtutions  as heteroduplex  polymorphisms  Genomzcs
12,301-306.
48.  van-der-Luijt,  R  , Khan,  P.  M  , Vasen,  H.,  van-Leeuwen,  C.,  Tops,  C.,  Roest,  P  ,
et al.  (1994)  Rapid  detection  of translation-terminating  mutations  at the  adenom-
atous polyposis  coli  (APC)  gene by  direct  protein  truncatron  test. Genomzcs 20,  l-4.
49.  Naylor,  J  A.,  Green,  P.  M.,  Rizza,  C  R.,  and  Giannelli,  F.  (1993)  Analysis  of
factor  VIII  mRNA  reveals  defects  in  every  one  of  28  haemophilia  A  patients.
Hum.  Mol.  Genet.  2,  11-17.
50.  Morton,  D.  G.,  Macdonald,  F  ,  Cachon-Gonzales,  M.  B.,  Rindl,  P.  M.,  Neop-
tolemos,  J.  P.,  Kerghley,  M.  R.,  et al.  (1992)  The  use of  DNA  from  paraffin  wax
preserved  tissue  for  predictive  diagnosis  m  familial  adenomatous  polyposrs.  J
Med  Genet.  29,571-573.
5 1.  Chomczynski,  P.  and Sacchi, N.  (1987)  Single-step  method  of RNA  isolation  by acid
guanidinium  thiocyanate-phenol-chloroform  extra&on.  Anal.  Bzochem. 162,  156-l  59.
52.  Groden,  J.,  Gelbert,  L.,  Thhverrs,  A.,  Nelson,  L.,  Robertson,  M  , Joslyn,  G.,  et al.
(1993)  Mutational  analysis  of  patients  with  adenomatous  polyposis:  identical
inactivating  mutations  m  unrelated  individuals.  Am.  J  Hum  Genet  52,263-272.
53.  Soto,  D.  and  Sukumar,  S. (1992)  Improved  detection  of mutations  in  the  ~53  gene
in  human  tumors  as  single-stranded  conformation  polymorphs  and  double-
stranded  hetroduplex  DNA.  PCR  Methods  Appllc  2,96-98.
54.  Tassabehji,  M.,  Read,  A.  P  , Newton,  V.  E.,  Patton,  M  , Gruss,  P.,  Harris,  R  , and
Strachan,  T.  (1993)  Mutations  in  the  PAX3  gene  causing  Waardenburg  syndrome
type  1 and type  2  Nature  Genetics  3,26-30.
55.  Bhattacharyya,  A.  and  Lrlley,  D.  M.  (1989)  The  contrasting  structures  of  mts-
matched  DNA  sequences  containing  looped-out  bases  (bulges)  and  multiple
mismatches  (bubbles).  Nucleic  Acids  Res.  17,6821-6840.
98  Frayling  and  Rowan
56.  Maxam,  A  and  Gilbert,  W.  (1980)  Sequencing  end-labeled  DNA  with  base-spe-
cific  chemical  cleavages  Methods  Enzymol.  65,499-560
57.  Hans,  I.  I.,  Green,  P.  M.,  Bentley,  D.  R.,  and Giannelli,  F  (1994)  Mutation  detec-
tion  by  fluorescent  chemtcal  cleavage:  application  to  hemophilia  B.  PCR  Meth-
ods Appbc  3,268-271
58  Roe&  P.  A.,  Roberts,  R  G.,  van-der-Tugn,  A.  C , Heikoop,  J. C., van-Ommen,  G. J ,
and den-Dunnen,  J. T  (1993)  Protem  truncation  test (PTT)  to rapidly  screen the DMD
gene  for  translation  terminating  mutations.  Neuromuscular  Dzsord  3,391-394
59  Spirio,  L  , Nelson,  L.,  Ward,  K  , Burt,  R  , White,  R  , and  Leppert,  M  (1993)  A
CA-repeat  polymorphtsm  close  to  the  adenomatous  polyposis  coli  (APC)  gene
offers improved  diagnostic  testing  for famihal  APC.  Am  J  Hum  Genet  52,286-296.
60.  van-Leeuwen,  C.,  Tops,  C.,  Breukel,  C.,  van-der-Khft,  H.,  Fodde,  R.,  and  Khan,
P. M.  (1991)  CA  repeat polymorphism  at the D5S299  locus  linked  to adenomatous
polyposis  co11 (APC).  Nuclerc  Acids  Res  19,  5805.
61  Breukel,  C.,  Tops,  C.,  van-Leeuwen,  C.,  van-der-Kllft,  H.,  Fodde,  R.,  and  Khan,
P.  M.  (1991)  AT  repeat  polymorphism  at  the  D5S122  locus  tightly  linked  to
adenomatous  polyposis  coli  (APC).  Nucleic  Acids  Res.  19,6665.
62.  Allan,  G.  J.,  Cottrell,  S.,  Trowsdale,  J.,  and  Foulkes,  W  D  (1994)  Loss  of  het-
erozygostty  on  chromosome  5 in  sporadic  ovarian  carcinoma  1s a late  event  and  is
not  associated  with  mutations  in  APC  at  5q2 I-22.  Hum.  Mutat  3,283-291
63.  Heighway,  J.,  Hoban,  P.  R.,  and  Wylhe,  A  H.  (1991)  Ssp  I  polymorphism  in
sequence  encoding  3’  untranslated  region  of  the  APC  gene.  Nucleic  Aczds Res
19,6966.
64.  Kraus,  C.  and  Ballhausen,  W.  G.  (1992)  Two  mtragemc  polymorphisms  of  the
APC  gene  detected  by  PCR  and  enzymatic  digestion.  Hum  Genet  88,705,706
65.  Olschwang,  S ,  Laurent-Puig,  P.,  Thurlle,  B.,  and  Thomas,  G.  (1992)  Frequent
polymorphism  in  the  13th  exon  of  the  adenomatous  polyposis  coli  gene.  Hum
Genet  90,  161-163.
66.  Chung,  M.  H.,  Kiyosawa,  H.,  Ohtsuka,  E.,  Nishimura,  S.,  and  Kasai,  H.  (1992)
DNA  strand  cleavage  at  8-hydroxyguanine  residues  by  hot  piperidme  treatment.
Biochem.  Biophys.  Res  Commun  188,  l-7.
67.  Sambrook,  J.,  Fritsch,  E.  F.,  and  Maniatis,  T.  (1989)  Appendix  D:  codons  and
amino  acids,  m  Molecular  Clonwzg* A  Laboratory  Manual  (Nolan,  C.,  Ford,  N  ,
and  Ferguson,  M  , eds.),  Cold  Spring  Harbor  Laboratory  Press, Cold  Spring  Har-
bor,  NY,  pp.  D.2-D.5.
68.  Xia,  L.,  St.  Denis,  K.  A.,  and  Bapat,  B.  (1995)  Evidence  for  a novel  exon  m  the
coding  region  of the adenomatous  polyposis  coli  (APC)  gene. Genomlcs  28,589-591.
69.  Sulekova,  Z.,  Rema-Sanchez,  J.,  and  Ballhausen,  W.  G.  (1995)  Multiple  APC
messenger  RNA  isoforms  encoding  exon  15  short  open  reading  frames  are
expressed  in  the  context  of a novel  exon  lOA-derived  sequence.  Int  J  Cancer  63,
435441.
Methods  for  Screening  in  Cystic  Fibrosis
Martin  Schwarz  and  Geraldine  Malone
1. Introduction
1.1.  Cystic  Fibrosis  Mutation  Analysis
Cystic fibrosis  (CF)  IS the most common lethal autosomal recessive dtsorder
m Whites, with  an incidence  of  approx  1 m 2500 live  births  and a carrier  fre-
quency of  approx  1 in 25. Since the discovery  of the cystic fibrosis  transmem-
brane  conductance  regulator  (CFTR)  gene m  1989 (Z-J),  molecular  genetics
laboratories  throughout  the world  have  endeavored  to  identify  the mutations
present in their populatton  of CF-bearing  chromosomes. Since the entire CFTR
gene and its intron-exon  boundaries  have  been sequenced, mutatton  analysis
in  CF  has become relatively  simple,  although  time  consuming.  Generally,  a
number  of  different  methods are applied  to mutation  analysis, but all  involve
an imttal  step of  amplification  of part of  the gene by polymerase  chain reaction
(PCR)  (4),  or a derivative  of  it, such as amplification  refractory  mutation  sys-
tem (ARMS)  (51.
Since  there  are  over  500  different  mutations  of  the  CFTR  gene  so  far
described  (Cystic  Fibrosis  Genetic  Analysis  Consortium),  one  must  be
aware  of  the relative  frequencies  of  the common  mutations.  Some of  these
(for  the United  Kingdom  [6],  with  comparative  figures  for  North  America
and North  and South  Europe  /7/)  are given  in Table  1. The  large  number  of
mutations  makes  population  screening  problematical,  since  a  negative
result  will  only  reduce  carrier  risk  and  cannot  exclude  CF  carrier  status. A
number  of  approaches  to CF  screening  have  been taken (e.g., couple  screen-
ing  in  pregnancy  and  preconceptual  [20];  cascade  screening  1211;  and
population  screening), although  general population  screening has largely  been
ruled  out  (22).
From  Methods  m  Molecular  Medmne.  Molecular  D/agnoss  of  GenetIc  Diseases
Edlted  by  R  Elles  Humana  Press  Inc  ,  Totowa,  NJ
99
Table  1
Relative  Frequencies  of  the  Common  CF  Mutations  in  the  United  Kingdom  (S),  North  America,
and  Northern  and  Southern  Europe  (7)”
North  Northern  Southern
UK  America  Europe  Europe
Mutation  Exon  No.  %  No.  %  No.  %  No  %  References
AF508
G551D
G542X
621  +  l(G>T)
1717-  l(G  >  A)
s  R117H
=  R553x
1898  +  l(G  >  A)
N1303K
R560T
AI507
G85E
1154insTC
V520F
W1282X
E60X
3659delC
1078delT
10  7387  75.32  6900  66.1  14,866  70.28  4007  55.03  3
11  302  3.08  206  1.97  356  1.68  37  0.51  8
11  165  1.68  234  2.24  439  2.08  259  3.56  9
intron  4  91  0.93  154  1.48  97  0.46  37  0.51  IO
intron  10  56  0.57  44  0.42  160  0.76  65  0.89  9
4  45  0.46  61  0.58  62  029  3  0.04  II
11  45  0.46  96  0.92  165  0.78  44  0 6  8
intron  12  45  0.46  2  0.02  41  0.19  10  0  14  12
21  45  0.46  130  1.25  209  0.99  179  2.46  13
11  41  0.42  24  0.23  40  0  19  0  0  9
10  30  0.3 1  20  0.19  57  0.27  5  0.07  9,14
3  21  0.21  16  0  15  30  0  14  14  0.19  II
7  19  0.19  n/a  n/a  n/a  n/a  n/a  n/a  15
10  17  0.17  n/a  n/a  n/a  n/a  n/a  n/a  16
20  17  0.17  245  2.35  120  0.57  43  0.59  17
3  16  0.16  n/a  n/a  n/a  n/a  n/a  n/a  Maloneb
19  14  0.14  14  0.13  39  0  18  1  0.01  9
7  9  0.09  1  0.01  53  0 25  2  0.3  18
S549N  11  8  0.08  5  0.05  18  0 09  2  0 03  8
Q493X  10  7  0.07  n/a  n/a  da  n/a  da  n/a  9
R347P  7  6  0.06  26  0.25  55  0.26  24  0.33  11
3849 +  10 kb(C  > T)  intron  19  5  0.05  57  0.55  23  0.11  8  0.11  19
A455E  9  3  0.03  27  0.26  35  0.17  0  0  9
%/a, Data not avadable.
bPersonal communication.
102  Schwarz  and  Malone
Classify  Sample
?Diagnosis  01  CF
HOW
muta
CF  Patlent
Family  History  of  C
Family  PM
member
Prenatal  Diaonosls
Fig.  1. Strategy  for  molecular  analysis  in  CF
1.2.  Testing  Strategy
In order  to carry out the appropriate  tests on a sample, a number  of  questions
should be answersd:
1  Is  there  a family  history  of CF?
2.  If  there  is  a family  history  of  CF,  1s the  genotype  of the  affected  person  known?
3.  What  IS the  ethnic  origin  of the  person  to be  tested?
The extent and type of  analysis performed  on a sample depends on the fam-
ily history  of the individual  to be tested; for  example, to confirm  CF m a patient,
it is necessary to identify  two  mutant alleles, whereas someone with  no family
history  of  CF requires  less comprehensive  testing m order  to reduce his or her
risk  of  being  a carrier  of  CF (Fig.  1). In  addition,  there  are a number  of  “sub-
sets” of  patients,  showing  atypical  CF phenotypes, in whom  mutations  of  the
CFTR  gene can be found  (e.g., congenital  bilateral  absence of the vas deferens
[CBAVD]  and chronic  pancreatitis;  see Section 1.2.8.). In  this chapter  a com-
prehensive  strategy  for  detecting  CF  mutations  is  given,  but  the  methods
described in  full  detail  are restricted  to ARMS  and allele-specific  oligonucle-
otide  (ASO)  techniques.
Screening  in  Cystic  Fibrosis
1.2.1.  CF  Patients-Common  Mutations
103
In  all  cases, the samples may be tested in  the first  instance either  with  the
CF(4)m-PCR  kit  (Johnson  &  Johnson Clinical  Diagnostics,  Amersham,  UK)
(23),  which  tests for  the four  most common CF mutations  in the United  King-
dom,  or  for  just  AF508  and  AI507  by  polyacrylamide  gel  electrophoresis
(PAGE).  In  many  populations  more  than half  of  all  CF patients  are homozy-
gous for  AF508 and it is therefore  usually more  efficient  to test first  for  AF508
alone. If  this 1s carried  out using the PCR primers  C 16B and C 16D (Table  2), it
must be remembered  that AF508  and AI507  can only  be distinguished  in het-
erozygous form  (there  being  no heteroduplexes  formed  in  AI507  and  AF508
homozygotes, nor in AF508/AI507  compound heterozygotes, which  would  oth-
erwise enable the two  mutations to be differentiated).  It  is therefore  preferable
to test both  the parents  of  a CF  patient;  since they  are  almost  certain  to  be
heterozygous  for  the relevant  mutation,  this strategy has the combined  benefit
of  distinguishing  between  AF508  and  81507,  and  also  contirmmg  that  both
parents are indeed heterozygotes. (If  this is not the case, further  investigation  of
the family  is required.)  Alternatively,  the use of  the CF(4)m  kit allows  specific
testing of  AF508, together  with  the next three most common UK  mutations.
1.2.2.  CF  Patients-Rare  Mutations
If,  after  AF508/AI507  and ARMS  CF(4)m  testing, two  mutations  have  not
been identified,  and CF has either been confirmed  by sweat testing or there is a
strong clinical  suspicion of  CF, the next tranche of  mutations must be  mvesti-
gated (according to Table  1 and to local population  variations). This  is commonly
performed  in  a specialist laboratory  that is capable of  rare mutation  analysis.
These next mutations  are not necessarily tested in  descending order  of  fre-
quency (as they are all fairly  rare), since batching of  samples and the combination
of  a number  of  tests may dictate which  mutation  analyses are performed  first.
A  number  of  different  techniques may now  be employed  simultaneously.  As
an extreme example, a sample may be tested for  R560T  and R117H  by ARMS
duplex (primers are detailed in Table 3, p. 106), for exons 5,8, and 18 by denatur-
ing  gradient  gel electrophoresis (DGGE),  for  exons 3 and 7 by single-stranded
conformational  polymorphism  (SSCP),  for  W1282X  and  N1303K  by  AS0
hybridization  to dot-blots (Table  4, p. 106), and for  R553X  by restriction  endo-
nuclease digestion  of  PCR products. Because of  the simplicity  of  detection of
changes which  alter restriction  endonuclease recognition  sequences (Table  5, p.
107), a number of diagnostic laboratories choose to test for  these mutations (e.g.,
R553X,  R560T)  at an early  stage. This  may be followed  by  further  SSCP and
DGGE  analysis, and ultimately  DNA  sequencing exon by exon. With  the great
spread of  mutations within  the gene, there is really  no “correct”  order.
Table  2
Sequences,  Product  Sizes,  and  Annealing  Temperatures  of  PCR  Primers  Used  in  CF  Analysis  (see  Note  1O)8
Exon  Primer  sequence  5’ to  3’  Name
Product  Annealing
size,  bp  temperature,  “C
3
4
7
9
10 @al-Q
G
A  10
11
12
13
14a
17b
19
CTTGGGTTAATCTCCTTGGA  3i5
ATTCACCAGATTTCGTAGTC  313
TCACATATGGTATGACCCTC  4i5
TTGTACCAGCTCACTACCTA  4i3
AGACCATGCTCAGATCTTCCAT  7i5
GCAAAGTTCATTAGAACTGATC  7i3
TAATGGATCATGGGCCATGT  9i5
ACAGTGTTGAATGTGGTGCA  9i3
GTTTTCCTGGATTATGCCTGGGCAC  C16B
GTTGGCATGCTTTGATGACGCTTC  C16D
GCAGAGTACCTGAAACAGGA  lOi
CATTCACAGTAGCTTACCCA  lOi
CAACTGTGGTTAAAGCAATAGTGT  lli5
GCACAGATTCTGAGTAACCATAAT  lli3
GTGAATCGATGTGGTGACCA  1215
CTGGTTTAGCATGAGGCGGT  1213
TGCTAAAATACGAGACATATTGCA  13i5
ATCTGGTACTAAGGACAG  Cl-1M
AAAAGGTATGCCACTGTTAAG  14ai5
GTATACATCCCCAAACTATCT  14ai3
TTCAAAGAATGGCACCAGTGT  17bl5
ATAACCTATAGAATGCAGCA  17bi3
GCCCGACAAATAACCAAGTGA  1915
GCTAACACATTGCTTCAGGCT  19i3
309
438
410
561
98
491
425
426
528
511
463
454
54
54
54
54
54
54
54
57
58
57
56
54
20
21
intron  6a
iniron  8
intron  17b
intron  17b
mtron  19
GGTCAGGATTGAAAGTGTGCA
CTATGAGAAAACTGCACTGGA
AATGTTCACAAGGACTCCA
CAAAGTACCTGTTGCTCCA
CAAGTCTTTCACTGATCTTC
TGAGCAGTTGTTAATAGATAA
TCTATCTCATGTTAATGCTG
GTTTCTAGAGGACATGATC
GACAATCTGTGTGCATCG
GCTGCATTCTATAGGTTATC
AAACTTACCGACAAGAGGA
TGTCACCTCTTCATACTCAT
AGGCTTCTCAGTGATCTGTTG
GAATCATTCAGTGGGTATAAGCAG
20×5  473  59
2Oi3
2115  476  54
210
FC09  106/l  10  57
6iRPT
NURI  220  50
AT17R1.2  201-301  50
AT17D1.2
ACl7R2  140  50
AC17D2
i19F  437  50
i19R
“Sequences  are  provided  courtesy  of  the  Cystic  Fibrosis  Genetic  Analysis  Consortium
106  Schwarz  and  Malone
Table  3
Sequences  and  Product  Sizes  for  ARMS  Primers  (23)  Used  to  Detect
the  CF  Mutations  R560T  and  R117H  in  a  Duplex  Reactiona
Mutatron  Prnner  Sequence  5’ to  3’
Product
size,  bp
R560T
RI  17H
Common  AAAATTTCAGCAATGTTGTTTTTGACCAAC
Normal  GCTTGCTAGACCAATAATTAGTTATTCAAC
Mutant  GCTTGCTAGACCAATAATTAGTTATTCAAG
Common  CACATATGGTATGACCCTCTATATAAACTC
Normal  CCTATGCCTAGATAAATCGCGATAGAACC
Mutant  CCTATGCCTAGATAAATCGCGATAGAAT
316
237
aAs  for  the CF(4)m  test, a pan  of tubes (A  and B)  is required  for  each DNA  sample. Tube A
contams  R560T  and R117H  common,  R560T  normal, and R117H  mutant primers;  tube B  con-
tams  R560T  and R117H  common, R560T  mutant and R117H  normal, pnmers.  Thermal cycler
and electrophoresls  condltlons  are as for  CF(4)m.
Table  4
Sequences  of  Normal  (N)  and  Mutant  (M)  ASOs
Used  in  the  Detection  of  CF  Mutations8
Mutation  AS0  Sequence  5’ to  3’
Posthybndrzation
wash  temperature,  C?
AF508  N  CACCAAAGATGATATTTTC
M  AACACCAATGATATTTTCTT
1717-l(G>A)  N  TGGTAATAGGACATCTC
M  TGGTAATAAGACATCTC
1898+  l(G>A)  N  CAAAGAACATACCTTTCAA
M  TGAAAGATATGTTCTTTG
W1282X  N  CAACAGTGGAGGAAAGCCTT
M  CAACAGTGAAGGAAAGCCTT
N1303K  N  TAGAAAAAACTTGGATCC
M  TAGAAAAAAGTTGGATCC
PolyT(intron8)  5T  TGTGTGTGTTTTTAACAG
7T  TGTGTGTTTTTTTAACAG
9T  GTGTGTTTTTTTTTAACAG
42-44
42-44
42-44
424
42,44,46
36,40,42
36
36,40,42
aPosthybndlzatlon  washes  are camed out m 2X  SSC, 0 1% SDS solution  at incremental tem-
peratures  as shown  (see Notes  9 and 10).
Screening  in  Cystic  Fibrosis  107
Table  5
CF  Mutations  Detectable  by  Restriction  Endonuclease  (RE)  Digestion
of  PCR  Products
Mutation  PCR  primers0  RE
RE  digestion  product  sizes,  bpbJ
Normal  Mutant
G85E
621+  1
(G’V
1154insTC
R334W
R347P
G551D
R553X
R560T
S549N
3849+  IOkb
CC ’  T)
W1282X
3i5  and  313
4i5  and  4i3
Hinff
MseI
105 +  204
33,35,71,  118,  181
7i5  and  7i3  MspI,  RsaI  50,68,74  +  21V
715 and  7i3  MspI  192 +  218
7i5  and  7i3  CfoI  151+  259
1 li5  and  1113  Mb01  425
1115 and  lli3  HzncII  186 +  239
lli5  and  lli3  Mae11  425
lli5  and  lli3  DdeI  13,  174 +  238
i19F  and  i19R  HphI  88 +  349
2Oi5  and  2Oi3  Mnfl  185 +  288
309
33,35,54,71,
118,  127
50,68,76  +  21gc
410
410
182+243
425
215  +  210
13 + 412
88,127  +  222
473
‘See Table 2
bThe expected digestion product  sizes for  both normal and mutant sequences are shown
CThese products  may be d1stmgmshed by PAGE
1.2.3.  Carrier  Testing  and  Prenatal  Diagnosis
When  Two  Mutations  Have  Not  Been  Identified
If,  after  this quite  extensive  testing, two  mutations have  not been identified
in  a CF  patient,  it  may be necessary to  resort  to using  intragenic  markers  to
make  the  family  “informative”  if  prenatal  diagnosis  is required.  This  is the
procedure  to identify  the parents’ CF-bearing  chromosomes so that their  inher-
itance can be followed  by linkage;  the search for  the second mutation,  or rarely
both mutations,  of  course, continues.
The  large battery  of highly  polymorphic  intragenic  markers makes it highly
likely  that a family  will  be informative  (Table  6). Although  the dinucleotide
repeats are by far  the most polymorphic,  it may not always be necessary to use
them. For  example,  if  exon  10 PCR  products are available  from  a CF patient
and his or her parents, it is quite straightforward  to perform  a restriction  enzyme
digest (HphI)  to look  for  the M470V  polymorphism.  Although  only  a dimor-
phism  (A  or  G at nucleotide  position  1540), this marker  demonstrates quite  a
high  degree of  heterozygosity  (0.24).
Table  6
lntragenic  Polymorphisms  Used  to  Determine  Carrier  Status  in  CF  Family  Studiesa
Name
Polymorphism
Analysis  Allele/product
Tee  Pnmer&  Method”  sizes,  bp  Refs
IVS6bTTGA  TTGA  repeat  FC09,6iRPT  PAGE
IVS8CA  CA  repeat  NuRl,  NuR2  PAGE
s  IVS17bTA  TA  repeat  AT17R1.2,  AT17D1.2  PAGE
Q  IVS17bCA  CA  repeat  AC17R2,  AC17D2  PAGE
M47OV  AorG@  1540  1015, 1013  RE  WIW
T854T  GorT@2694  14ai5,  14aD  RE  (Cfrl31)
106and  110
-220
-20  l-299
-140
A  (Met):492
G  (Val):191  +  301
G-511
A:125  +  286
24
25
26
26,27
9
28
@Mutations have not been characterized  in  the  CF  Index  Case
bSee Table  2
=PAGE,  Separation  of alleles  by polyacrylmde  gel  electrophoresq  RE  (enzyme),  restriction  endonuclease  &gesQon  and  agarose  gel  electrophoresls
Screening  in  Cystic  Fibrosis  109
It is here that one should consider the problem  posed by consanguinity. Asian
CF  patients  (or  others  from  populations  in  which  consanguinity  is common)
are frequently  homozygous  for  a CF mutation  and occasionally  this may be a
“private”  mutation.  It  1s therefore  important  to identify  the mutation  if  possible
and, if  not, to find  a marker  for  which  the family  is informative.  This  is usually
possible, for  even though  the patient may be homozygous, the parents must be
heterozygous for  the mutation  and are therefore  likely  to be heterozygous for  a
linked  marker.  Although  a linked  marker  haplotype  can be useful  for  prenatal
diagnosis, it is unlikely  to be of  much use in carrier  testing in a large extended
family  (but  should  be useful  in  a small  family  until  the marker  ceases to  be
informative),  and for  this purpose the mutation  should be identified.
1.2.4.  Testing  Individuals  with  No  Family  History  of  CF
It  may  be sufficient  to test an individual  who  has no family  history  of  CF
(for  example, the partner  of  a relative  of  a CF patient)  for  enough  mutations  to
enable a suitable reduction  in their risk of carrying  CF. The number and type of
mutations  tested will  depend  on  the  ethnic  and  geographical  origin  of  that
person (see Section 1.2.7.). If  one assumes a carrier risk of  1 in 25 for  the United
Kingdom,  and  the  ARMS  CF(4)m  kit  detects  81%  of  mutations  in  the
United  Kingdom  (Table  l),  a person who  is negative  will  have  a risk  of  1 in
166 of  carrying CF. This  figure  can of  course be reduced further by testing more
mutations, but the reduction  in risk becomes smaller with  each mutation  tested.
1.2.5.  Testing  Relatives  of  a  CF  Patient
In order  to provide  the most accurate information  on carrier  risks it is neces-
sary to  determine  the genotype of  the CF patient.  This  usually  will  have  been
achieved  before  relatives  come  forward  for  testing,  but  in  certain  cases the
genotype will  be unknown.  For example, the CF patient may have  died, moved
overseas, or  simply  may not have been tested. If  the patient  has died,  the par-
ents (who  are of  course obligate  carriers)  may be available  and willing  to be
tested. If  the patient has moved  away, it is usually possible to find  out who  the
patient’s  physician  is and then find  out the genotype or obtain a sample. Occa-
sionally,  there may have  been a CF patient  who  died  20 or  30 yr ago. One can
only  do so much to determine  the strength of  the diagnosis and in  the end it is
probably  enough  to test the relative  for  the common mutations in order  to give
a sufficiently  reduced  carrier  risk.
1.2.6.  Assistance  with  the  Diagnosis  of  CF
A  knowledge  of  the  distribution  of  mutations  in  a  given  population  is
invaluable  in  the testing of  individuals  suspected of having  CF. Table  1 shows
the  20  most  frequent  mutations  in  the  United  Kingdom  and their  respective
110  Schwarz  and  Ma/one
frequencies.  It  can be seen that  testing for  the  four  most common  mutations
covers  8 1% of  all  CF  chromosomes  m the  United  Kingdom  and  a negative
result  goes some way  to reduce the possibility  of  CF, but  of  course does not
exclude  it altogether.  Indeed, molecular  analysis cannot exclude  CF while  the
number  of  mutations  contmues to  grow,  and the best that can be attained  is
either  the confirmation  of  CF by  identifying  two  mutations,  or  a reduction  in
the likelihood  of  CF by  testing  for  a number  of  mutations.  It  is not  possible,
after  getting  a negative  result for  several mutations, to provide  a numerical  risk
of  CF, since the clinical  possibility  of  CF already  has been raised and has con-
sequently altered the prior  risk of  CF. When testing for  the four  most common
CF mutations has yielded  only  one mutation  in a person, a sweat test should be
performed  and further  testing for  rare mutations will  then only  take place after
an abnormal  sweat test result.
1.2.7.  Testing  CF  Patients  from  Other  Ethnic  Origins
and  Their  Relatives
The  distribution  of  CF  mutations  varies  from  country  to  country  (7),  even
within  the  United  Kingdom  (6),  and  it  is therefore  extremely  important  to
ascertain  an  individual’s  ethnic  origin  before  testing  is  undertaken.  For
example, there are particular  mutations which  should be tested in patients (and
relatives  and their partners)  from  particular  ethnic backgrounds  (e.g., W 1282X
m Ashkenazi Jews, 394delTT  in Scandinavians, etc.). Pakistani mutations have
been seen predominantly  m exons 4,  10, and  12, and  SSCP analysis of  these
exons covers  most known  mutations  of  this origin,
1.2.8.  Clinical  Presentation  of  CF  Patients
The  nature  of  the clinical  presentation  of  the patient  also should  be deter-
mined  before  any extensive  investigation  is carried  out, as this too may have  a
bearing  on which  mutations  to test for.  Although  genotype:phenotype  correla-
tion  in  CF  is not  well  defined,  there  are mutations  whtch  may  be  associated
with  particular  presentations. For example, mild  lung  disease, pancreatic suff-
ciency and normal  sweat chloride  levels have  been reported  in individuals  who
have  the 3849  +  10 kb (C  > T)  mutation.  Consequently,  ascertainment  of  the
clinical  features may give  an indication  of  the mutations  to test for.
In  addition,  there  are  a number  of  clinical  subgroups  in  which  particular
mutations  of  the CFTR  gene have  been observed.  For example  the mutations
AEl15  and K1060T,  as well  as AF508,  G542X,  and RI  17H have been seen m
CBAVD  (29).  An increased frequency  of  CF heterozygotes has been observed
among  patients with  chronic  pancreatitis  (Haworth,  personal  communication,
February  1996).
Screening  in  Cystic  Fibrosis  111
The phenotyptc  effect  of the RI  17H mutation  has been seen to be dependent
on the length  of the intron  8 polythymidme  tract immediately  preceding  exon 9
(30).  Three  variants  have  been described (ST,  7T,  and 9T)  which  give  rise to
varying  degrees of  exon 9 splicing.  The RI  I7H  mutatron  is associated with  the
5T  variant  in  the majority  of  CF patrents, but with  the 7T  variant  m CBAVD
patients. The  5T,  7T,  and 9T  variants  may be determined  by AS0  hybridiza-
tion  (AS0  sequences are detailed  in Table  4).
2.  Materials
2.1.  Samples
Any  sample which  contains nucleated cells may be used as a source of DNA
for  molecular  genetic analysis. Samples are usually blood  (1-5  mL in K/EDTA)
or mouthwash/  buccal swabs (taken  in  10 mL  of  4% sucrose solution).  Since
only  small amounts of  DNA  are required  when molecular  analysis is performed
by PCR, mouthwash  and buccal swab samples provide  sufficient  material  for
testing. This  technique is becoming  increasingly  popular  with  patients, since it
is  noninvasive  and  can be  collected  by  the patient  at home  and  sent to  the
laboratory  by mail.
2.2.  Reagents
1.  CF(4)m  PCR  kit  (product  code  PCRlO12;  Johnson  &  Johnson  Clinical  Diagnos-
tics);  includes  Tuq  DNA  polymerase.
2.  T4  Polynucleotide  kmase  (‘product  code 7003 1; United  States Biochermcal,  Cleve-
land,  OWAmersham  International  plc,  Little  Chalfont,  UK).
3.  Tug DNA  polymerase  (product  code  1146 173; Boehrmger  Mannhelm,  Lewes, UK).
4.  Hybond  N+  blotting  membrane  (product  code  RPN203B;  Amersham  Intema-
tional).
5.  Proteinase K (product code 1092 766; Boehringer Mannhelm).
6.  20X  Salme  sodium  citrate  (SSC):  3MNaC1,  0.3Mtrisodium  citrate,  pH  7.0.
7.  Hybridization  solution:  5X  SSC,  0.1%  sodium  dodecyl  sulphate  (SDS),  0  1%
Ficoll,  0.1%  polyvinylpyrollidone  (product  code  P-5288;  Sigma,  Poole,  UK),
0.1%  bovine  serum  albumin  (product  code  A-9647;  Sigma),  1% of  a  10 mg/mL
solution  of  sheared  denatured  herring  sperm  DNA  (product  code  223  646;
Boehrmger  Mannheim)  (see Note  1).
8.  Blood  lysis  buffer:  0.32M  sucrose,  10 mM  Tris-HCI,  pH  7.5,  5 mA4 MgC12,  1%
Triton  X-100  (product  code  X-100,  Sigma).  Store  at 4°C.
9.  Virkon  detergent (product code 222/154; Merck, Lutterworth, UK).  Prepare a
2%  solution  as required.
10.  TE  Buffer:  I  mil4Tris-HCl,  10 WEDTA,  pH  7.5.
11.  TBE  Buffer:  0 089M  Tris,  0.089M  boric  acid,  0  002M  EDTA,  pH  8 0
12.  Mineral  oil  (product  code  M-3516;  Sigma).
112  Schwarz  and  Malone
2.3.  Equipment
In  addition  to standard laboratory  equipment,  the following  are required:
1.  Thermal  cycler  (DNA  Thermal  Cycler,  Perkin  Elmer,  Beaconsfield,  UK).
2  Hybridization  oven  (HB  lD,  Techne,  Cambridge,  UK)
3.  Vertical  PAGE  apparatus  (9  x 8 cm  AE6400,  Genetic  Research  Instrumentation,
Dunmow,  UK;  40  x 20  cm  V3,  Anachem,  Luton,  UK).
4  Horizontal  gel  electrophoresis  apparatus  (HE  serves, Pharmacia  Biotech,  St.
Albans,  UK).
5.  Heatmg  block  (Dri-Block  DB-2A,  Techne),  useful  but  not  essential.
3.  Methods
3.1.  Extraction  of  DNA  from  Mouthwash  Samples
Mouthwash  samples (in  10 mL  of  4% sucrose solution)  are collected  by the
patients themselves  and returned  to the laboratory  by mail  (see Note  2).
1.  Centrifuge  the  samples  at  12OOg for  15 min  (4’C)  to  pellet  the  buccal  cells.
2.  Discard  the  supernatant  mto  a suitable  detergent  (e.g.,  2%  Vtrkon  solutton)  and
resuspend  the pellet  m  500  pL  of  10 rnMNaC1,  10 mA4 EDTA,  pH  7.5  solution  m
a  1.5 mL  screw-topped  microcentrifuge  tube
3  Spin  briefly  (15  s) m  a microcentrifuge  to  pellet  the  cellular  material  again.
4  Discard  the  supernatant,  resuspend  the  pellet  in  500  pL  of  50  mM  NaOH  solu-
tion,  and  heat  to  100°C  for  10 mm  rn a heating  block  (or  a boilmg  water  bath).
5.  After  the  suspension  has cooled,  add  to each tube  100 pL  of  IMTris-HCl,  pH  7.5
solution  to  neutralize  the  NaOH,  and mix  by  inversion.
6.  Spm  briefly  m  a microcentrifuge  and  transfer  the  supernatant  to  a fresh  tube.
7.  A  5-pL  aliquot  of DNA  prepared  in  this  way is  sufficient  for  a single  PCR  reac-
tion.  DNA  should  be  stored  at -20°C  until  use
3.2. Extraction  of  DNA  from  Blood  Samples
Two  methods are used to extract DNA  from  whole  blood  The  first  requires
only  a small amount (-200  PL) of  blood  and IS similar  to the method  described
for  extraction  of  DNA  from  mouthwash  samples and produces sufficient  DNA
for  PCR-based  analysis. The  second method  requires  l-10  mL  of  blood  and
employs  a proteinase  K  digestion  followed  by phenol  and chloroform  extrac-
tion. This  latter  method  may  yield  -200  pg  of  DNA  from  a 5-mL  blood  sample
(see Note  3).
3.2.1.  Small-Scale  Extraction  of  DNA  from  Blood  Samples
1.  To  200  yL  of blood  (m  EDTA),  add  800  pL  of cold  170 mMNH,Cl  solution  in  a
screw-topped  microcentrtfuge  tube  and  mtx  by  rotatmg  for  20  min.
2  Spin  the  tube  in  a microcentrtfuge  for 2 min  to  obtain  a whtte-cell  pellet.  Discard
the  supematant  into  a suitable  detergent  (e g ,2%  Virkon  solutton)
Screening  in  Cystic  Fibrosis  113
3.  Resuspend  the  cell  pellet  in  300  pL  of  10  mM  NaCl,  10  mM  EDTA,  pH  7.5
solution,  and  then  spin  briefly.  Collect  the  pellet.  Gently  rinse  the  surface  of  the
pellet  with  an additional  300  I.~L of  this  solution  to  remove  any  visible  hemoglo-
bin  residue.
4.  Resuspend  the  resultant  white-cell  pellet  m  500  pL  of  50  mMNaOH  solutton.
5.  Incubate  the  suspension  in  a heating  block/water  bath  at  100°C  for  10 min,  then
neutralize  by  adding  100  PL  of  Tris-HCI,  pH  7.5  solution  and  vortex  for  5 s.
6.  Finally,  centrifuge  the  suspension  to  pellet  the  cell  debris  and  transfer  the  super-
natant  to  a fresh tube.
7.  A  5-pL  aliquot  of DNA  prepared  in  this  way is  sufficient  for  a single  PCR  reac-
tion,  DNA  should  be stored  at -20°C  until  use.
3.2.2.  Large-Scale  Extraction  of  DNA  from  Blood  Samples
1.  Transfer  l-10  mL  of  whole  blood  (in  EDTA)  into  a 30-mL  centrifuge  tube.  Add
blood  lysis  buffer  to  a final  vol  of  30  mL  (10  mL  for  blood  vol  ~2  mL).  Mix  by
inverting  several  times.
2.  Centrifuge  for  30  min  at  1200g  (4OC) to  pellet  the  white  cells.
3.  Discard  the  supematant  into  a suitable  detergent  (e.g.,  2%  Virkon  solution),  tak-
ing  care  not  to  dislodge  the pellet.  Keep  the  tube  inverted  and  drain  the  pellet.
4.  Resuspend  the  pellet  in  2 mL  of  0.075M  NaCl,  0.024M  EDTA,  pH  8 0  solution
and  transfer  to  a  14-mL  tube.
5.  Add  200  pL  of  10% SDS  solution  and  10 pL  of proteinase  K  solution  (20  mg/mL,
see Note  4),  and mix  by  inverting  the  tube.
6.  Incubate  overnight  at 37°C.
7.  Add  2 mL  of  phenol  (saturated  with  100 mMTris-HCI,  pH  8.0)  (see Note  5).
8.  Mix  on  a rotator  for  10 mm.
9.  Separate  the  aqueous  and  organic  phases by  centrimgatton  at  12OOg for  2 mm.
10.  Transfer  the  (upper)  aqueous  phase  by  pipet  into  a fresh  tube  containing  2 mL
of phenol.  Take  care not  to  carry  over  any  of  the  phenolic  layer.  Repeat  steps  8
and  9.
11.  Transfer  the  (upper)  aqueous  phase  by  pipet  to  a fresh tube  containing  2  mL  of
chlorofotmisoamyl  alcohol  (25: 1). Repeat  steps 8 and  9.
12.  Transfer  the  (upper)  aqueous  phase by  pipet  into  a fresh  tube  containing  4 mL  of
absolute  ethanol.  Allow  the DNA  to begin  to precipitate  at the  interface,  then  mix
gently  to  complete  the precipitation.
13.  Remove  the DNA  precipitate  from  the  ethanol  with  a disposable  plastic  tip.  Drain
off  the  excess ethanol  from  the  DNA  by  pressing  against  the  side  of the  tube,  and
transfer  to  a 2-mL  cryotube  containing  100-500  pL  of  sterile  distilled  water,
14.  Dissolve  the  DNA  at  room  temperature  by  mixing  on  a rotator  for  2-3  h.
15.  Measure  the  DNA  concentration  and  purity  using  a UV  spectrophotometer,  and
adjust  the  concentration  to  500  pg/mL.
16.  A  0.5~pL  aliquot  of  DNA  prepared  in  this  way  is  sufficient  for  a  single  PCR
reaction.  DNA  should  be  stored  at -20°C  until  use.
114  Schwarz  and  Malone
3.3.  ARMS  Multiplex
1.  Prepare  genomic  DNA  using  one of the methods  described  in  Sections  3.1-3.2.2.
2.  Each  Johnson  &  Johnson  CF(4)m  PCR  test  comprises  one  “A”  reactron  (yellow
tube)  and  one  “B”  reaction  (blue  tube).  These  are  stored  at  -20°C.  Allow  the
required  number  of  tubes  to  thaw  before  use,  including  an  extra  test  to  contain
water  in  place  of  DNA  as a control.  Positive  controls  containing  particular  muta-
tlons  may  be  included.  Spin  the  tubes  briefly  m  a microcentrifuge.
3.  Add  test  DNA  (5 or  0.5  pL  depending  on the  extraction  method)  to  each tube  of
an A  and  B  pair  at ambient  temperature  (see Note  6).
4.  Add  1 drop  (30-50  pL)  of sterile  mineral  oil  to  each reaction  tube;  then  re-cap  the
tubes  firmly
5.  Prepare  the  Tuq DNA  polymerase  (supplied  in  the  kit)  dilution  by  mixing  80  pL
water,  10 yL  ARMS  buffer  (10X),  and  10 ,uL  Taq DNA  polymerase  (45-60  U).
This  is  sufficient  for  20  tests (40  tubes)
6  Place  the  reaction  tubes  in  the  thermal  cycler  block  which  is  set to  run  at  94°C.
After  the  tubes  have  been  at 94’C  for  5 mm,  remove  each tube  in  turn  and  add
2 PL  of the  diluted  Tag  DNA  polymerase  to  the  lower  aqueous  phase through  the
mineral  oil  layer.  Ensure  that  the  enzyme  is not  added  to  the  011 layer.  Replace
each tube  in  the  block  at 94°C  until  enzyme  has been  added  to  each tube.
7.  Stop  the  94’C  soak program  and  immediately  run  the  amplification  program  for
35  cycles  of:  94’C  denaturation  for  45  s,  60°C  annealing  for  45  s,  and  72°C
extension  for 45  s, followed  by a final  extension  of  10 min  at 72°C  and  an indeti-
mte  soak  at 4°C.
8.  Take  a 20-pL  aliquot  from  each reaction  tube  and to  each aliquot  add  10 pL  of  gel
loading  buffer.  Load  25  pL  of each A and B  pair  next  to  each other  on a horizontal
3%  agarose  gel  (containing  ethidium  bromide  at  0.5  yglmL)  (see Note  7)
9.  Electrophorese  the  samples  at  1OOV for  45  min  (for  a  20  x  25-cm  gel)  in  0.5X
TBE  buffer.
10.  Visualize  using  a UV  transilluminator  and  photograph  the  gel  for  a permanent
record  (see Fig.  2)
3.4.  AS0  Hybrkfjzation
In addition  to the ARMS  multiplex  test, a number  of mutations are tested for
by AS0  hybridization  to dot-blots  of  PCR products. In  the first instance, PCR
products  of the relevant  CFTR  exon are prepared  according  to standard proce-
dures. These are fixed  onto duplicate nylon  membranes in the form  of dot-blots,
which  are then hybridized  to one of two ASOs, which  are homologous  to either
the normal  sequence or the mutant  sequence at any given  point.
3.4.1.  Preparation  of  Dot-Blots
1.  For  each sample,  label  a 0.5~mL  microcentrifUge  tube.  To  each tube,  add 6  PL  of
denaturing  solution  (0.4M  NaOH,  25  mM  EDTA).  Carefully  (from  beneath  the
oil  layer)  take up  16 pL  of PCR  product  from  each sample  and add to the denaturant.
Screening  in  Cystic  Fibrosis  115
123456789  10  11  12  13  14  15  16  17
Fig.  2.  Detection  of  four  CF  mutations  by  the  CF(4)m  PCR  kit.  Odd-numbered
tracks  contain  the ARMS  products  for the  normal  alleles  of  621  +  l(G  >  T)  and AF508,
plus  the  mutant  alleles  of G55  1 D  and G542X.  Even-numbered  tracks  contain  products
for  the  normal  alleles  of G55  1D  and  G542X  and the  mutant  alleles  of 62 1 +  1 (G  >  T)
and  AF508.  Tracks  1 and  2 are  from  an  individual  who  is  negative  for  all  four  muta-
tions,  as are  tracks  3  and  4.  Tracks  5 and  6 are from  a AF508  heterozygote  (the  extra
band  in  track  6  represents  the  AF508  mutant  allele).  Tracks  7 and  8 are from  a AF508
homozygote  (the  extra  band  in  track  8 represents  the AF508  mutant  allele  and the  band
representing  the  normal  allele  for  AF508  is absent  from  track  7).  Tracks  9 and  10  are
from  a compound  heterozygote  of  621  +  l(G  >  T)  and  AF508.  Tracks  11  and  12 are
from  a G55  ID  heterozygote.  Tracks  13 and  14 are from  a compound  heterozygote  of
G542X  and  AF508.  Tracks  15 and  16 are a negative  (no  DNA)  control  and  track  17 is
DNA  molecular  weight  marker  VI  (Boehringer  Mannheim).
2.  Incubate  the  tubes  at  94’C  for  10 min  in  a heating  block  and  then  cool.  Centri-
fuge  the  tubes  briefly.
3.  Cut  a piece  of  charged  nylon  membrane  (e.g.,  Hybond  N+)  sufficient  for  prepar-
ing  duplicate  membranes.  In  pencil,  mark  out  a grid  of  squares  1.25  x  1.25  cm
and  number  the  membranes  accordingly  (see Note  8).
4.  Transfer  8 pL  of each sample  onto duplicate  squares of each membrane.  Allow  to dry.
5.  Fix  the  DNA  to  the  membrane  by  exposing  to UV  light  at 3 12 nm  (on  a standard
UV  transilluminator)  for  5 min.
6.  Place  the  membrane  between  sheets of  filter  paper.  Wrap  in  cling  film,  and  store
at 4’C  until  use.
3.42.  AS0  Labeling
Each AS0  is 5’ end-labeled  with  y-33P or  32P using  polynucleotide  kinase
(PNK)  which  catalyzes the transfer  of  the y-phosphate of  ATP  to a 5’-OH  ter-
minus  of  DNA.
1.  To  a 0.5~mL  tube  add the  following:  5 uL  sterile  distilled  water,  1 PL  PNK  buffer
(10X),  1 pL  AS0  (10-20  ng/pL),  1 uL  33P-ATP  or 32P-ATP,  2 pL  PNK  (10-20  U).
116  Schwarz  and  Malone
2.  Incubate  the  reaction  mixture  at  37’C  for  1 h,  then  heat  to  70°C  for  2  min  to
denature  the  enzyme.
3  Dilute  each reaction  to  100 uL  with  distilled  water  for  ease of  dispensing.
3.4.3.  Hybridization  of  ASOs  to  Dot-Blots
1.  Place  each  of  the  duplicate  membranes  (A  and  B)  m  a  clean,  dry  hybridization
vessel.  To  each vessel  add  10 mL  of  hybridization  solution,  takmg  care to  avoid
trapping  air  bubbles  between  the membrane  and  the  vessel.
2.  Prehybrrdize  the  membranes  m  the  hybrtdization  oven  at 42°C  for  1 h.
3  To  the  A  vessel,  add the  33P- or 32P-labeled  “mutant”  AS0  (from  Section  3.4.2.),
ensuring  that  the  AS0  is mtxed  throughout  the  vessel.  Likewise,  add the  labeled
“normal”  AS0  to  the  B  vessel
4  Incubate  the  two vessels  overnight  at 42’C  in  the  hybridization  oven
5.  Discard  the  hybridization  solution,  replace  with  30  mL  of  wash  solution  (2X
SSC,  0.1%  SDS),  and  return  to  the  hybridization  oven  for  45  mm.
6.  Repeat  step 5, adjusting  the oven  temperature  according  to  the AS0  used (Table  4)
(see Note  9).
7  After  the  final  wash, remove  the  membrane  from  the  vessel,  blot  dry,  and  place
between polythene  sheets in  an X-ray  cassette. Place  a sheet of X-ray  film  against
the  membrane  and  expose at -70°C  for  l-4  d before  developing  if  using  33P, or  at
room  temperature  for  2-3  h  if  using  32P.
4.  Notes
1.  Prepare  a  solution  of  herring  sperm  DNA  (10  mg/mL)  preferably  leaving  it  to
dissolve  overnight.  The  DNA  may  be sheared  either  by  passing  the  solution  sev-
eral  times  through  a narrow  gage  (G21)  needle,  or  by  using  a  sonicating  water
bath  (60  mm,  full  power  for  100 mL  of  DNA  solution).  The  DNA  solution  may
then  be  stored  in  lo-mL  aliquots  at  -2O’C  until  required.  The  DNA  solution
should  be  placed  in  a  botlmg  water  bath  for  5-10  min  to  denature  the  DNA
immediately  prior  to  its  use m  the  preparation  of hybridization  solutton.
2.  It  has been  reported  that  if  patients  eat  apples  or  chocolate  before  performing  a
mouthwash  sample  there  may  be  some  mhtbition  of  PCR  when  usmg  those
samples  (Cellmark  Diagnostics,  personal  commumcatton,  March  1994).  We  rec-
ommend  that  patients  do  not  perform  mouthwash  samplmg  mnnediately  after
eating.  Patients  are  also  advised  not  to  brush  their  teeth  immediately  before
sampling.  For  babies/children  who  are too  young  to  perform  a mouthwash,  suf-
ficient  cellular  materral  may  be  collected  by  gently  wtpmg  inside  each  cheek
using  a swab/cotton  bud  and  rmsmg  this  into  the  sucrose solution.
3.  DNA  prepared  from  mouthwash  samples  or  from  blood  using  the  small-scale
(NaOH)  method  could  probably  be  stored  for  several  years  (not  mvesttgated),
but  the  phenol/chloroform  extraction  method  from  blood  is  recommended  for
preparation  of  DNA  destined  for  long-term  storage  DNA  for  storage  should  be
dissolved  in  TE  buffer  pH  7 5 rather  than  in  water.
4.  Prepare  an  aqueous  solution  of  proteinase  K  (20  mg/mL)  and  store  at -20°C  in
500~uL  aliquots.
Screening  in  Cystic  Fibrosis  117
5.  Phenol  1s highly  corrosive,  can cause severe bums,  and should  be handled  with  care
6.  Multiplex  ARMS  CF(4)m  is  a very  sensitive  test  and  the  use of  filter  pipet-ups
throughout  ts recommended  to  avoid  problems  with  contammatton.
7.  Ethtdmm  bromide  is a powerful  mutagen  and should  be handled  with  care  A  stock
solution  (10  mg/mL)  should  be prepared  and  stored  at 4°C  in  a lightproof  bottle.
8.  Hybond  membrane  should  be  handled  as little  as possible,  always  using  clean,
dry  gloves.
9  Posthybridization  wash temperatures  are given,  but  smce different  ovens  will  have
different  specifications,  these conditions  should  be used as a guide  and monitoring
of the  membranes  after  each wash, using  a Geiger-Muller  detector,  is advised
10.  Working  solutions  of primer  pairs  are made  at a concentration  of  20  l.tA4 of  each
primer.  Stock  solutions  of each primer  are stored  at  10X  working  concentration
Working  solutions  of  ASOs  are made  at  10 ng/pL,  and  stock  solutions  at  100X
working  concentration  All  primer  and  AS0  solutions  are stored  at -2O’C
References
1.  Rommens,  J.  M.,  Ianuzzi,  M.  C.,  Kerem,  B.,  Drumm,  M.  L.,  Melmer,  G.,  Dean,
M.,  et al.  (1989)  Identification  of  the  cystic  fibrosis  gene  chromosome  walking
and jumpmg.  Science  245,1059–1065.
2.  Riordan,  J. R.,  Rommens,  J. M.,  Kerem,  B.,  Alon,  N.,  Rozmahel,  R.,  Grzelczak,
Z.,  et  al  (1989)  Identification  of  the  cystic  fibrosts  gene*  clonmg  and  character-
ization  of  complementary  DNA.  Science  245,  1066-1073.
3.  Kerem,  B.,  Rommens,  J.  M.,  Buchanan,  J.  A.,  Markiewicz,  D  ,  Cox,  T  K.,
Chakravarti,  A.,  et  al.  (1989)  Identification  of  the  cystic  fibrosis  gene’  genetic
analysis.  Science  245,  1073-1080.
4  Mullis,  K  and  Faloona,  F. (1987)  Specific  synthesis  of  DNA  m  vitro  via  a poly-
merase  catalyzed  chain  reation,  m Methods  tn Enzymology,  vol.  155 (Wu,  R.,  ed.),
Academic,  New  York,  pp.  335-350.
5.  Newton,  C.  R.,  Graham,  A.,  Heptinstall,  L.  E.,  Powell,  S.  J.,  Summers,  C.,
Kalsheker,  N  , and  Smith,  J. C. (1989) Analysis  of any point  mutation  in  DNA:  the
amplification  refractory  mutation  system.  Nucleic  Acids  Res  17,2503-25  16.
6.  Schwarz,  M.  J.,  Malone,  G.  M.,  Haworth,  A.,  Cheadle,  J.  P.,  Meredith,  A.  L  ,
Gardner,  A.,  et  al.  (1995)  Cystic  fibrosis  mutation  analysis:  report  from  22  UK
regional  genetics  laboratories.  Hum  Mut.  6,326–333.
7.  Kazazian,  H  H.,  Jr.  and The  Cystic  Fibrosis  Genetic  Analysis  Consortium  (1994)
Population  variation  of  common  cystic  fibrosis  mutations.  Hum  Mut  4,  167-l  77.
8.  Cutting,  G.  R.,  Kasch,  L  M.,  Rosenstein,  B.  J., Tsui,  L-C.,  Antonarakis,  S  E  , and
Kazazian,  H.  H.,  Jr.  (1990)  A  cluster  of  cystic  fibrosis  mutations  m  the  first
nucleotide-binding  fold  of  the  cystic  fibrosis  conductance  regulator  protein.
Nature  346,366–369
9.  Kerem,  B.,  Zielenski,  J ,  Markiewicz,  D.,  Boron,  D.,  Gaztt,  E.,  Yahaf,  J.,  et  al.
(1990)  Identification  of mutations  in  regions  corresponding  to the 2 putative  nucle-
otide  (ATP)-binding  folds  of the  cystic  fibrosis  gene.  Proc  Natl  Acad  SIX  USA
87,8447-845  1.
118  Schwarz  and  Malone
10.  Zielenski,  J.,  Bozon,  D.,  Kerem,  B.,  Markiewicz,  D.,  Rommens,  J.  M.,  and  Tsui,
L.-C.  (1991)  Identification  of  mutations  in  exons  1 through  8 of the cystic  fibrosis
transmembrane  conductance  regulator  (CFTR)  gene.  Genomzcs  10,229-235.
11.  Dean,  M.,  White,  M.,  Amos,  J.,  Gerrard,  B.,  Stewart,  C.,  Khaw,  K.-T.,  and
Leppert,  M.  (1990)  Multiple  mutations  in  highly  conserved  residues  are  found  m
mildly  affected  cystic  fibrosis  patients.  Cell  61,863-870
12  Strong,  T.  V.,  Smit,  L  S , Nasr,  S., Wood,  D  , Cole,  J  L  , Ianuzzi,  M.,  Stern,  R  ,
and Collins,  F.  S. (1992)  Charactensatlon  of an intron  12 splice  donor  mutation  m
the cystic  fibrosis  transmembrane  conductance  regulator  (CFTR)  gene. Hum.  Mut.
1,380-387.
13.  Osborne,  L.,  Knight,  R.  A.,  Santis,  G.,  and  Hodson,  M  (1991)  A  mutation  in  the
second  nucleotide  bmdmg  fold  of the  cystic  fibrosis  gene. Am  J  Hum  Genet  48,
608-612.
14.  Schwarz,  M.  J.,  Summers,  C.,  Heptinstall,  L.  E.,  Newton,  C.,  Markham,  A.,  and
Super,  M.  (1991)  A  deletion  mutation  of  the  cystic  fibrosis  transmembrane  con-
ductance  regulator  (CFTR)  locus:  AI507  Adv  Exp  A4ed  Bzol  290,393-398.
15.  Iannuzzl,  M.  C.,  Stern,  R.  C.,  Collins,  F  S , Hon,  C  T  , Hldaka,  N.,  Strong,  T.,  et
al. (1991)  Two  frameshift  mutations  in  the cystic  fibrosis  gene  Am.  J, Hum.  Genet
48(2),  227-23  1.
16.  Jones,  C.  T.,  McIntosh,  I.,  Keston,  M  , Ferguson,  A.,  and  Brock,  D.  J.  H.  (1992)
Three  novel  mutations  in  the  cystic  fibrosis  gene  detected  by  chemical  cleavage:
analysis  of variant  splicing  and a nonsense mutation.  Hum.  Mol.  Genet  l(l),  11-17.
17.  Vidaud,  M.,  Fanen,  P  , Martin,  J.,  Ghanem,  N.,  Nicolas,  S.,  and  Goossens,  M.
(1990)  Three  mutations  in  the  CFTR  gene  in  French  cystic  fibrosis  patients:
identification  by  denaturing  gradient  gel  electrophoresis  Hum  Genet.  85,
446-449.
18  Claustres,  M.,  Gerrard,  B.,  White,  M.  B.,  Desgeorges,  M  , Kjellberg,  P.,  Rollin,
B . , and  Dean,  M.  ( 1992)  A  rare mutation  ( 1078delT)  m  exon  7 of the  CFTR  gene
in  a Southern  French  adult  with  cystic  fibrosis.  Genomics  13,907,908.
19.  Highsmith,  W.  E.,  Burch,  L.  H.,  Zhou,  Z.,  Olsen,  J.  C.,  Boat,  T.  E.,  Speck,  A.,  et
al.  (1994)  A novel  mutation  in  the cystic  fibrosis  gene with  pulmonary  disease but
normal  sweat chloride  concentration.  N  Engl  J  Med  331,  974-980.
20.  Livingstone,  J., Axton,  R.  A.,  Gtltillan,  A.,  Mennie,  M.,  Compton,  M.,  Liston,
W.  A.,  et  al.  (1994)  Antenatal  screening  for  cystic  fibrosis  a trial  of  the  couple
model.  Br  Med  J  308,1459-1462.
21.  Super,  M.,  Schwarz,  M.  J., Malone,  G.,  Roberts,  T.,  Haworth,  A.,  and  Dermody,
G.  (1994)  Active  cascade testing  for  carriers  of  cystic  fibrosis  gene.  Br  Med  J
308,  1462-1468.
22.  American  Society  of Human  Genetics  Board  of  Directors  (1992)  Statement  of the
American  Society  of  Human  Genetics  on  Cystic  Fibrosis  Carrier  Screening.  Am.  J.
Hum.  Genet.  51(6),  1443,1444.
23.  Ferrie,  R.  M.,  Schwarz,  M.  J.,  Robertson,  N.  H.,  Vaudin,  S.,  Super,  M.,  Malone,
G.,  and  Little,  S.  (1992)  Development,  multiplexing,  and  application  of  ARMS
tests for common  mutations  in  the CFTR  gene. Am.  J. Hum  Genet  51(2),  251-262
Screening  in  Cystic  Fibrosis  119
24.  Gasparini,  P., Dognini,  M.,  Bonnizzato,  A.,  Pignatti,  P.  F., Morral,  N.,  and Estivill,
X.  (1991)  A  tetranucleotide  repeat polymorphism  in  the  cystic  fibrosis  gene. Hum.
Genet.  86,625.
25.  Morral,  N.,  Nunes,  V.,  Casals,  T.,  and  Estivill,  X.  (1991)  CA/GT  microsatellite
allele  within  the  cystic  fibrosis  transmembrane  conductance  regulator  (CFTR)
gene  are not  generated  by  unequal  crossing  over.  Genomics  10,692-698.
26.  Zielenski,  J.,  Markiewicz,  D.,  Rininsland,  F.,  Rommens,  J.  M.,  and  Tsui,  L.-C.
(199  1) A  cluster  of  highly  polymorphic  dinucleotide  repeats  in  intron  17B  of  the
CFTR  gene. Am.  J.  Hum.  Genet.  49,1256–1262.
27.  Morral,  N.,  Girbau,  E.,  Zielenski,  J.,  Nunes,  V.,  Casals,  T.,  Tsui,  L.-C.,  and
Estrvlll,  X.  (1992)  Dinucleotide  (CA/GT)  repeat  polymorphism  in  mtron  17B  of
the  cystic  fibrosis  conductance  transmembrane  regulator  (CFTR)  gene.  Hum.
Genet.  88,356
28.  Zielenski,  J., Rozmahel,  R.,  Bozon,  D.,  Kerem,  B.,  Grzelczak,  Z.,  Riordan,  J. R.,
et al.  (199  1) Genomic  DNA  sequence of  the cystic  fibrosis  conductance  regulator
(CFTR)  gene.  Genomics  10,214-228.
29.  Casals,  T.,  Bassas, L.,  Ruiz-Romero,  J.,  Chillon,  M.,  Grmmez,  J.,  Ramos,  M.  D.,
et al.  (1995)  Extensive  analysis  of 40  infertile  patients  with  congenital  absence  of
the  vas deferens:  in  50%  of  cases only  one  CFTR  allele  could  be detected.  Hum.
Genet.  95,205-2  11.
30.  Kiesewetter,  S.,  Macek,  M.,  Jr.,  Davis,  C.,  Currrstm,  S. M.,  Chu,  C.-S.,  Graham,
C.,  et al.  (1993)  A  mutation  in  CFTR  produces  different  phenotypes  depending  on
chromosomal  background.  Nature  Genet.  5,274-278.

Characterization  of  Gene  Rearrangements
and  Gene  Conversion  Events
in  the  21-Hydroxylase  Gene
Simon  C.  Ramsden  and  Paul  J.  Sinnott
1.  Introduction
Congenital  adrenal  hyperplasia  (CAH)  is an inherited  disorder  of  steroido-
genesis with  a wide  spectrum of  expression. In about 95% of cases, the disease
1s the result  of  21-hydroxylase  deficiency,  an autosomal  recessive  condmon
that maps to the major  histocompatibility  complex  (MHC)  on 6~21.3  (I).
Classical CAH  results in excessive androgen  production.  Females with  this
disorder  are frequently  diagnosed at birth  because of  ambiguous  development
of  external  genitalia,  whereas males may not present until  age 4-7  when  they
begin  to manifest  inappropriate  virthzation.  Approximately  30% of mdtviduals
with  classical CAH  have this simple virilizing  form  of the disease. The  remain-
ing 70% in addition  manifest  the potentially  life-threatening  salt-wasting  form
of  classical CAH  characterized by an inability  to retain  dietary  sodmm.
Pang and coworkers  (2)  estimated the incidence  of  classical CAH  based on
biochemical  criteria  as 1 in  14,000 with  a carrier  frequency  of  1 in  60. Non-
classical CAH  is likely  to  be equally  as common,  and although  accurate esti-
mates are not  available,  the prevalence  of  all  clinical  forms  of  the disease is
likely  to vary  from  one populatton  to the next (3). When an individual  at popu-
lation  risk  requests carrier  testing, we  estimate a prior  carrier  risk  of  1 in  50.
This  cannot account for  racial  differences  and, in addition,  will  be an underes-
timate,  not accounting  for  the mildest  mutations.
1.1.  The  Genetics  of  21-Hydroxylese  Deficiency
There  are  two  21-hydroxylase  loci  at  6~21.3,  a functtonal  gene  (termed
P45Oc2 1 B, CYP2 1, or 2 1B) and a nonfunctional  pseudogene (termed P45Oc2 1 A,
From’  Methods  m  Molecular  Medune.  Molecular  Dagnosrs  of  Genetrc  Dseases
Edited  by  R  Elles  Humana  Press  Inc  , Totowa,  NJ
721
122  Ramsden  and  Sinnott
CYP2 1 P, or 2 1 A).  These loci are duplicated  in tandem with  the C4A  and C4B
loci,  respectively,  which  encode the fourth  component  of  the serum comple-
ment (4). What we  see today is assumed to be the consequence of  an ancestral
duplication  of approx 30 kb of DNA  encoding the 2 1 -hydroxylase  and C4 genes
(see Fig.  1). Sequencing studies have  confirmed  the presence of  a number  of
mutations  within  the 21A  pseudogene incompatible  with  gene function  ($6).
The tandem duplication  involving  the 2 I -hydroxylase  gene results in high  lev-
els of  mutation  owing  to gene deletions  and gene conversion.
1.1-l.  Gene  Deletions
Gross deletions  of the entire 21B  gene account for  approximately  one-third
of  2 1 -hydroxylase-deficient  chromosomes.  The  high  degree  of  sequence
homology  between  the A  and B umts means that unequal  pairing  may occur
across this region  during  meiosis. If  this is accompamed by  a recombination
event  within  the mispaired  region,  then a trtplication  and a deletion  of  a com-
plete unit will  result in the meiotic  products. The  position  of the recombination
event  will  dictate the exact composition  of  the resultant recombinant  chromo-
somes. Figure  2  shows  a range  of  theoretical  possibilities  given  different
recombination  events.  Recombination  events at position  A,  for  example,  will
result  in a chromosome  lacking the entire 2 1B gene. Clearly,  this is not the full
picture  since a recombination  event  between A and B will  result  in a 2 1 B/2 1 A
fusion  gene, nonfunctional  by virtue  of  the 21A  sequences.
Figure 2 also demonstrates the generation of deletions and triplications that will
have  no consequence on 21 -hydroxylase  activity.  Indeed,  these rearrangements
can be demonstrated in the normal population. It has been estimated, for  example,
that 14% of  normal chromosomes in the French population  carry a 2 IA  unit dele-
tion (7). These nonpathogenic deletions and triplication  haplotypes may be used as
extremely  close polymorphisms  for  2 1 -hydroxylase  deficiency  gene tracking.
1.1.2.  Gene  Conversion
Approximately  two-thirds  of  2 1 -hydroxylase-deficient  chromosomes show
no evidence  of  gross 2 1 B deletions. In  these instances, sequencing has identi-
fied  point  mutations,  and  small  insertions  and deletions.  Closer  examination
reveals  that these mutations are usually already present in the 2 1A pseudogene,
and they appear to pass into the 2 1 B gene by the process of  gene conversion,  a
process first  described in ascomycete fungi  (81. Gene conversion  in this system
relies  on the heteroduplex  formed  by the nonhomologous  pairing  between  the
2 1A and B genes. Mtspaired  bases, corresponding  to the sites of  mutation  m
the 21A  gene, are subject to mismatch repair.  Consequently,  the strands may
be correctly  or incorrectly  repaired,  the latter  case resulting  in  the transfer  of
pseudogene sequence into  the active  2 1 -hydroxylase  gene.
The  2 7 – Hydroxylase  Gene  123
21B  C4B  21A  C4A
I  I
approx. 30kb
Fig.  1. Schematic  representation  of  the  genomic  organization  around  the  21-hy-
droxylase  locus.
Fig.  2.  Possible  outcomes  of  nonhomologous  recombination  events  around  the
2 1 -hydroxylase  gene.
1.2.  Referrals
Individuals  will  be referred  for  the molecular  diagnosis  of  2 1 -hydroxylase
deficiency  for  a variety  of  reasons:
1.  An  early  and  accurate  prenatal  diagnosis  in  a family  with  a previous  history  of
21-hydroxylase  deficiency  will  identify  affected  female  fetuses in  utero.  In  these
cases, dexamethasone  treatment  will  assist normal  genital  development  in  the fetus.
2.  For  individuals  with  either  a  mild  or  atypical  manifestation  of  the  disease,
molecular  techniques  may  identify  mutations  in  the  21-hydroxylase  gene  that
will  confirm  the  diagnosis.  Unfortunately,  since  no  routine  screening  strategy
would  be likely  to  identify  all  possible  mutations,  the inability  to identify  a muta-
tion  can  never  exclude  the  diagnosis.
124  Ramsden  and  Sinnoti
3  Individuals  wtll  often  present  to  chmc  requesting  carrier  screening  These  may
be individuals  at an elevated  prior  risk  owing  to an affected  relative  or mdtviduals
at population  risk  with  a partner  who  is  affected  or  a known  carrier.
Haplotype  analysis  mcorporatmg  markers  closely  flanking  the  disease  locus  IS
the  most  useful  technique  in  the  prenatal  diagnosis  of  CAI-I  where  affected  mem-
bers  of  a f&my  have  been  prevtously  dragnosed.  These  requests  are often  at  short
notice,  and  gene  traclung  will  always  offer  quick,  accurate  risks.  For  diagnostic
purposes  and  carrier  detection,  however,  dnect  mutation  analysis  1s usually  necessary.
2.  Materials
The  polymerase  chain  reaction  (PCR)  procedures  used  throughout  this  chap-
ter  are  standard  techniques,  and  the  materials  and  equipment  required  have  been
described  in  detail  elsewhere  (see particularly  Chapter  2).  Southern  analysis  for
major  gene  rearrangements  will  be highlighted  as the  key  technique  in  this  chapter.
2.1.  PC/?
1.  The  materials  required  for  the  PCR  amplificatton  are  detailed  in  Chapter  2.
2.  The  ohgonucleotides  required  are given  in  Tables  1 and  2.
3  For the  visualizatton  of rmcrosatellites,  one will  require  apparatus  suitable  for  run-
nmg  8% native  polyacrylanude  (19: 1 ratio  of crosslinking)  gels and silver  staimng  is
required  (see Chapter  2).
4.  For  the  visualization  of  amplification  refractory  mutation  system  (ARMS)  prod-
ucts,  one  will  require  apparatus  suitable  for  runnmg  l-3%  horizontal  agarose
gels  and  ethidium  bromide  staining  (see Chapter  2).
2.2.  Southern  Analysis
Analytical-grade  reagents  should  be  used  at  all  times.
1.  A 20 x 20 cm  submarme  gel  electrophoresrs tank  suitable  for running  agarose gels  is
essential,  i  e., Horizon  20  25  system  (Life  Technologies,  Gaithersburg,  MD)
2.  An  electrophoresrs  power  pack
3  A  temperature-controlled  hybrtdization  oven,  capable  of  mamtammg  65’C.
4.  Electrophoresis-grade  agarose.
5.  TaqI  restriction  enzyme*  This  is available  from  numerous  manufacturers  at a con-
centration  of  approx  10 U/uL  and will  be supplied  with  a suitable  reaction  buffer.
Store  at -20°C
6.  Probes  21A1.8  (11)  and  C4B550  (12).
7.  TBE  electrophoresis  buffer:  Make  as a  10X  stock  solution,  0.89M  Trts,  0.89M
boric  acid,  0.02A4 EDTA  (pH  8.0),  and  store  at room  temperature.
8.  5X  TBE  gel  loading  buffer,  to  make  10  mL:  4.9  mL  glycerol,  100  uL  of  10%
SDS, 3 mg  bromophenol  blue,  and  15 mg  xylene  cyanole.  Store at room  temperature.
9.  Phosphate  prehybridization/hybridization  solution  (PPH):  Prepare  prehy-
bridization  solution  as a 2X  stock  (i.e.,  0.5MNaH2P04,  O.SMNaCl,  1 mMEDTA,
adjust  to pH  7.5  with  5MNaOH),  and  store  at room  temperature.  When  ready  to
The  21 -Hydroxyase  Gene  725
Table  1
Microsatellite  Primer9
Oligonucleotide  Sequence,  S-3
IR2  GCCTCTAGATTTCATCCAGCCACA
IR4  CCTCTCTCCCCTGCAACACACA
a Primer  sequences taken from ref  9.
Table  2
ARMS  Primersa
Oligonucleotide  Sequence,  5’-3’
Pl
P4
P5
Pll
P19
P48
P55
P659A
P659C
P659G
P1004T
P1004A
P1688G
P1688T
P2113C
P2113T
TTC  AGG  CGA  TTC  AGG  AAG  GC
TCT  CGC  ACC  CCA  GTA  TGA  CT
GGT  GCT  GAA  CTC  CAA  GAG  G
GGA  GCA  ATA  AAG  GAG  AAA  CTG  A
TTG  AGC  AAG  GGC  AGC  CGT  G
CAG  AGC  AGG  GAG  TAG  TCT  C
CCT  GTC  CTT  GGG  AGA  CTA  CT
ACC  CTC  CAG  CCC  CCA  A
ACC  CTC  CAG  CCC  CCA  C
ACC  CTC  CAG  CCC  CCA  G
CCG  AAG  GTG  AGG  TAA  CAG  A
CGA  AGG  TGA  GGT  AAC  AGT
ACT  GCA  GCC  ATG  TGC  AC
CAC  TGC  AGC  CAT  GTG  CAA
GGG  CAC  AAC  GGG  CCG
AAG  GGC  ACA  ACG  GGC  CA
a Primer  sequences taken from  ref. 10.
use the prehybridization  buffer,  dilute  with  water and  add  SDS  to  a final  concen-
tration  of  1X  PPH,  0.5%  SDS.  To  make  the  hybridization  buffer,  remove  20  mL
into  a screw-capped  plastic  tube,  and  add  PEG  6000  to  a final  concentration  of
6%.  No  further  blocking  is required  for  these  probes.
IO.  Probe-labeling  reagents:  In  a laboratory  not  already  routinely  labeling  probes,  a
commerctal  random  priming  labeling  kit  (e g.,  The  Random  Primed  DNA  Label-
ing  Kit,  Boehringer  Mannheim  [East  Sussex, UK],  product  number  1004  760)  is
the  easiest  option.
11.  a32PdCTP  radioisotope  label:  Can  be  purchased  at  10  pCi/pL  from  Amersham
International  (Buckinghamshire,  UK).  Note  that  storage  and  use  of  radioactive
materials  are governed  by  national  and  local  safety  regulations.
126  Ramsden  and  Sinnott
12.  Denaturing solution: ISMNaCl,  0 5MNaOH.  Store at room temperature.
13  20X  SSC: 3MNaC1,O 3M Na-citrate  Store at room temperature
14  Positively charged nylon membrane for  DNA transfer, I e., Hybond N+ (Amer-
sham International).
15  250- and 500-p gage polythene layflat tubing (P & B Plastics, Stockport, UK).
16.  Glass plates.
17.  Autoradiograph cassettes fitted with blue emitting intensifying screens, i.e., High
Speed X  (X-Ograph, Wiltshire, UK).
18.  X-Ray  film.  Fuji RX  (FUJI  Photo Film Co., Japan).
19. -70°C  Freezer.
20  A slow orbital shaker.
2 1  A short-wave UV transrlluminator.
3.  Methods
3.1.  Gene  Tracking
The  21-hydroxylase  locus resides within  the class III  region  of  the MHC,
and typing  for  the linked  human leucocyte antigen (HLA)  loci have been widely
used in tracking  this gene. Although  associations are well  established between
CAH  and certain  HLA  types (13-161,  they are rarely  of  much practical  use in
routine  diagnosis. DNA-based  markers have proven  most useful  for  the molec-
ular  diagnosis  of  21-hydroxylase  defictency.  These  can be  divtded  mto  two
broad  types,  namely  markers  derived  from  DNA-based  HLA  typing  and
microsatelhte  markers representing  anonymous polymorphisms.
3. I.  I.  DNA-Based  MA  Typing
Although  it  IS outside  the  scope of  this  chapter  to  describe  the  practical
details  behind  HLA  typing,  they are worth  a brief  note  since they  do offer  a
rich  source of highly  polymorphic  markers for  2 1 -hydroxylase  gene tracking  if
HLA  typing  facilities  are available.  A  complete  system of  HLA-DR  and  DQ
typing  devised  by  Bidwell  and Jarrold  (17)  relying  on  Southern  analysis has
now  been adopted by many typing  laboratones.
More  recently,  an alternative  to restriction  fragment  length  polymorphism
(RFLP)  typing  has been developed,  the use of  PCR amplification  followed  by
hybridization  with  allele-specific  oligonucleotide  probes (18). The principle  of
so-called  oligotyping  1s the determination  of  nucleotide  sequences that occur
in  the polymorphic  exons of  the  HLA  genes. In  the HLA  class II  genes, for
example, most of  this variation  occurs m the second exon.
One  of  the most elegant  strategies for  HLA  typing  at the molecular  level
involves  the design of  specific oligonucleotide  primers  for  PCR amplification,
which  will  amplify,  exclusively,  the  desired  allele.  This  sequence-specific
amplification  (or  ARMS–see  Section 3.2.2.)  technique  is now  available  for
the rapid  nonradioactrve  typing  of HLA-A,  -B, -C, -DR,  and -DQ  loci  (19-22).
The  2 1 -Hydroxylase  Gene  127
Table  3
Conditions  for  Amplifying  a  Microsatellite  Repeat  at  the  TNF  Locus
Product  sizes,  Number  of
Microsatellite  Primers  bp  Cyclinga  cycles
TNFa  IR2+4  80-l  10  93”C,  1 min  27
65’C,  1 min
72”C,  1 min
Tycling  is preceeded by  93T  for  3 min and followed  by  72°C  for  5 min.
Fig.  3.  Microsatellite  TNFa.  This  marker  shows approx  0.5%  recombination  with
the  2 1 -hydroxylase  locus.
3. I .2.  Microsatellite  Markers
These offer  a rapid nonradioactive  alternative  to HLA  typing. Microsatellites
have  been described at the TNF  locus approx  0.5 CM distal to the disease gene
(9).  These  have  proven  particularly  useful  in  the diagnosis  of  this  disease.
Table  3 shows the amplification  conditions used for  a particularly  useful micro-
satellite. Fragments are resolved  on 8% native  polyacrylamide  gels and visual-
ized using ethidium  bromide  or silver  staining (see Chapter  2). Figure  3 shows
this marker  segregating  through  two  families.
128  Ramsden  and  Sinnott
It is envisaged that as the HLA  region becomes better characterized, further micro-
satellites will  become available  offering  flanking  markers that might be amplified
in a multiplex  reaction  making  gene tracking  for  this disease more efficient.
3.2.  Mufation  Analysis
3.2.1.  Short  Range  Mapping
Rearrangements involving  the 2 1 -hydroxylase  gene are best determined by a
short-range  mapping  strategy usmg  Southern analysis (adapted  from  ref.  22).
Although  a number  of  restriction  digests can provide  information  regarding
genomic organization around this locus, we use a simple 7’uqI digest with  a mixed
radiolabeled  probe  representing  the ~450~2 1 cDNA,  2 1 Al  .8 (1 l),  and  a 5’ C4
cDNA,  C4B550  (12). For the purposes of  this chapter, the technical details of  the
process of  Southern analysis are given  in full.  However,  it is the interpretation of the
resulting autoradiographs that makes this particular application most interesting.
3.2.1.1.  RESTRICTION  DIGESTION  AND  GEL  ELECTROPHORESIS
1.  The  genomic  DNA  1s cut  with  Tag1 prior  to  electrophoresis  Prepare  restriction
digests  of all  the  samples  to be analyzed  m  either  0.6-  or  1 6-mL  microcentrifuge
tubes  as follows:  5 pg  of  genomic  DNA,  3 l.tL  of  10X  restriction  enzyme  buffer
(supplied  by  the  manufacturer),  10 U  of restriction  enzyme  (typically  1 pL).  Add
sterile  dHzO  to  30  yL  and  Incubate  m  a water  bath  at 65°C  for  at  least  4 h,  pref-
erably  overnight.
2.  While  the  samples  are digesting,  prepare  a 0 8%  agarose  gel  for  electrophorests
of the  samples.  For  a typical  20  x 20 cm  format,  the  following  amounts  should  be
sufficient:,  35 mL  of  10X  TBE,  3 15 mL  of dH*O,  2.8  g of agarose.  The  gel  should
be  heated  gently  to  dissolve  the  agarose  either  in  a  microwave  oven  or  on  a
hotplate  with  a magnetic  stirrer  bar  Once  the  agarose  has completely  dissolved,
add  17.5  pL  of  a  10 mg/mL  solutton  of  ethidmm  bromide,  swirl  gently  to  mix,
and  allow  the  gel  solution  to  cool  to  65°C.
3.  Place  an appropriate  comb  in  the  gel  former,  and  seal the  open  ends  with  plastic
tape  When  the  gel  has cooled  down,  pour  carefully  mto  the  former.  Check  for  an
bubbles,  especially  around  the  comb  These  can be removed  using  a Pasteur  pipet.
Allow  the  gel  to  set  for  at  least  1 h  before  running.  If  the  gel  1s not  required
tmmedtately,  it  may  be  wrapped  m  clmg  film  and  stored  m  a refrigerator  at 4°C
for  up  to  48  h  When  ready  to  run,  remove  the  tape  and  immerse  in  1X  TBE
buffer  to  a depth  over  the  gel  surface  of  about  1.5  mm,  Only  remove  the  comb
once  the  gel  is fully  submerged  in  the  running  buffer.
4.  The  samples  should  be  monitored  for  complete  digestion  before  running.  Take
3 yL  of  each restrrction  digest,  and  mix  wrth  1 yL  of 5X  TBE  loading  buffer,  and
run  for  30 min  at 60 mA  on a 0.8-l  .O% agarose monitor  gel.  The  digested  samples
should  then  be  visualtzed  on  a  UV  transilluminator.  Undigested  or  partially
digested  samples  have a charactertstic  streaky  appearance.  Add  a further  10 U  of
restriction  enzyme  to  any uncut  samples  and  remcubate  for  at least  2 h
The  2 I- Hydroxylase  Gene  129
5.  Once  the  samples  are completely  digested,  mix  each with  9 FL  of dH,O  and  9 ,ttL
of  5X  TBE  loading  buffer.  Load  the  whole  sample  onto  the  gel  using  a  fresh
micropipeter  tip  for  each  sample.  A  mol-wt  standard,  i.e.,  1-kb  ladder  (Life
Technologies),  should  also  be  loaded  in  one  of  the  outer  wells.  Set  the  gel  to
run  at  55  mA  in  constant  current  mode  for  at least  16 h.  You  will  need to  resolve
fragments  ranging  from  3.2-7.0  kb.
3.2.1.2.  SOUTHERN  BLOTTING
1.  When  the  gel  has  electrophoresed  the  correct  distance,  place  the  gel  on  a  UV
transilluminator.  Cut  off  the  mol-wt  marker,  the  wells,  and  any  waste agarose.
Remember  to  slice  off  a corner  of the  gel  to  allow  it  to  be oriented,  and  note  the
dimensions  of the  trimmed  gel.  Transfer  the  gel  mto  a plastic  tray,  and  submerge
m  denaturing  solution.  Denature  on  a slow orbital  shaker  for  1 h.
2.  While  the  gel  is  denaturing,  cut  a piece  of  charged  Nylon  membrane  and  two
pieces  of  Whatman  3MM  filter  paper  to  a size slightly  larger  than  the  gel.  Mark
or  cut  one  corner  of  the  membrane  to  correspond  to  the  cut  corner  of  the  gel.
Transfer  the  gel  onto  an inverted  gel  casting  tray,  and  carefully  place  the  nylon
membrane  onto  the  gel  avoiding  introducing  air  bubbles.  Briefly  wet the  sheets
of  filter  paper  in  denaturing  solution,  and  place  on  top  of  the  membrane.  Com-
plete  the  blot  by  adding  a stack  of  paper  towels  to  a  depth  of  approx  6  cm  and
compress  with  a suitable  weight  (approx  500  g).  Leave  to  blot  for  12-16  h  (see
Note  1).
3.  Dismantle  the  blot  and  discard  any  damp  paper  towels.  Place  the  membrane  into  a
tray containing  200 mL  of 3X  SSC, and shake gently  for 2 min,  pour  off the  3X  SSC,
and repeat twice.  The  filter  should  now be of neutral  pH,  and may  be probed  imme-
diately  or  sealed  in  plastic  while  still  damp  and  stored  at 4°C  almost  indefinitely.
3.2.1.3.  PROBE  LABELING AND  HYBRIDIZATION
1.  The  instructions  supplied  with  the  labeling  kit  need  to  be followed  with  care  for
successful  labeling.  Remember  you  will  be handling  dangerous  radioisotopes  and
need  to  use adequate  protection  in  the  form  of  perspex  shields.  Monitor  both  the
working  area  and  yourself  adequately  during  and  after  handling  radioisotopes.
Between  50  and  100  ng  of  probe  should  be  labeled  for  each  Southern  blot,  and
most  kits  recommend  that  2.5-5  @Ji  of  a32PdCTP  be used per  labeling  reaction,
For  this  analysis,  the  two  probes,  21A1.8  and  C4B550,  should  be  labeled  in
separate reactions,  Remember  that  single-stranded  DNA  is needed  as a template
for  the  labeling  reaction,  so you  must  denature  the  probe  by  heating  to  100°C
in  a dry  block  or  boiling  water  bath  before  adding  to  the  rest  of  the  reaction.
For  safety  reasons,  labeling  reactions  should  always  be  carried  out  in  screw-
capped  Eppendorfs.
2.  Make  up  200  mL  of prehybridization  solution  per  filter  by  diluting  down  the  2X
stock  to  1X  and  adding  SDS  to  a final  concentration  of 0.5%.  Before  use, remove
10  mL  of  this  solution  into  a  screw-capped  30-r&  plastic  tube,  and  add  0.6  g
PEG  6000  This  will  make  up  the  hybridization  buffer,  and  should  be  placed  at
65’C  during  the  period  of  prehybridization  to  dissolve  the  PEG  and  assist  in
130  Ramsden  and  Sinnott
degassing  the  solution,  Place  the  filters  in  a  sealable  plastic  box,  add  the
prehybridization  solution,  and seal  the  lid  tightly.  Place  in  an  oven  at 65°C  for  at
least  1 h to  prehybridize  (see Note  2)
3.  After  the  required  prehybridization  and  labeling,  the  hybridization  can be  set up
m  sealed  plastic  bags.  First  add  200  pL  of prehybridization  buffer  (without  SDS)
to  the  probes,  mix  them  together,  and  then  boil  them  for  5 min,  after  which  the
probe  mixture  should  be  placed  on  ice.  While  the  probes  are  being  boiled,  the
filter  should  be  placed  in  500-gage  plastic  and  double  sealed  on  three  sides
The  hybrrdizatton  buffer  is then  added  followed  by  the  denatured  probes  and  the
bag  sealed,  taking  care  to  exclude  bubbles.  The  filters  should  then  be  placed
between  two  glass  plates  and  Incubated  at 65°C  overnight  (Note  3).
3.2.1.4.  FILTER WASHING  AND AUTORADIOGRAPHY
1.  Prepare  1 L  of  a stringent  0.2X  SSC,  0  1%  SDS  wash  solution  and  1 L  of  a less
stringent  solution  (i.e.,  1X  SSC,  0.1%  SDS),  and  equilibrate  at 65’C.
2  Cut  the  sealed  plastic  containing  the  hybridizing  filter  open  with  a scalpel,  and
remove  the  filter  into  500  mL  of the  less stringent  wash in  a sealable  plastic  box
After  a few mmutes,  replace  thts  wash with  the  remaining  500  mL  and  place  at
65°C  for  30  mm  Finally,  replace  this  wash with  the  more  strmgent  wash,  and
leave  for  a further  30  min  at  65°C.
All  wash solutions  and the  hybridization  solutions  should  be disposed  of down
a  sink  designated  for  the  disposal  of  radroactive  waste.  The  plastic  and  glass
plates  should  be  washed  thoroughly  in  running  water  before  handlmg  and  dis-
posal  of  the  plastic.
3.  Remove  the  filter  after  the  first  stringent  wash with  a clean  pair  of  forceps,  and
place  on a clean  surface. Monitor  the  radioactivity  using  a Geiger  counter,  if  this
is  above  10 counts/s  (cps)  (with  the  plastic  shield  left  over  the  Geiger  detection
window),  wash m  fresh  solution  for  a further  30 min.  Repeat  this  final  wash until
the  activity  is  between  5  and  10  cps  or  until  no  drop  in  activity  is  observed
between  washes.
4.  Either  heat-seal  the  filter  m  250-gage  plastic  or  wrap  m  cling  film.  Place  with  a
sheet  of  X-ray  film  inside  an  autoradiograph  cassette  fitted  with  intensifying
screens m  a darkroom.
5.  Leave to expose at-70°C  for  1-5  d before  developing.  The  film  is usually  developed
after  an overnight  exposure  to Judge  the  length  of time  needed  for  a good  result.
6  Filters  can be  stripped  ready  for  reprobing  by  soaking  them  m  boiling  0  1% SDS
for  10 min  (see Note  4).
3.2.1.5.  INTERPRETATION OF RESULTS
The C4B gene exists in two forms, long (22 kb) and short (16 kb), the differ-
ence  being  the  result  of  the  presence  or  absence  of  a  6.8-kb  intron  at  the  5’  end
of the gene (23). As a result of this polymorphism, the 5’ end of the C4B gene
is  characterized  by  6.0-  or  5.4-kb  TuqI  fragments  corresponding  to  the  long
and short forms, respectively. The 5’ end of the C4A gene can be distinguished
The  21 -Hydroxyase  Gene  131
Fig.  4.  Key  to  characterizing  the  genomic  organization  around  the  2 1 -hydroxylase
gene  (CYP21)  using  Southern  analysis  as described  in  the  text.  A  TuqI (T)  digest  and
a mixed  probing  with  21A1.8  and  C4B550  reveal  an individual  with  no  deletions  and
heterozygous  for  the  5.4-  and  6.0-kb  C4B  alleles.  Note  the  C4B  signals  are  half  the
intensity  of  the  C4A  signal.
from  C4B  alleles  since it  lies on  a 7.0-kb  fragment  (20).  The  21B  gene lies
largely  on a 3.7-kb  Z’aqI fragment  and the 2 1A gene lies largely  on  a 3.2-kb
TaqI  fragment  by virtue  of  an additional  TaqI  site at its 5’ end (see Fig. 4).
A  2 lAl.8  and  C4B550  mixed  probe  hybridized  against  a  TaqI  genomic
digest will  usually  be sufficient  to elucidate the genomic  organization  around
this  locus.  By  comparing  band  intensities  within  gel  lanes, one can identify
deleted  and duplicated  genes. In  this system, the C4 alleles act as internal  lane
controls  for  interpreting  the dosage of  the 2 1A and B alleles (see Fig. 5).
In  a few  rare cases, the short-range  mapping  strategy described will  not be
sufficient  to elucidate  the genomic  organization  fully  around the 2 1 -hydroxy-
lase locus. When  this  situation  occurs, pulsed-field  gel electrophoresis  must
be used (24).
132  Ramsden  and  Sinnott
Fig.  5. (A,B)  (Caption  on page  134)
The  21 -Hydroxylase  Gene  733
C
E  kb
-3.7
I
-3.2
Fig.  5.  (C,D,E)  (Caption  on page  134)
Ramsden  and  Sinnott
3.2.2.  Detection  of  Point  Mutations
Only  a minority  of  gene conversion  events will  mvolve  the TuqI  sites diag-
nostic of  the 2 1B gene (see Fig.  SC). The  remainder  will  not be detected using
Southern analysis as described. As most pathogenic  mutations within  the 2 1 B
gene will  have derived  from  the 2 1 A pseudogene, we know  what  mutations  to
look  for.  However,  any mutation  detection method  must be able to distinguish
those mutant  sequences within  the 2 1 B gene from  the same sequences present
within  the pseudogene
Fig.  5.  (A)  A  severe  salt-wasting  female  has  2 1 -hydroxylase  defictency  by  virtue  of
being  homozygously  deleted  for  her 2 1B genes. Note  she has no signal  at 3.7 kb.  This  gene
would  only  normally  be  expected  to  be  deleted  as  a part  of  a larger  30-kb  deletion,  and
consistent  wtth  this,  we  see  no  C4B  alleles  either.  The  parents  are  both  carriers  of  this
deletion  as  evidenced  by  reduced  21B  and  C4B  band  mtensmes.  (B)  A  male  has  21-
hydroxylase  deficiency.  Allele  dosage  on Southern  analysis  reveals  2 1 B and C4B  alleles
of  reduced  intensity,  indicating  that  he  1s a carrier  of  a  B  unit  deletion,  which  he  has
inherited  from  his  mother.  The  father’s  short-range  mapping  results  show  a pattern  con-
sistent  wtth  no deletion,  and he 1s most  likely  to  carry  a point  mutation  within  one  of  hts
21B  genes.  (C)  This  family  has  three  deletions  segregating.  The  father  has  both  an  A
unit  and  a B  unit  deletion  He  therefore  has  a single  copy  of  each  of  the four  genes  m the
region,  and  as  expected,  all  four  bands  on  the  Southern  analysis  are  of  equal  mtenstty
Note  that  an A  unit  deletion  is  always  accompanied  by  a 6.4-kb  C4B  allele  (allele  1)
owmg  to the unique  TaqI  fragment  created  by  this  deletion  The mother  has an mtersttttal
deletion  (note  the relative  band intensities  21B:C4B:21A:C4A  [2-l  1:2]).  The affected  son
has  inhented  the 2 1B unit  deletion  and presumably  a point  mutation  from  hts  mother.  The
daughter  has  inherited  the 2 1 A  unit  deletion  (note  the C4B  1 allele).  (D)  Thts  demonstrates
some of  the nonpathogemc  variation  around  this  locus  m two  mdkduals,  neither  of whom
have  (or  are carriers  of)  the disease  The man’s  A  unit  deletion  1s mdtcated  by  the 6.4-kb
C4B  allele.  The  woman,  however,  carries  a triplication.  This  can  often  be  hard  to  spot,
especially  if  one cannot  observe  the chromosomes  segregating  through  at least  two  genera-
tions.  In  thts  case,  one must  use  the relattve  allele  dosages  21BaC4B:21A:C4A  (2.3.3:2).
(E)  In  all  the above  examples,  the variation  around  the 2 1 -hydroxylase  locus  has  resulted
from  unequal  recombmatron  as  discussed  m  Section  1.1.1,  Gene  conversion  events  that
mvolve  the  Tug1 sites  relevant  to  this  dtagnosttc  technique  also  will  be  identified.  This
figure  shows  the  results  from  an individual  who  appears  to  have an imbalance  of  2 1 B and
2 1 A  genes  without  an accompanying  imbalance  between  the C4B  and C4A  alleles  result-
ing from  gene conversion  In this  case, 2 1 A  sequence has been converted  into 2 1 B sequence,
and so this  would  not  be expected  to have pathogenic  consequences  (given  all other  things
being  equal,  there  will  still  be  two  functtonal  21B  genes).  This  mterpretatton  has  been
confirmed  m this  individual  by  observing  the segregation  of  the converted  2 1 -hydroxylase
gene.  Clearly,  the  reverse  sttuatton,  converston  of  21B  sequence  into  21A,  could  have
serious  implications
The  21 -Hydroxylase  Gene  135
Table  4
Common  Point  Mutations  in  the  2%Hydroxylase  Gene
Nucleotide
positiona
Position
gene
Sequence
change
Protein
change
Clinical
phenotype
659  Intron 2
1004  Exon 4
1688  Exon 7
2113  Exon 8
AorC+G  Splice mutatton  Salt wasting
ATC +  AAC  Ile  173 +  Asn  Simple virilizmg
GTG +  TTG  Va1282 +  Leu  Nonclassical
CGG +  TGG  Arg 357 +  Trp  Salt wasting
Wucleotlde  positions  have been taken  from  ref  10
Table  5
First-Round  ARMS-PCR  Amplification  of  the  21 B Gene
Region amplified
Primers
Final primer concentrations
Cycling conditions*
Number of cycles
Exons l-3,  fragment A
PI  + P48
0.5 pM
93°C  1 mm
54°C  1 min
72°C  1 mm
20
Exons 3-10, fragment I3
P4 + P55
0.5 pA4
93°C  1 mm
54”C, 1 min
72°C  1 mm
20
*Cyclmg  IS preceded by 93°C  for  3 mm and followed  by 72T  for  5 mm
A strategy has been described based on the use of  sequence-specific PCR or
ARMS  (10).  In  this technique,  a preamplification  step is employed  to amplify
specifically  the 2 1B sequence in  preference  to  the 2 1A. This  is achieved  by
designing  primers  to  amplify  only  in the absence of  an 8-bp  deletion  present
within  the 2 1A pseudogene. A second round  of ARMS  is then used to identify
mutations  using  the  amplified  21B  sequence as a  template.  The  following
describes a method  for  identifying  a number  of  the more  common  mutations
summarized  in Table  4.
3.2.2.1.  PROTOCOL  FOR DETECTION  OF POINT  MUTATIONS
1.  Amplify  the 2 1B gene in two halves using 20-yL  standard PCR reactions (see
Table 5 and Note 5).
2.  Dilute the reactions with 20 uL water and use 2 yL of product to seed the second
round of mutation-specific PCR.
3.  For the second round, prepare 20 yL PCR reactions to amplify a mutation-spe-
cific fragment as well as a larger control fragment. The two fragments share a
common primer. In this duplex reaction, working primer concentrations are 0.5 @14
for  the  common  primer  and  the  ARMS  primers  (specific  to  the  variant  you
wish to amplify), and 0.15 @4 for the control primer (see Note 5 and Table 6).
136  Ramsden  and  Sinnott
Table  6
Second-Round  ARMS-Mutation  Detection  in  the  21 B  Gene
Mutation  659  1004  1688  2113
Template fragment
(see Table 4)
Control primer
Common primer
ARMS primers
Cycling”
Number of cycles
Control fragment
size, bp
ARMS fragment
size, bp
A
P5  P19
P48  P55
P659A, P659C,  P 1004T
P659G  P1004A
93”C,  1 mm  93”C, 1 mm
60°C  1 min  54”C, 1 min
72°C  3 min  72“C, 3 min
30  30
423  1385
86
B
323
B
Pll
P55
P1688G
P1688T
93’C,  1 min
54V,  1 min
72’C, 3 min
30
2064
1005
B
Pll
P55
P2113C,
P2113T
93°C  1 min
54’C,  1 min
72”C,  3 mm
30
2064
1428
YZyclmg 1s followed by 72°C for 5 mm.
4.  Resolve the products of the second round of amplification on agarose gels (3%
for the 659 mutation and 1% for the others) and visualize using ethidium bromide
(see Table 6 and Fig  6).
3.3.  Quoting  Risks
For carrier  detection, mutation  analysis will  offer  a means of  modifying  the
prior  risk of  1 in  50. Accurate  estimates of frequencies  for  mutations within  the
21-hydroxylase  gene are not yet available.  However,  experience  has led us to
estimate that approximately  one-third  of  deficient  genes carry a gross deletion
detected by the short-range  mapping.
At  least 16 mutations  have been described within  the 21B  gene. Most have
derived  originally  from  the 21A  pseudogene. However,  novel  mutations  will
always be a possibility. Consequently, it will  not be feasible to screen exhaus-
tively  for  all  mutations  within  a service  environment.  We find  that by screen-
ing for  the common point mutations at positions 659, 1004, 1688, and 2113
(see Table  4)  in  addition  to  the  short-range  mapping  strategy described  for
identifying  deletions and gene conversion events, we are able to identify  the
majority  of  pathogenic  mutations  (Note  6).  In  a pilot  study  (unpublished
results),  this  system identified  a causative mutation  in  69 of  8 1 2 1 -hydroxy-
lase-deficient chromosomes.
The  2 1 -Hydroxyiase  Gene  137
Fig.  6. Genotyping  the  common  point  mutations  using  the  ARMS  technique.  Geno-
types  for  the mutations  are as follows  (left  to  right):  Splice  mutation  659  A/C+G,  AA,
CC,  GG,  CG.  Ile173+Asn  ATCIATC,  ATCIAAC,  AACIAAC.  Va1282+Leu
GTG/GTG,  GTG/TTG,  TTG/TTG.  All  these  genotypes  assume  that  a single  ARMS
product  signifies  homozygosity  and  not  hemizygosity.  This  would  have  to  be verified
using  the  short-range  mapping  strategy  described.
4.  Notes
1.  There  are almost  as many  variations  on Southern  analysis  methodologies  as there
are  labs  doing  the  technique.  Described  here  is  our  preferred  approach  to  the
technique.  It  is probably  the  simplest  we have  tried,  but  by  no  means  the  most
rapid.  Depurination  of gels to  nick  the DNA  is not  usually  necessary unless  one  is
looking  at  particularly  large  target  fragments  (>lO  kb),  and  by  using  charged
membrane  in  conjunction  with  an alkali  blot,  we avoid  the  need  for  crosslinking
of the  genomic  DNA  onto  the  filter.  We  find  that  with  capillary  blotting  there  is
generally  no need  to  set up  a reservoir.  The  “dry  blotting”  method  described  here
will  generally  suffice.  Clearly  much  more  rapid  blotting  procedures,  such  as
vacuum  blotting,  are  available  to  speed up  the  procedure.  Different  membranes
may  require  different  blotting  protocols.  For  best  results,  refer  to  the  manu-
facturer’s  instructions.
2.  The  prehybridization  and  hybridization  buffers  described  here  are  ideal  for  the
probes  outlined  in  this  chapter.  However,  they  are not  suitable  for  all  probes.  If
more  blocking  is  required,  alternative  buffers  are available  (see Chapter  3).
138  Ramsden  and  Sinnott
3.  Described  here  is  a  simple  (some  might  say  archaic)  method  of  setting  up  a
hybridization.  Nowadays  a  range  of  commercially  available  purpose-built
hybridization  ovens  are  available  to  simplify  the  procedure  and  minimize  radia-
tion  exposures.
4.  If  the  alkali  blotting  technique  is used  in  conjunction  with  a charged  membrane,
then  filters  must  not  be stripped  using  sodium  hydroxide  as often  recommended
for  nylon  filters.
5.  Standard  PCR  condrtions  will  usually  suffice.  However,  with  the products  being
so large,  conditions  may  need  to  be  optimized.  Particularly  we find  that  the  fol-
lowmg  20X  buffer  has given  the most  consistent  results-l.OMTris-HCl  (PH  9.0
at ZS’C),  400  mM  ammonium  sulfate,  30 mit4  MgC12.  This  buffer  has a relatively
low  magnesmm  chloride  concentratron,  and the concentration  of dNTPs  will  have
to be calculated  to  give  a free magnesium  concentration  of 0.7 mil4  (see Chapter  2).
Hot  start  (addmg  the  enzyme  after  the  nntial  denaturmg  step,  while  the  reaction
is  still  hot)  will  often  improve  the  quality  of results.
6.  If  two point  mutations  are identified  rn an affected  indivrdual,  one cannot  assume
that  they  are on  different  chromosomes  since  gene  conversion  can transfer  more
than  one mutation  as a single  event.  To  establish  phase,  their  independent  segre-
gatton  must  be  observed.
References
1.  Aston,  C. E.,  Sherman,  S. L.,  Morton,  N.  E.,  Spieser,  P. W.,  andNew,  M.  I.  (1988)
Genetic  mapping  of the  21-hydroxylase  locus:  estimation  of  small  recombination
frequencies.  Am.  J.  Hum.  Genet.  43,304-310.
2.  Pang,  S., Wallace,  M.  A.,  Hofman,  L.,  Thuline,  H.  C.,  Dorche,  C.,  Lyon,  I.  C.  T.,
et  al.  (1988)  Worldwide  experience  in  newborn  screening  for  classtcal  congenital
adrenal  hyperplasia  due  to  2 1 -hydroxylase  deficiency.  Paediatrics  81,  866-874.
3.  Spiezer,  P.  W.,  DuPont,  B.,  Rubenstein,  P.,  Piazza,  A.,  Kastelan,  A.,  andNew,
M.  I.  (1985)  High  frequency  of  non-classical  steroid  2 1-hydroxylase  deficiency
Am.  J.  Hum.  Genet.  37,650-667.
4.  Carroll,  M.  C.,  Campbell,  R.  D.,  and  Porter,  R.  R.  (1985)  Mapping  of  steroid
21-hydroxylase  genes  to  complement  component  C4  genes  in  HLA,  the  major
histoincompatability  locus  in  man.  Proc  Natl.  Acad  Sci.  USA  83,521-525.
5.  White,  P.  C., New,  M.  I.,  and DuPont,  B.  (1986)  Structure  of the human  21-hydroxy-
lase  genes. Proc.  Natl.  Acad.  SCL USA  83,5  III-5  115.
6.  Higashi,  Y.,  Yoshioka,  H.,  Yamane,  M.,  Gotoh,  O.,  and FuJii-Kuriyama,  Y.  (1986)
Complete  nucleotrde  sequence  of  two  steroid  21-hydroxylase  genes  tandemly
arranged  in  human  chromosome:  a pseudogene  and  a  genuine  gene.  Proc.  Nat1
Acad.  Sci.  USA  83,2841-2845.
7.  Morel,  Y.,  Andre,  J., Uring-Lambert,  B.,  Hauptman,  G.,  Betuel,  H.,  Tosi,  M.,  et al.
(1989)  Rearrangements  and  point  mutations  of  the  ~450~21  genes  are  distin-
guished  by  five  restriction  endonuclease  haplotypes  identified  by  a new  probing
strategy  in  57  families  with  congemtal  adrenal  hyperplasia  J  Clan  Invest  83,
527-536.
The 21-Hydroxylase  Gene  739
8.  Holliday,  R.  (1964)  A  mechanism  for  gene  conversion  in  fungi.  Genetic  Res.  5,
282-304.
9.  Udalova,  I.  A.,  Nedospasov,  S. A.,  Webb,  G.  C.,  Chaplin,  D.  D.,  and  Turetskaya,
R.  L.  (1993)  Highly  informatlve  typing  of  the  human  TNF  locus  using  SIX adJa-
cent  polymorphic  markers.  Genomxs  16,  180-l  86.
10.  Wedell,  A.  and Luthman,  H.  (1993)  Steroid  21-hydroxylase  deficiency:  two  addi-
tional  mutations  in  salt  wastmg  disease  and  rapid  screening  of  disease  causing
mutations.  Hum.  Mol.  Genel.  2,4499-4504.
11.  Sinnott,  P.  J.,  Dyer,  P.  A.,  Price,  D.  A.,  and  Strachan,  T.  (1989)  21-Hydroxylase
deficiency  patients  with  HLA  identical  affected  and  unaffected  siblings.  .J. Med.
Genet  26,  10-17.
12.  Schneldeer,  P.  M.,  Carroll,  M.  C.,  Alper,  C.  A.,  Rittner,  C.,  Whitehead,  A.  S.,
Yunis,  E.  J.,  and  Colten,  H.  R.  (1986)  Polymorphism  of  the  human  complement
C4  and  steroid  2 1-hydroxylase  genes.  J.  Chn.  Invest.  78,650-657.
13.  Partenan,  J , Koskimies,  S.,  Sipilia,  I.,  and  Lipsanen,  V.  (1989)  Major  histocom-
patibility-complex  gene  markers  and  restrictlon  fragment  analysis  of  steroid
2 1-hydroxylase  (CYP21)  and complement  C4  genes in  classical  congenital  adre-
nal  hyperplasia  patients  in  a single  population  Am  J  Hum  Genet  44,  660-670.
14.  Fleischnick,  E  , Awdeh,  Z.  L  , Raum,  D.,  Granados,  J.,  Alosco,  S. M.,  Crigler,
J.  R.,  Jr.,  et al.  (1983)  Extended  MHC  haplotypes  in  21-hydroxylase  deficiency
congenital  adrenal  hyperplasla:  shared  genotypes  m  unrelated  patients.  Lancet  I,
152-156.
15.  Holler,  W.,  Scholtz,  S., Knorr,  D.,  Bidlmgmaier,  F , Keller,  E.,  and  Ekkehard,  D.
A  (1985)  Genetic  differences  between  the  salt-wasting  simple  vlrilismg  and  non-
classical  types  of congenital  adrenal  hyperplasla.  J  Ch.  Endocrlnol  Metab.  60,
757-763.
16.  Pollack,  M.  S., Levine,  L.  S., and O’Neill,  G. L.  (198 1) HLA  linkage  and B 14, DR  1,
BfS  haplotype  association  with  the  genes  for  late  onset  and  cryptic  2 1 -hydroxy-
lase  deficiency.  Am.  J.  Hum.  Genet  33,540-550.
17.  Bidwell,  J. L.  and Jarrold,  E. A.  (1986)  HLA-DR  allogenotyping  using  exon  specific
cDNA  probes  and  application  of  minigel  methods.  Mol.  Immunol  23,  111 l-l  115.
18.  Dyer, P. A., Jawaheer, D., Ollier,  B., Poulton,  K.,  Sinnott,  P. J., and Thomson,  W.  (1993)
HLA  allele  detection  using  molecular  techniques.  Dzsease Markers  1,  145-160.
19.  Browning,  M.  J.,  Krausa,  P.,  Rowan,  A.,  Bicknell,  D.  C.,  Bodmer,  J.  G.,  and
Bodmer,  W.  F.  (1993)  Tissue  typing  the  HLA-A  locus  from  genomic  DNA  by
sequence  specific  PCR:  comparison  of  HLA  genotype  and  surface  expression  on
colorectal  tumour  lines.  Proc  Nat1  Acad  Sci.  USA  90,2842-2845.
20.  Olerup,  0.  and  Zetterquist,  H.  (1992)  HLA-DR  typing  by  PCR  amplification  with
sequence  specific  primers  (PCR-SSP)  in  2 hours:  an alternative  to  serological  DR
typing  m  clinical  practice  including  donor  recipient  matching  in  cadaverrc  trans-
plantation.  Tissue Antigens  39,225-235.
21.  Bunce,  M.  and Welsh,  K  I.  (1994)  Rapid  DNA  typing  for  HLA-C  using  sequence-
specific  primers  (PCR-SSP):  identification  of  serological  and  non-serologically
defined  HLA-C  alleles  including  several  new  alleles.  Tzssue Antzgens  43,7-17.
140  Ramsden  and  Sinnott
22.  Morel,  Y.  and  Miller,  W.  L.  (1991)  Clinical  and  molecular  genetics  of congenital
adrenal  hyperplasia  due  to  21-hydroxylase  deficiency,  in  Advances  in  Human
Genetics,  vol.  20  (Harris,  H.  and Hirschorn,  K.,  eds.), Plenum,  New  York,  pp.  1-88.
23.  Yu,  Y.  C.,  Belt,  K.  T.,  Giles,  C.  M.,  Campbell,  R.  D.,  and  Porter,  R.  R.  (1986)
Structural  basis  of the polymorphism  of the  human  complement  components  C4A
and  C4B:  gene  size,  reactivity  and  antigenicity  EMBO  J.  5,2873-288  1.
24.  Collier,  S.,  Sinnott,  P.  J.,  Dyer,  P.  A.,  Price,  D  A.,  Harris,  R.,  and  Strachan,  T.
(1989)  Pulsed  field  gel  electrophoresis  Identifies  a high  degree  of  variability  m
the number  of tandem  2 1 -hydroxylase  and complement  C4 repeats  in  2 1 -hydroxy-
lase  deficiency  haplotypes.  EMBO  J.  8,  1393-1402.
7
Molecular  Analysis  of  X-Chromosome  Inactivation
David  0.  Robinson  and  John  F. Harvey
1. Introduction
Analysis  of  X-chromosome  inactivation  patterns can be a useful  tool  in the
identification  of  carriers  of  certain  X-linked  diseases and  also  for  other
investigations,  such as gene mapping  and clonality  analysis. X  inactivation  is
the process in  females  whereby  one  of  the  two  X  chromosomes  of  a cell  is
maintained  in  an inactive  state with  most  genes remaining  untranscribed.  It
occurs early  in embryogenesis at the late blastocyst stage and normally  is ran-
dom  such that for  each cell there  is an equal  chance of  either  X  chromosome
being  inactive.  Once a cell has undergone  X  inactivation,  all  cells originating
from  it maintain  the same chromosome inactive  throughout  life.  Adult  tissues
therefore  are normally  a mosaic of  groups  of  cells with  the same X  chromo-
some inactive.
1.1.  The  Applications  of  X-Inactivation  Analysis
1.1.1.  Female  Carriers  of X-Linked  Diseases
Sometimes it is difficult  to determine  by direct  mutation  analysis the carrier
status of  asymptomatic female  relatives  of  individuals  with  X-linked  diseases
because of the presence of  the normal  X.  However,  in certain cases X  inactiva-
tion  status can be used as an indicator  of carrier  status. In  females where  one X
chromosome  carries  a mutation  that is incompatible  with  cell  viability,  only
those cells with  the mutation  on the inactive  X  survive,  thus generating  a uni-
lateral  pattern  of  X  inactivation  (see Notes  1 and 2).  Examples of  this  include
carriers  of  Bruton-type  agammaglobulinemia  (I),  Wiskott-Aldrich  syndrome
(2),  X-linked  severe combined  immunodeficiency  (3),  and X-linked  immuno-
deficiency  with  hyper IgM  (4) (see Note 3). In some cases non-random  X  inac-
tivation  is restricted  to certain  cell lineages (see Note  4).
From  Methods  in  Molecular  Medme  Molecular  Diagnosis  of  Genebc  Diseases
Edlted  by  R  Elles  Humana  Press  Inc  , Totowa,  NJ
141
142  Robinson  and  Harvey
1.1.2.  Females  with  Symptoms  of  X-Linked  Diseases
X-linked  diseases, which  are  normally  recessive,  occasionally  manifest
themselves  in  females,  for  example,  Duchenne  muscular  dystrophy  (5),
adrenoleucodystrophy  (61, and X-linked  retinitis  pigmentosa (7). This  is some-
times caused by non-random  X  inactivation,  but there are other possible causes
including  X-chromosome  monosomy  with  the  single  X  carrying  a mutation,
homozygosity  for  a mutation,  an X-autosome  translocation,  or the presence of
an autosomal  phenocopy.  X-inactivation  analysis therefore  can be  of  use in
identifying  the causative mechanism of disease and thus facilitate  risk calcula-
tion  for  other  family  members.  In  the  case of  X-lmked  retinitis  pigmentosa
type 2, X-inactivation  analysis also can be of  prognostic  value,  those females
with  a less severe skew in X  inactivation  developing  less severe symptoms (8).
1.1.3.  The  Mapping  of  Diseases  to the  X  Chromosome
Some X-linked  diseases, such as agammaglobulmemia  and  focal  dermal
hypoplasia,  have  or  may  have  autosomal  phenocopies.  In  sporadic  cases of
these diseases the X-inactivation  status of  female  relatives  has been used to
determine  the mode of  inheritance  of the disease (9, IO), thus facilitating  recur-
rence risk and carrier  risk  calculations within  the pedigree.
I.  1.4.  Carriers  of  Structural  Abnormalities  of  the  X  Chromosome
In  pedigrees  in which  a structural  abnormality  of  the X  chromosome,  such
as a partial  deletion  or  an  mversion,  is segregating,  molecular  analysis of  X
inactivation  can be used to identify  asymptomatic  female  carriers  (11).  Carri-
ers usually  exhibit  nonrandom  X  inactivation  such that the normal  X  is exclu-
sively  active.  A  random  pattern  of  X  inactivation  can  be  the  cause of  an
abnormal  phenotype  (12).
1.7.5.  Females  with  Small  Ring  X  Chromosomes
In  some cases of  females with  a 46,Xr(X)  karyotype  the severity  of the phe-
notype is thought to be influenced  by the inactivation  status of the marker chro-
mosome. In  those cases where  not only  the normal  chromosome  but  also the
marker  chromosome  is active,  the phenotype  is more  severe because of  func-
tional  disomy  for  genes on  the marker  (13).  If  the marker  chromosome  con-
tains  a  site  amenable  to  molecular  analysis,  then  X  inactivation  can  be
ascertained without  the need for  cell  culture  and late replication  analysis.
1.1.6.  The  Origin  of  X-Autosome  Translocations
Females  with  balanced  X-autosome  translocations  exhibit  nonrandom  X
inactivation  such that  the derived  X  is exclusively  active.  In  cases where  the
X-Chromosome  Inactivation  143
translocation  has arisen de nova,  X-inactivation  studies using molecular  probes
have superseded more lengthy procedures in determining  the parental  origin  of
the aberration  (14).
1.1.7.  C/on&y  in  Tumor  Cell  Lines
X-inactivation  analysis has been used as an indicator  of  clonal  composition
in  lymphoproliferative  diseases and  other  human  cancers in  order  to  study
tumor  progression  and evolution  (15,16).
1.2.  Strategies  for  Molecular  Analysis  of  X  Inactivation
X  inactivation  is associated with  the methylation  of  specific  CpG  sites on
the  X  chromosome.  The  majority  of  such sites found  so far  are  associated
with  genes, and usually  the  inactive  X  is methylated.  However,  there  are  at
least two  sites, M27P  (17)  and DX74  (18),  at which  the reverse  is the case
with  the active  X  being  methylated.  A number  of  methylation  sites have  been
found  that  are  close to  DNA  polymorphisms  and can be used to  determine
X-inactivation  patterns in  informative  females (17,19-23).  Two  strategies are
available,  one using Southern blotting  and the other using the polymerase chain
reaction  (PCR).
1.2.1.  The  Use  of  Methylationdensitive  Restriction  Enzymes
and  Southern  Blotting
This  approach  uses DNA  probes to analyze polymorphic  sites that are dif-
ferentially  methylated  on  active  and  inactive  X  chromosomes. The  example
used here  is the probe  M27P  which  recognizes a VNTR  polymorphism  (too
large  for  routine  PCR  amplification)  in  Xpll.22  and which  is informative  in
90% of  females  (24). The  internal  cytosine residue of  a CCGG  sequence lying
5’ to the VNTR  is methylated  on all  active  X  chromosomes and unmethylated
only  on inactive  X  chromosomes, although  in blood  cells a variable  proportion
of  inactive  X  chromosomes are methylated  at this site (2.5). Methylation  status
can be determined  by Southern blotting  using the restriction  enzyme H&II  and
its isoschizomer MspI  (as a control)  that recognize the sequence CCGG.  MspI
cleaves  this  sequence whether  or  not  it  is methylated,  whereas  HpaII  only
cleaves CCGG  sites that are unmethylated  on the internal  cytosine. A compari-
son is made of  the  Southern blot  banding  patterns of  a DNA  sample cleaved
with  MspI  and independently  cleaved with  HpaII.  All  samples are also cleaved
simultaneously  with  AvuII  in  order  to  separate a variably  methylated  CCGG
site lying  3’ to the VNTR  from  the VNTR  and its associated 5’ CCGG  sequence
(25)  (see Note  5). This  also generates fragments  of  a size resolvable  by  stan-
dard agarose gel electrophoresis. After  hybridization  with  the probe M27P,  the
MspI  track  will  show two  allelic  bands in  informative  females. In  the HpaII
144  Robinson  and  Harvey
track, inactive  X  chromosomes that are unmethylated  will  be represented by a
band of  the same size as that in the MspI  digest. Bands larger  than those in the
MspI  track will  represent active (methylated) X  chromosomes and also, in DNA
extracted from  blood,  a proportion  of  inactive  X  chromosomes that are methy-
lated  at this  site. (This  proportion  differs  from  female  to female  and ranges
from  040%  [25].)
In  cases with  random X  inactivation  the HpaII  track will  contain both bands
present  m  the  A4spI track  and  also  their  larger  methylated  counterparts.
However,  in  the  case of  unilateral  X  inactivation  when  the  CCGG  site  is
unmethylated  exclusively  on one allele, then only  one of the two bands present
in  the  it@1  track  will  be  present  in  the  HpaII  track.  This  fragment  is that
derived  from  the exclusively  inactive  X  chromosome. Similar  analysis can also
be carried  out using other probes such as phosphoglycerate  kinase (PGK)  (19)
and  hypoxanthine-guanine  phosphoribosyltransferase  (HPRT)  (205  but  they
are considerably  less polymorphic  than M27P  (see Note  6).
1.2.2.  PCR  Amplification  of  DNA
Cleaved  with  Methylation-Sensitive  Restriction  Enzymes
This  technique  relies  on the availability  of  PCR primers  that can amplify  a
length of  DNA  containing  both a repeat sequence polymorphism  and a site that
is differentially  methylated  on  active  and  inactive  X  chromosomes.  A  com-
parison  is made of  the PCR amplification  products of  DNA  with  and without
prior  cleavage  with  a methylation-sensitive  restriction  enzyme, such as HpaII
or HhaI,  which  only  cleaves its recognition  site if  it is unmethylated.  Females
with  unilateral  X  inactivation  who  are informative  for  the polymorphism  will
show two  allelic  PCR bands when the DNA  sample is undigested prior  to PCR,
but  only  one band when  the sample is digested prior  to PCR.
In this chapter primers  that bracket the polymorphic  repeat sequence within
the human androgen receptor  gene (HUMAR)  are described (22,26).  They  also
amplify  a CCGG  site that is methylated  only  on  inactive  X  chromosomes.  If
DNA  from  a female  with  unilateral  X  inactivation  is digested with  HpaII,  then
the unmethylated  CCGG  site on the active X  will  be cleaved, thus amplification
of  only  the allele  on the inactive  X  is possible.  Subsequent PCR amplification
products  (approx  280 bases long depending  on the size of  the repeat sequence)
are compared with  the two bands produced  from  undigested DNA.  A polymor-
phism  within  the monoamine  oxidase A  (MAOA)  gene can be employed  in  a
similar  fashion  (21).  Such PCR  methods  are  more  rapid  than  blotting  and
require  much  less  DNA,  however,  not  all  females  are  informative.  The
HUMAR  polymorphism  is heterozygous  m 90%  (22)  and the  MAOA  poly-
morphism  in  75% (27)  of  females (see Note  6).
X-Chromosome  inactivation  145
2. Materials
2.1.  X-Inactivation  Analysis
Using  M27p  and  Southern  Blotting
1.  Sample  DNA.
2.  Restriction  enzymes  H’aII,  AvaII,  and A4spI at  10 U/uL.
3.  10X  Concentrated  restriction  enzyme  buffer:  10  mil4  Tris-HCl,  10 mM  magne-
sium  chloride  and  1 wdithiothreitol  (DTT),  pH  7.5.
4.  Incubator  or water  bath  at  37’C.
5.  Gel  loading  buffer  consisting  of  40%  sucrose,  0.25%  bromophenol  blue,
and  1 mMEDTA
6.  M27P  probe  (ATCC  cat no.  61516161517).
7.  0.25M  HCl  solution.
8.  Denaturing  solution:  0.5M  sodium  hydroxide,  1M  sodium  chloride.
9.  Neutralizing  solution:  1M  Tris-HCl,  1.5M  sodium  chloride,  pH  8.0.
10.  Horizontal  gel  electrophoresis  apparatus  with  20  x  20  cm  gel  formers,  combs,
and  3000-V  power  supply.
11.  Agarose
12.  5 mg/mL  Ethidium  bromide  solution.
13.  W  transilluminator,  W  protective  visor,  and  goggles  (Ultra-Violet  Products  Inc.,
San Gabriel,  CA).
14.  CU-5  Polaroid  camera  and  hood  with  Kodak  Wratten  22A  or 23A  red  filter  and
black  and  white  667  Polaroid  film.
15.  Blotting  membrane,  e.g., Zeta-Probe  GT  (Bio-Rad  Labs, Ltd.,  Hemel  Hempstead,  UK).
16.  Oven  at  8O’C.
17.  25  x 35-mm  Plastic  “radiation  bags” (Jencons Scientific  Ltd.,  Leighton  Buzzard,  UK).
18.  Bag  sealer.
19.  Trays  for  gel  and  filter  washings.
20.  Prehybridization  and hybridization  buffer:  7%  SDS,  0.25MNa2HP04,  pH  7.2.
2 1.  Shaking  water bath  or  incubator.
22.  Redivue  [a32P]dCTP  at 3000 CYmmol  (Amersham Intemational,  Amersham,  UK).
23.  DNA  labeling  kit,  e.g.,  “High  Prime”  (Boehringer  Mannheim,  Lewes, UK).
24.  Wash  buffer  1: 20  mMNa2HP04,  pH  7.2,  5%  SDS.
25.  Wash  buffer  2:  20  mMNa,HP04,  pH  7 2,  1% SDS.
26.  Sephadex  G50-150  equilibrated  in  10 mMTris-HCl,  1 mMEDTA,  pH  7.5  (TE),
and  a 0.7  x  20-cm  glass  column.
27.  Autoradiography  cassettes,  intensifying  screens,  and  X-ray  film  (e.g.,  Kodak
Xomat  AR5).
2.2.  X-Inactivation  Analysis
Using  the  HUMAR  Primers  and  PCR
1.  Sample  DNA.
2.  10 U/uL  HpaII  restriction  enzyme.
3,  10X  HpaII  buffer:  10  mM  Tris-HCl,  10  mM  magnesium  chloride,  and  1 mM
DTT,  pH  7.5.
146  Robinson  and  Harvey
4.  Water  bath  or  incubator  at 37’C.
5.  PCR  primers  as follows  (26):  HUMAR  Primer  1 5’ GCTGTGAAGGTTGCTGTT-
CCTCAT  3’ and HUMAR  Primer  2 5’ TCCAGAATCTGTTCCAGAGCGTGC  3’.
6.  T4  Polynucleotide  kinase  (PNK)  at  10 U&L.
7.  10X  PNK  buffer:  330 mMTris-acetate  pH  7.8,660  mMpotassium  acetate,  100 mM
magnesium  acetate,  and  5 mM  DTT.
8.  y32P[dATP]  at 3000  Cl/mm01  (Amersham  International).
9.  5 U/pL  Tag  polymerase.
10.  10X  concentrated  PCR  buffer:  100  mM  Tris-HCl  and  500  mMpotassium  chlo-
nde,  pH  8.3.
11.  25  mM  magnesium  chloride  solution.
12.  100 mM  solutions  of dATP,  dGTP,  dCTP,  and dTTP.
13.  Mineral  oil  for  PCR.
14.  Gel  loading  buffer:  45%  formamide,  20  mM  EDTA,  0.05%  bromophenol  blue,
and  0.05%  xylene  cyanol.
15.  Vertical  “sequencing”  gel  electrophorests  apparatus  with  3000-V  power  supply.
16  Thermal  cycler  and thin-walled  PCR  reaction  tubes
17  Electrophoresis  buffer  (1X  TBE):  10.8  g Tris  base,  5 5  g  boric  acid,  and  4  mL
0.5MEDTA,  pH  8.0,  in  1 L  distilled  water.
18.  6%  (w/v)  acrylamide/bisacrylamide  (19: l),  7Murea  in  1X  TBE  (Severn  Biotech
Ltd.,  Kidderminster,  UK).
19.  N,N,N’,N’,-Tetramethylene-ethylenediamine  (TEMED).
20.  Ammonium  persulfate:  1% aqueous  solution  (store  at -20°C  in  1-mL  aliquots).
2 1.  Autoradiography  cassettes with  intensifying  screens.
22.  X-ray  film  (e.g.,  Kodak  X-Omat  AR5).
3.  Methods
3.1.  X-Inactivation  Analysis
Using  M27p  and  Southern  Blotting
1.  For  restriction  enzyme  digesttons,  prepare  three  tubes  each  containing  6  pL  of
10X  restriction  enzyme  buffer  and  10 ug  of  sample  DNA  and  make  up  to  a vol-
ume  of  58  yL  with  distilled  water.
2.  To  each tube  add  1 pL  (10  U)  of AvaII.
3.  To  tube  2 add  1 pL  (10  U)  ofMsp1.
4.  To  tube  3 add  1 uL  (10  U)  of  HpaII.
5.  Incubate  for  16 h  at 37’C.
6.  For  gel  electrophoresis  add  12 pL  of  loading  buffer  to  each tube  and  load  all  the
sample  on to  a 0.8%  20  x 20  x  1 cm  horizontal  agarose gel  m  1X  TBE  containing
5  pg/mL  ethidium  bromide.
7.  Run  at  50  mA  for  40  h.
8.  Visualize  the  DNA  m  the gel  by transilluminating  with  long  wavelength  UV  light
(302  nm)  to  ensure  that  the  DNA  is fully  digested  and has run  evenly.  Record  by
photographing
X-Chromosome  inactivation  147
9.  Immerse  the  gel  in  500  mL  of  0.25MHCl  at  room  temperature  for  25  min  with
gentle  shaking.
10.  Pour  off  the  HCI  solution,  rinse  in  denaturing  solution,  and  gently  shake  the  gel
in  500  mL  of denaturing  solution  for  70  min  at room  temperature.
11.  Pour  off  the  denaturing  solution,  rinse  in  neutralizing  solution,  and  gently  shake
the  gel  in  500  mL  of neutralizing  solution  for  70 min  at room  temperature.
12.  Transfer  the  DNA  from  the  gel  onto  a blotting  membrane  (e.g.,  Zeta-Probe  GT)
using  the  standard  Southern  blotting  capillary  transfer  procedure.  (For  details  of
Southern  blotting  procedure,  see, for  example,  Chapter  12,  Section  3.4.).
13.  Label  50  ng  of  M27P  probe  with  50  pCi  of  [a3*P]dCTP  [3000  Ci/mmol]  using
the  labeling  kit  according  to  the  manufacturer’s  instructions.  After  a  30-min
incubation  at  37°C  run  the  labeled  probe  through  a column  of  approx  12 cm  of
Sephadex  G50-150  in  TE  to  remove  free  nucleotides.  Monitor  the  separation
of  free  nucleotides  from  labeled  probe  on  the  column  with  a hand-held  Geiger
counter.  Collect  the  labeled  probe  peak  (the  first  peak  of  activity  to  come  off
the  column)  in  a screwcap  Eppendorf  tube  held  with  a pair  of  forceps.  Replace
the  tube  cap,  denature  the  probe  in  a boiling  water  bath  for  10  min,  and  cool
rapidly  on  ice.
14.  Prehybrtdize  the  blotted  membrane  in  a plastic  “radiation”  bag  for  5-30  mm  with
20  mL  of  hybridization  buffer  at  65’C.  Add  the  labeled  probe,  seal the  bag,  and
incubate  overnight  with  gentle  shaking  at 65°C.  Wash  the  membrane  at 65°C  for
2  x 30  min  m  wash buffer  1, and  2 x 30  min  m  wash buffer  2. Enclose  the  filter  m
clear  plastic  wrap  and  expose  to  X-ray  film  at  -8O’C  overnight,  or  longer
depending  on the  efficiency  of the  hybridization,  and  develop.
15.  Banding  patterns  are shown in  Fig.  1 (see Note  7).
3.2.  X-Inactivation  Analysis
Using  the  HUMAR  Primers  and  PCR
1.  For  restriction  enzyme  digestion  prepare  two  tubes  for  each  DNA  sample  con-
taining  1 p.g of DNA  in  20  pL  of  1X  HpaII  buffer.
2.  Add  1 pL  (10  U)  HpaII  to  tube  1 (tube  2  serves as the  undigested  control).
3.  Incubate  at 37°C  for  16 h.
4.  To  end  label  add  7  pL  of  500  pg/mL  primer  1 (enough  for  10 reactions)  to  2  pL
10X  T4PNK  buffer,  1 pL  T4PNK  (10  U),  9 PL  H20,  and  1 PL  y*P[dATP]  3000
Ci/mmol  (see Note  8).
5.  Incubate  at  37OC for  30  min.
6.  Place  on  ice.
7.  For  10 reactions  prepare  a mix  containing  501  pL  of  10X  PCR  buffer,  30  pL
25  mM  MgC12,  7 pL  unlabeled  HUMAR  primer  2 at  500  pg/mL,  1.2  pL  of  each
dNTP  at  100 miV,  387  pL  H20,  and  1 pL  (5 U)  of  Tuq  polymerase.  Keep  on  ice.
8.  Pipet  2  pL  of each DNA  sample  (HpaII  digested  or undigested  control  DNA)  and
3  pL  H20  into  a PCR  tube  and  add  1 drop  of  mineral  oil.
9.  Place  the  tubes  in  the  thermal  cycler  and  incubate  for  6 min  at  96°C  to  denature
the  DNA  prior  to  PCR  and  to  inactivate  the  restriction  enzyme.
148  Robinson  and  Harvey
1A  1M  1H  2A  2M  2H
Fig.  1.  Autoradiograph  of  Southern  blot  analysis  of  X-inactivation  status  using
M27P.  Tracks  lA,  lM,  1H  represent  an  individual  with  random  X  inactivation  and
tracks  2A,  2M,  and  2H  represent  an  individual  with  unilateral  X  inactivation.  Tracks
A:  DNA  digested  with  AvuII  only.  Tracks  M:  DNA  digested  with  AvaII  and  MS@.
Tracks  H:  DNA  digested  with  AvuII  and HpaII.
10.  Add  the  20  uL  of labeled  HUMAR  primer  1 to the  PCR  mix  on ice  and  add 45  uL
of  this  to  the  denatured  DNA  in  the  thermocycler.
11.  Cycle  at 96°C  for  1 min,  60°C  for  1 min,  and  72°C  for 2 min  for  25 cycles,  with
a final  elongation  time  of  7 min  at 72°C.
12.  Add  an  equal  volume  of  formamide  loading  buffer,  heat  at  100°C  for  5 min,  and
place  on  ice.
13.  Load  5  uL  onto  a 6%  PAGE/urea  sequencing  gel  and  run  at  100 W  for  3-4  h.
14.  Expose  to  phosphoimaging  screen  or  X-ray  film  for  2-24  h,  depending  on  the
efficiency  of  the  labeling.
15.  Banding  patterns  are shown  in  Fig.  2.
4.  Notes
1.  A  proportion  of  apparently  normal  females  with  no  family  history  of  X-linked
disease  have  a unilateral  or  a severely  skewed  pattern  of  X  inactivation,  either
owing  to  an unidentified  rare  mutation  on  the  X  chromosome  or to  chance  varia-
tion.  Also,  the  X-inactivation  pattern  can vary  in  different  tissues  (27).  The  pro-
portion  of normal  females  with  severely  skewed X  inactivation  has been  variously
estimated  as 4  (2.5), 7  (28),  and  9.5%  (29).  This  can  lead  to  the  misinterpretation
of X-inactivation  data.  Also,  the  results  of biochemical  tests for  carrier  status can
be  influenced  by  X  inactivation,  for  example,  in  pyruvate  dehydrogenase  de&
ciency  (30)  and Lesch-Nyhan  syndrome  (31).  Therefore  it  is prudent  to  determine
the  X-inactivation  status  of  samples  used  for  such assays.
X-Chromosome  Inactivation  149
IA  16  214  28
Fig.  2.  Phosphoimage  of  PCR  analysis  of  X-inactivation  status using  the  HUMAR
primers.  Tracks  1A and  1B represent an individual  with  random  X  inactivation  and tracks
2A  and  2B  represent  an individual  with  unilateral  X  inactivation.  Tracks  A:  PCR  with-
out  predigestion  of DNA  with  HpaII.  Tracks  B:  PCR  after digestion  of DNA  with  HpaII.
2.  In  chorionic  villus  biopsies  the  level  of  skewing  of X  inactivation  may  be  fairly
high  in  normal  individuals  and  is potentially  misleading  (30).
3.  Some  mothers  of  isolated  cases of  disease may  be mosaic  carriers  of  a mutation
and,  although  still  at  risk  of  having  a  second  affected  child,  may  not  exhibit  a
unilateral  pattern  of  X  inactivation  in  the  cells  available  for  testing.
4.  The  tissue  of origin  of the  cells  analyzed  can be  important  for  the  ascertainment
of  carrier  status.  Carriers  of  some  diseases exhibit  a unilateral  pattern  of  X  inac-
tivation  only  in  one  or  a limited  number  of  cell  types.  For  Wiskott-Aldrich  syn-
drome,  DNA  from  whole  blood  lymphocytes  is sufficient  to  identify  nonrandom
X  inactivation  in  female  carriers,  however,  in X-linked  agammaglobulinemia  only
B-lymphocytes  manifest  unilateral  X  inactivation  in  carriers  and must  first  be  iso-
lated  to  the  appropriate  level  of purity  (95%)  (32)  before  analysis.  X-linked  severe
combined  immunodeticiency  carriers have unilateral  X  inactivation  in T-  and B-lym-
phocytes,  but  not  in  monocytes  and  neutrophils  (3,33).  Carriers  of  X-linked
immunodeticiency  with  hyper  IgM  exhibit  nonrandom  X  inactivation  in  T-cells,
B-cells,  and  neutrophils,  but  not  in  fibroblasts  (4). In  all  such cases, cells  in  which
X  inactivation  is unaffected  by the  disease  also  should  be  analyzed  to  ensure  that
the  X-inactivation  pattern  is  not  skewed  for  reasons other  than  carrier  status.
5.  For  M27P  analysis,  PstI  can  be used  in  place  of AvaII.  We  use AvaII  because  it
functions  optimally  in  the  same buffer  as HpaII  and MspI,  whereas &I  requires
a higher  salt  concentration.  Both  AvuII  and  PstI  serve to  exclude  another  HpuII
site  on  the  3’  side  of  the  VNTR  that  does  not  correlate  well  with  X-inactivation
150  Robinson  and  Harvey
status.  Some  of the  earlier  publications  on  this  method  describe  the use of restric-
tion  enzymes  that  do  not  exclude  the  3’  site  and  give  a  less  clear  picture  of
X-inactivation  status.
6.  Although  PCR-based  analysis  of X  inactivation  is more  rapid  than  blotting,  there
are cases where  Southern  blotting  1s stall the  method  of  choice.  For  example,  the
M27P  locus  1s closely  linked  to  the  gene  responsible  for  Wtscott-Aldrich  syn-
drome  and  female  carriers  of the  mutation  exhibit  nonrandom  X  mactivation  (21,
therefore,  both  lmkage  and X-mactlvation  analysis  can be performed  at the  same
time.  Also  a small  proportion  of females  are uninformative  for the  available  PCR-
based polymorphisms  and it  is then  necessary to try  M27P  and  Southern  blotting.
7.  Occasionally  the  difference  in  size between  the  two  M27P  alleles  is  the  same  as
that  between  the  methylated  and  unmethylated  bands  such that  the  lower  methy-
lated  band  is the same  size as the upper  unmethylated  band.  This  can be mlsmter-
preted  as unilateral  X  inactivation.  In  such  cases X-mactivatlon  analysts  should
be repeated  using  another  methylation  ate.
8.  When  using  the  HUMAR  PCR  method  in  principle  either  primer  can  be  end
labeled,  however,  in  our  laboratory  we get  better  results  labeling  primer  1. It  is
also  possible  to  visualize  PCR  products,  without  radiolabeling,  by  staining  with
ethidium  bromide,  although  more  than  25  rounds  of  thermocycling  are  neces-
sary.  Radiolabeling  and  restricting  the  cycle  number  to  within  the  linear  range
facilitates  a more  accurate  determination  of  the  degree  of bias  of  X  inactivation
by  measuring  the  relative  band  intensities  using  densitometry  or a phospholmager
References
1.  Fearon,  E.  R.,  Wmkelstem,  J. A.,  Civm,  C.  I.,  Pardoll,  D.  M.,  and  Vogelstein,  B.
(1987)  Carrier  detection  in  X-linked  agammaglobulmaemta  by analysis  of  X  chro-
mosome  inactivation.  N.  Engl.  J.  Med.  316,427-431.
2.  Fearon,  E.  R.,  Kohn,  D.  B.,  Wmkelstein,  J.  A.,  Vogelstem,  B.,  and  Blaese,  R.
M.  (1988)  Carrier  detection  in  the  Wiskott-Aldrich  syndrome.  Blood  72,
1735-1739.
3.  Puck,  J. M.,  Nussbaum,  R.,  and Conley,  M.  E. (1987)  Carrier  detection  m  X-linked
severe combined  immunodeficiency  based  on  patterns  of  X  chromosome  inacti-
vation.  J  Clm.  Invest.  79,  1395-1400.
4.  Notarangelo,  L.  D.,  Parolini,  O.,  Albertini,  A.,  Duse,  M.,  Mazolari,  E.,  Plebani,
A.,  et al.  (1991)  Analysis  of X-chromosome  inactivation  in  X-linked  immunode-
ficiency  with  hyper-IgM  (HIGMl):  evidence  for  the  involvement  of  different
hematopoietic  cell  lineages.  Hum.  Genet.  88,  130-l  34.
5.  Moser,  H.  and Emery,  A.  E.  H.  (1974)  The  manifesting  carrier  in  Duchenne  mus-
cular  dystrophy.  Clm  Genet  5,271-284.
6.  Moser,  A.  B.,  Naidu,  S.,  Kumar,  A.  J.,  and  Rosenbaum,  A.  E.  (1987).  The
adrenoleucodystrophies.  CRC  Clan  Rev  Neurobzol  3,29-88.
7.  Warburg,  M.  (1971)  Random  inacttvities  of  the  X  chromosome  m  intermediate
X-linked  retinitis  pigmentosa.  Two  hypotheses.  Trans.  Ophthalmol.  Sot.  UK  91,
553-560.
X-Chromosome  Inactivation  151
8.  Friedrich,  U.,  Warburg,  M.,  and Jorgensen,  A.  L.  (1993)  X-mactivation  pattern  in
carriers  of  X-linked  retinisis  pigmentosa:  a valuable  means  of prognostic  evalua-
tion?  Hum  Genet.  92,359-363.
9.  Tsuge,  I.,  Matsuoka,  H.,  Abe,  T.,  Kamachi,  Y.,  and Torii,  S. (1993)  X  chromosome
inactivation  analysis  to  distinguish  sporadic  cases of  X-linked  agammaglobulin-
aemia  from  common  variable  immunodeflciency.  Eur.  J. Pediut.  152(11),  900-904.
10.  Gorski,  J.  L.  (1991)  Father-to-daughter  transmission  of  focal  dermal  hypoplasia
associated  with  non-random  X  inactivation:  support  for  X-linked  inheritance  and
paternal  X  chromosome  mosaicism.  Am.  J.  Med.  Genet.  40(3),  332-337.
11.  Wells,  S., Mould,  S., Robins,  D.,  Robinson,  D.,  and Jacobs, P.  (1991)  Molecular  and
cytogenetic  analysis  of  a familial  microdeletion  of Xq.  J.  Med.  Genet.  28,  163-166.
12.  Francke,  U.  (1984)  Random  X  inactivation  resulting  in mosaic  nullisomy  of region
Xp2  1 +lp2  1.3  associated  with  heterozygosity  for  ormthine  transcarbamylase
deficiency  and  for  chronic  granulomatous  disease.  Cytogenet.  Cell  Genet.  38,
298-307.
13.  Migeon,  B.  R.,  Luo,  S.,  Stasiowski,  B.,  Jani,  M.,  Axelman,  Y.,  Van  Dyke,  D.  L.,
et  al.  (1993)  Deficient  transcription  of  MST  from  tiny  ring  chromosomes  in
females  with  severe phenotypes.  Proc.  Natl.  Acad.  SCL USA  80,  19,920-19,924.
14.  Robinson,  D.  O.,  Boyd,  Y.,  Cockburn,  D.,  Collinson,  M.  N.,  Craig,  I.,  and  Jacobs,
P.  A.  (1990)  The  parental  origin  of de novo  X-autosome  translocations  in  females
with  Duchenne  muscular  dystrophy  revealed  by  M278  methylation  analysis.
Genet.  Res.  Camb.  56,  135-140.
15.  Vogelstein,  B.,  Fearon,  E.  R.,  Hamilton,  S. R.,  Preisinger,  A.  C.,  Willard,  H.  F.,
Michelson,  A.  M.,  et  al.  (1987)  Clonal  analysis  using  recombinant  DNA  probes
from  the  X  chromosome.  Cancer  Res.  47,480648  13.
16.  Abrahamson,  G.,  Fraser, N.  J.,  Boyd,  Y.,  Craig,  I.,  and Wainscoat,  J. S. (1990)  A
highly  informative  X  chromosome  probe,  M27S,  can be  used  for  the  determina-
tion  of  tumour  clonality.  Br.  J  Haematol.  74,371,372.
17.  Boyd,  Y.  and  Fraser,  N.  J.  (1990)  Methylation  patterns  at  the  hypervariable  X
chromosome  locus  DXS255  (M27P)  correlate  with  X  inactivation  status,
Genomics  7,182-l  87.
18.  Giacalone,  J.,  Friedes,  J.,  and  Francke,  U.  (1992)  A  novel  GC  rich  human
microsatellite  VNTR  in  Xq24  is  differentially  methylated  on  active  and  inactive
X  chromosomes.  Nature  Genet.  1,  137-143.
19.  Keith,  D.  H.,  Singer-Sam,  J., and  Riggs,  A.  D.  (1986)  Active  X  chromosome  DNA
is unmethylated  at eight  CCGG  sites clustered  in  a guanine  -plus-rich  island  at the
5’  end  of the  gene  for  phosphoglycerate  kinase.  Mol.  Cell.  Biol.  6,4  122-4  125.
20.  Yen,  P.  H.,  Patel,  P.,  Chinault,  A.  C.,  Mohandas,  T.,  and  Shapiro,  L.  J.  (1984)
Differential  methylation  of  hypoxanthine  phosphoribosyltransferase  genes  on
active  and  inactive  X  chromosomes.  Proc.  Natl.  Acad.  Sci.  USA  81,  1759-1763.
21.  Hendricks,  R.  W.,  Chen,  Z.  Y.,  Hinds,  H.,  Schuurman,  R.  K.  B.,  and  Craig  I.  W.
(1992)  An  X  chromosome  inactivation  assay based  on differential  methylation  of
a CpG  island  coupled  to  a VNTR  polymorphism  at the  5’  end  of  the  monoamine
oxidase  A  gene.  Hum  Mol.  Genet.  l(3),  187-194.
152  Robinson  and  Harvey
22.  Allen,  R.  C.,  Zoghbr,  H.  Y.,  Moseley,  A.  B.,  Rosenblatt,  H.  M.,  and  Belmont,  J.
W.  (1992)  Methylation  of  the  HpaII  and  HhaI  sites  near  the  polymorphic  CAG
repeat  m  the  human  androgen-receptor  gene  correlates  with  X  chromosome  inac-
tivation.  Am.  J.  Hum.  Genet  51,  1229-1239.
23.  Tonioli,  D.,  D’Urso,  M.,  Martnu,  G.,  Peraco,  M.  G.,  Tufano,  V.,  Battistuzzi,  G.,
et al.  (1984)  Specrfic  methylation  pattern  at the  3’ end of the  human  housekeeping
gene  for  glucosed-phosphate  dehydrogenase.  EMBO  J  3,1987-l  995.
24.  Fraser,  N.  J.,  Boyd,  Y.,  and  Craig,  I.  (1989)  Isolation  and  charactertsatron  of  a
human  variable  copy  number  tandem  repeat at Xcen-p  1.22.  Genomzcs 5,146-148.
25.  Hendricks,  R.  W.,  Kraakman,  M  E  M  , Mensink,  R.  G.  J.,  and  Schuurman,  R.  K.
B.  (199  1) Differential  methylation  at the  5’  and the  3’  CCGG  sites flanking  the  X
chromosomal  hypervariable  DXS255  locus.  Hum.  Genet.  88,  105-l  11
26.  Tilley,  W.  D.,  Marcelli,  M.,  Wilson,  J  D  , and  McPhaul,  M.  J. (1989)  Character-
isation  and  expression  of  a cDNA  encoding  the  human  androgen  receptor.  Proc
Nat1  Acad  Sci  USA  86,327-33  1.
27.  Gale,  R.  E.,  Wheadon,  H.,  Boulos,  P  , and  Linch,  D.  C.  (1994)  Tissue  specificity
of  X  chromosome  inactivation  patterns.  Blood  83(10),  2899-2905.
28.  Vetrie,  D.,  Flmter,  F.,  Bobrow,  M.,  and  Harris,  A.  (1992)  X  mactivatron  patterns
in  females  with  Alport’s  syndrome:  a means  of  selecting  against  a  deleterious
gene?  J  Med  Genet  29(9),  663-666.
29.  Harris,  A.,  Collins,  J., Vetne,  D.,  Cole,  C.,  and Bobrow,  M  (1992)  X  inacttvation
as  a  mechanism  of  selection  against  lethal  alleles:  further  investigation  of
incontinentia  pigmenti  and  X  linked  proliferative  disease.  J.  Med.  Genet.  29,
608-614.
30.  Brown,  R.  M.  and  Brown,  G.  K.  (1993)  X  chromosome  inactivation  and the  diag-
nosis  of  X  linked  disease  in  females.  J,  Med  Genet  30,  177-184.
31.  Marcus,  S.,  Steen,  A.-M.,  Andersson,  B.,  Larnbert,  B.,  Kristoffersson,  U.,  and
Francke,  U  (1992)  Mutation  analysis  and  prenatal  diagnosis  in  a Lesch-Nyhan
family  showing  non-random  X-mactivation  interfering  with  carrier  detection  tests.
Hum  Genet.  89,395-400.
32  Alterman,  L.  A.,  de  Alwis,  M  ,  Genet,  S ,  Lovering,  R.,  Middleton-Price,  H.,
Morgan,  G.,  et  al.  (1993)  Carrier  determination  for  X  linked  agammaglobulm-
aemia  using  X  inactivation  analysis  of purified  B  cells  J  Immunol.  Methods  166,
111-116.
33  Conley,  M.  E.,  Lavoie,  A.,  Briggs,  C.,  Brown,  P.,  Guerra,  C.,  and  Puck,  J.  M.
(1988)  Non-random  X  chromosome  inactivation  in  B  cells  from  carriers  of  X
chromosome  linked  severe  combined  immunodeticiency  Proc.  Nat1  Acad  Sci.
USA  85,3090-3094.
8
Risk  Analysis
Andrew  P.  Read
1. Introduction
Every  genetic laboratory  diagnosis carries some degree of uncertainty,  even
if  only  the risk  of  laboratory  error.  Increasingly,  diagnosis  is based on direct
tests that  tell  us whether  or  not  the patient  carries  a given  mutation.  In  these
cases formal  risk  analysis  is scarcely necessary–although  it  is important  to
remember that the patient wants to know  the risk of disease, not the probability
of  possessing a certain  genotype. Variable  expression, nonpenetrance,  or  late
onset may mean that carrying  the mutation  is not the same thing  as having  the
disease. Unfortunately,  there  are still  many  situations  where  direct  mutation
tests are not  available  as part  of  a routine  diagnostic  service.  Some disease
genes have  not yet been cloned; for  others, although  the gene is known,  muta-
tions are hard to find  (e.g., in neurotibromatosis  1 and adult polycystic  kidney
disease type  1); sometimes direct  tests easily reveal  a proportion  of  all  muta-
tions, but the remainder  are too diverse  to be hunted down  in a busy diagnostic
laboratory  (as happens  in  cystic  fibrosis  families).  In  all  these cases family
studies require  the use of  linked  markers to track the disease gene through  the
family.  Gene tracking  always requires  a risk  calculation.  A  further  complica-
tion  arises when  the same clinical  disease can be caused by mutations  at more
than one locus, as with  polycystic  kidney  disease or tuberous  scleroses.
Some aspects of  risk  analysis  involve  no  more  than  common  sense arith-
metic or standard calculations  of  false-positive  and false-negative  rates. These
calculations  are covered  in any standard text on elementary  statistics (e.g., ref.
1),  and are  not  considered  further  here,  although  it  is important  that genetic
laboratory  workers  should feel comfortable  with  simple statistics. This  chapter
concentrates on the two  specialized techniques that are widely  used in genetics
From.  Methods  m  Molecular  Medicine:  Molecular  Diagnosis  of  Genebc  Dmases
Edlted  by*  R  Elles  Humana  Press  Inc  , Totowa,  NJ
153
154  Read
laboratories  for  risk estimation, Bayesian analysis and pedigree  analysis using
linkage  programs.
Genetic risk analysis usually  involves  calculating  the probability  of  each of
a small number  of  mutually  exclusive  outcomes: The  person either  carries the
gene or does not; the fetus is either affected,  a carrier,  or homozygous normal.
This  type of problem  lends itself  well  to analysis by Bayesian methods. Bayes’
theory  gives  a formula  for  combming  the  probabilities  of  diverse  pieces  of
evidence  in order  to get an overall  probability,  and allows  simple hand calcula-
tions,  at least in  straightforward  situations. Typically,  Bayesian  methods  are
used to combme  pedigree  risks with  results of  marker  studies. Advantages  of
Bayesian methods  are their  generality-any  risk  factors  can be incorporated
into  the calculation-and  their  simple logical  structure. The main  drawback  is
that the calculation  can get excessively comphcated for  large pedigrees. A  few
people develop  a great aptitude for  reducing  almost any problem  to a Bayesian
calculatron, done by hand on a suitably large piece of paper, but for  most of  us,
Bayestan methods are best kept for  simple pedigrees. A  recent book  (2)  gives
examples  of  almost  every  conceivable  application  of  Bayesran methods  to
genetic laboratory  diagnosis.
The  main  alternative  to Bayes is to use a linkage  program  on the computer
(see Note  1). At  first  sight  it  may  seem surprising  that  programs  written  for
calculating  lod  scores should be useful  for  estimating risks. Actually  the prob-
lems are not so very  different,  Each problem  involves  three interrelated  sets of
mformation:  the segregation  of  the disease, the segregation  of  the marker(s),
and the linkage  relationship  between the disease and the marker.  Any  two  can
be used to calculate  the third.  The  core of  linkage  analysis programs,  such as
Liped  and Mlink  is a formula  (the Elston-Stewart  algorithm)  (3)  for  calculat-
ing  the overall  likelihood  of  a pedigree,  including  disease and marker  types.
For  linkage  analysis, the  overall  likelihood  is calculated  twice,  once  on  the
assumption  that  the  disease and  marker  loci  are unlinked,  and  again  on  the
assumption  that  they  are  linked  with  recombination  fraction  8. The  ratio  of
these two  likelihoods  is the  odds for  or  against  linkage  with  recombination
fraction  8. The  logarithm  of  these odds is the lod  score z(0) at that recombina-
tion  value.
For  risk  estimation  the odds of  two  alternative  genotypes must be worked
out  for  the proband.  The  likelihood  of  the pedigree  is calculated  twice.  Both
times the same, known,  recombination  fraction  for  the marker  is specified;  but
for  the two  calculations the two alternative  genotypes for  the proband  are used.
Again,  the ratio  of  the likelihoods  gives  the  relative  probabilities  of  the two
genotypes.  The  advantages  of  using  a linkage  program  are that very  compli-
cated pedigrees  can be handled just  as easily as simple ones, and the computer
does not make arrthmetical  mistakes. The main  disadvantage  is that the calcu-
Risk Analysis  155
lation  requires  a very  specific genetic model  to be provided,  including  precise
values  for  gene frequencies,  genetic distances, and so on, which  in reality  are
rarely  known  precisely. Additionally,  none of  the available  programs  is totally
simple to run,  still  less to run  correctly.  Courses are available  through  various
organizations  (e.g.,  in  the  United  Kingdom,  through  the  Human  Genome
Project  Resource Centre,  see Note  2),  and it  is strongly  recommended  that at
least one person in each center using these programs  should  have taken such a
course. Most people  need some help  to get started, and plenty  of  guided  prac-
tice before  they feel  confident.  Two  excellent books describe the principles  of
human  linkage  analysis  (3)  and  some more  practical  details of  using  linkage
programs  (4).
2.  Materials
The main linkage  analysis program  is Mlink.  This  is part of  a package called
Linkage,  currently  in version  5.2, which  includes several  programs  necessary
for  using  Mlink,  and some handy utility  programs.  All  the Linkage  programs
run  on a PC under  DOS or  OW2, and are available  free  of  charge to noncom-
mercial  users from  various  sources, including  Professor Jurg  Ott (see Note  1).
Computation  times can be  quite  lengthy,  and  it  is best to  use at least a 486
machine. The  programs  are supplied  in both compiled  and Pascal source code
forms.  If  you  want  to  alter  any of  the adJustable parameters  (to  allow  larger
families,  more alleles at a locus, and so on) you will  need an appropriate  Pascal
compiler,  such as Borland’s  Turbo  Pascal. This  is a commercial  package that
must be bought  from  a software  supplier.  Alternatives  to Mlink  include  Liped,
again running  on a PC and obtainable  free  from  Professor  Ott,
The  other  “material”  necessary for  risk  analysis is the most accurate and
up-to-date  information  on map distances and other properties  of  markers.  For
this reason, everybody  doing  risk analysis should have  access over  a computer
network  to the Genome Database (GDB)  and to the online  Mendelian  Inherit-
ance in  Man  (OMIM).  At  the time of  writing  both  GDB  and OMIM  are freely
accessible over  the Internet,  in addition  to access in the United  Kingdom  for
registered  users at the Human  Genome Project Resource Centre (see Note  2).
3.  Methods
3.1.  Bayesian  Calculations
1.  Set up a table with one column for each of the alternative hypotheses. Cover all
the alternatives.
2.  Assign a prior  probability  to each alternative. The prior  probabilities of  all the
hypotheses must sum to 1. It is not important at this stage to worry about exactly
what information you should use to decide the prior  probability, as long as it is
consistent across the columns. You will  not be using all the information (other-
156  Read
No  symptoms  of  HD
Fig.  1.  Pedigree  of  HD.
wise there  would  be no  point  in  doing  the  calculation  because you  would  already
have  the  answer),  and  any  information  not  used  in  the  prior  probability  can  be
used  later
3.  Using  one  item  of information  not  included  in  the prior  probabilities,  calculate  a
conditional  probability  for  each  hypothesis.  The  conditional  probability  is  the
probability  of the  information,  given  the  hypothesis  (not  the  probability  of  the
hypothesis  given  the  information!).  The  condttional  probabilities  for  the  differ-
ent  hypotheses  do  not  necessarily  sum  to  1.
4.  If  there  are  further  items  of  information  not  yet  included,  repeat  step  3 as many
times  as necessary  until  all  information  has been  used  once  and  once  only.  The
end  result  is  a number  of  lines  of  conditional  probabilities  in  each  column.
5.  Within  each column,  multiply  together  the prior  and all  the  conditional  probabili-
ties.  This  gives  ajointprobability.  The joint  probabilities  do  not  necessarily  sum
to  1 across the  columns.
6.  Scale  the  joint  probabilities  to  givefinal  probabibtles  that  do  sum  to  1. This  is
done  by  dividing  each joint  probability  by  the  sum  of  all  the joint  probabilities.
The  final  probability  is the  desired  answer (see Note  3)
3.1.1.  Bayesian  Calculation  of  the  Risk
of  Carrying  the  Huntington’s  Disease  (HO)  Gene
Figure  1  illustrates  a  simple  application.  A  man  wishes  to  know  the  risk
that  he carries  the  HD  gene. He  is 40  yr  old  and  on examination  is free  of
symptoms.
1.  Set up the calculation with two columns, for the two alternative hypotheses, that
he  has the  HD  gene  or that  he does not  have  it.
2.  Use  the  mendelian  probability,  1 m  2,  as the  prior  risk.
3.  For  the  “HD”  column,  the  condttional  probability  is the  chance  that  somebody
age 40  shows no  symptoms,  given  that  they  have  a paternally  inherited  HD  gene.
Consulting  an  age-of-onset  curve  shows that  this  is  50%.  For  the  “No  HD”  col-
umn,  the  probability  that  somebody  age 40  shows no  symptoms,  given  that  they
do  not  have  the  HD  gene,  is needed.  Common  sense suggests thts  figure  is  1; the
small  possibility  of  a phenocopy  could  be  allowed  by  setting  the  figure  to,  say,
0.999. Note that the conditionals do not sum to 1.
4.  Calculate  the joint  and  final  probabilities  (Table  1). The  risk  is  1 in  3  (Note  4).
Risk  Analysis  157
Table  1
Bayesian  Calculation  of  the  Risk  that  11, (Fig.  1)
Has  the  HD  Gene
Hypothesis:  Man  has  HD  gene  No  HD  gene
Prior  probability  l/2  l/2
Conditional
Free  of  symptoms  at age 40  0.5  1
Joint  probability  0.25  0.5
Final  probability  0.2510  75  =  l/3  0.510.75  =  213
3.1.2.  Bayesian  Calculations  for  X-Linked  Conditions
3.1.2.1.  CARRIER  RISK  OF DUCHENNE’S  MUSCULAR  DYSTROPHY (DMD)
This  example  shows calculation  of  carrier  risk  of  DMD,  given  an obligate
carrier,  with  DNA  and creatine kinase data. The proband  is III,  (Fig.  2).
1.  There  are two alternative  hypotheses, and therefore  two columns  in  the calculation.
2  II2  is an  obligate  carrier,  therefore,  the  prior  risk  is  1 in  2
3.  Put  in  the  DNA  information  as a conditional  probability.  III2  has  inherited  the
low-risk  allele  of  a marker  that  shows 5%  recombination  with  DMD  in  a collec-
tion  of  family  data.  Given  that  she  is  a  carrier,  the  probability  of  this  is  0.05;
given  that  she is not  a carrier  the  probability  is 0.95.  (It  happens  that  these  condi-
tional  probabilities  sum  to  1.)
4.  Put  in  the  CK  data  as a second,  independent  conditional  probability  (see Note  5).
III2  has a CK  level  that  gives  2.3:  1 odds  she is  a carrier.
5.  Work  out  the joint  and final  probabilities  (Table  2). The  final  carrier  risk  is  10.8%.
3.1.2.2.  DMD  CARRIER  RISK  WITH  No  OBLIGATE  CARRIERS
What  is the risk that II,, (Fig.  3)  is a carrier?  The  prior  risk that a randomly
selected woman  is a carrier  of DMD  is 4 ~1 where ~1 is the mutation rate (Note  6).
First the chance that her mother  is a carrier  is calculated (Table  3). The  mother
has a 1 in 3 chance of  being a carrier  (see Note  7). Therefore,  ignoring  the very
small extra risk of  a second new  mutation,  the daughter has a 1 m 6 risk. This
could be modified  by DNA  marker studies and CK testing, as in previous examples.
3.1.2.3.  PRIOR  RISK  FOR NONLETHAL  X-LINKED  CONDITIONS
For  a  nonlethal  X-linked  condition  such  as hemophilia,  an  important
parameter  isf,  the biological  fitness  of  affected  males (f=  0 if  none  has chil-
dren, f  =  l/3  if  they  have  on  average  only  one  third  the number  of  children
that unaffected  men do, and so on).  The  prior  risk  that a female  is a carrier  is
x = 2  p(2  +A/(1  -A  ( see Note  8).  For  hemophilia  A,  the fitness  of  affected
males is estimated to be 0.7, giving  a prior  risk of  18 CL.
158  Read
r
0  CK  risk  2.3: 1
1  2-1
Fig.  2. Pedigree  of  DMD.  II,  is an  obligate  carrier.
Table  2
Bayesian  Calculation  of  the  Risk  that  Ill2  (Fig.  2)
Carries  the  DMD  Gene
Hypothesis:  III2  is  A  carrier  Not  a carrier
Prior  probability
Conditional  (1)
DNA  result
Condmonal(2)
CK  data
Joint  probability
Final  probability
l/2  l/2
0.05  0.95
2.3  1
0.0575  0.475
0 0575/O  5325  =  0  108  047510.5325  =  0.892
3.2.  Risk  Analysis  Using  Mlink
3.21.  Prenatal  Diagnosis
of Spinal  Muscular  Atrophy  Using  Linked  Markers
1.  Set  up  the  pedigree  tile,  setting  out  the  pedigree  structure  and  the  disease  and
marker  types  in  the  standard  format  described  m  the  program  documentation
(Fig.  4D,  see pp.  160,161)  Any  word  processor  or  text  editor  can  be  used,  pro-
vided  the  result  is  an  ASCII  (plam  text)  tile.  Be  careful  not  to  leave  any  blank
lines  at  the  end.  If  the  number  of  possible  haplotypes  exceeds  64,  it  must  be
reduced  below  this  threshold  by  recoding  alleles  or  eliminating  markers  (see
Note  9).  The  pedigree  in  Fig.  4A  has been  simplified  as shown  m  Fig.  4C.
2.  Use  the  Makeped  program  that  is part  of the  Linkage  package  to  convert  this  to  a
processed  pedigree  tile  (Fig.  4E;  see Note  10).
Risk  Analysis  159
No  history
of  DMD
Fig.  3.  Pedigree  of  DMD.  A  family  that  has no  obligate  carrier.
Table  3
Bayesian  Calculation  of  the  Risk that  IId (Fig.  3)
Carries  the  DMD Gene
Hypothesis:  Mother  is a
Prior  probability
Conditional  (1)
She has an affected  son
Conditional  (2)
She  has two unaffected  sons
Joint  probability
Final  probabtlity
Carrier
4p
II2
l/4
$2
p/2/@/2  + p)  =  l/3
Noncarrier
1-4P
P
1
pI(pI2  +$)  +  213
3.  Use  the  Preplink  program  that  is  part  of  the  Linkage  package  to  create  a  file
describing  the  genetics  of the  disease  and  markers  (Fig.  4F).  The  map  locations
of  all  loci  must  be  specified
4  Use  LCP,  the  Linkage  Control  Program  in  the  Linkage  package,  to  set up  a DOS
batch  file  to  run  the  problem.
5.  Run  the batch  file  to  calculate  the  risk.  Figure  4G  shows the  output:  The  risk  the
fetus  is affected  is  98.9%.
3.2.2.  Risk  Analysis  Using  M/ink in  DMD
1.  Set up  the pedigree  file,  with  the disease  and marker  types,  as before.  Incorporate
CK  data by  using  liability  classes (see Note  11).
2.  Use  the  Makeped  program  to  convert  this  to  a processed  pedigree  tile.
3.  Use  the  Preplink  program  to  create the  file  describing  the  genetics  of  the  disease
and markers.  The  mutation  rate,  1 x  lo”,  is specified.  The  frequency  of the  disease
allele  is set at 2 x  lti  (see Note  12). Figure  5 (seep.  162) shows a Preplink  file  that
allows  10 different  CK  risk  categories, and flanking  markers,  each with  four alleles.
4.  Use  LCP,  the  Linkage  Control  Program,  to  set up  a  DOS  batch  file  to  run  the
problem
5.  Run  the  batch  file  to  calculate  the  risk.
160  Read
A:5-3  A:5-1  A:5-1
B:9-7  B:7-3  B:7-3
C:6-3  C:6-3  C:6-1  A
&
I
B:  1-3  B:l-4  B:;-4
SMA:N-?  SMA:A-A  SMA:?-?
C:l-3  C:l-3  C:l-4  C
1100111212  Father  110030010  1  12  12  Father  Ped:  1  Per:  1
1200213434  Mother  120030020  134  34  Mother  Ped:I  Per:2
1312111313  Son  131204410  113  13  Son  Ped:  1  Per:  3
14  12  2  2  1413  Daughter  1 4  1 2 0 5 5 2 0  2  14  13  Daughter  Ped:  I  Per:  4
1512001414  Fetus  I 5  1 2 0 0 0  1 1  0  I  4  1 4  Fetus  Ped:  I  Per:  5
D  E
Fig.  4.  Use  of  Mlink  program  to  calculate  risk  m  a prenatal  diagnosis  of  spinal
muscular  atrophy  using  lmked  markers.  (A)  The  pedigree,  with  types  for  three  hypo-
thetical  markers,  A,  B,  and  C  No  attempt  has been  made  to  draw  out  the  haplotypes.
(B)  Genetic  map.  (C)  Pedigree  simplified  for  input  to  Mlink  (see Note  9).  Again,  no
attempt  has been  made  to  draw out  the  haplotypes;  Mlink  will  do  this.  (D)  Raw  pedi-
gree  file  for  input  to  Mlink.  (E)  Pedigree  tile  as processed  by  Makeped  (see Note  10).
(F)  Preplink  file  describing  the  genetics.  (G)  Mlink  output.  The  fetus  has  98.9%  risk
of being  affected.
Risk  Analysis  761
3105  -=<NO.OFLOCI,RISKLOCUS,SEXLINKED(IFl)PROGRAM
00.00.00  ~<MUTLOCUS,MUTRATE,HAPLOTYPEFREQUENCIES(IFl)
213
1  2 <<AFFECTION,NO.OFALLELES
0.9700000.030000 <<GENE  FREQUENCIES
l<<NO.OFLlABILlTYCLASSES
0.00000.00001.0000~~PENETRANCES
2-=ALLELEATRISK
3  4 <<ALLELENUMBERS,NO.OFALLELES
0.2500000.2500000.2500000.250000 <<GENE  FREQUENCIES
3  4 c<ALLELENUMBERS,NO.OFALLELES
0.2500000.2500000.2500000.250000 <<GENE  FREQUENCIES
00  <<SEXDIFFERENCE,INTERFERENCE(iFlOR2)
0.010000.04000<<RECOMBlNATlONVALUES
l0.100000.12000~~RECVARIED,INCREMENT,FINlSHlNC  VALUE
F THETAS  0.010 0.040
—.-____-__-________I_______
PEDIGREE1  LNLIKE  ILOGlOLlKE
—___—-__–_—_—————
RISKFORPERSON  51NPEDlGREE  1
HOMOZYGOTECARRIER  :  0.98882
HETEROZYGOTECARRIER  :  0.01107
NORMAL  :  0.00011
1  -24.367676 -10.582725
TOTALS  -24.367676 -10.582725
-2 LN(LIKE)=  48.735351
Fig.  4.  (F,G)
G
Special problem8  in DMD  include  possible ambiguity  in the position  of  the
DMD  mutation  relative  to an  intragenic  marker  (see Note  13)  and  germinal
mosaicism (see Note  14). Sometimes it happens that a woman’s  carrier  risk is
negligible  unless her father  or grandfather  is a germinal  mosaic, in which  case
it is significant  but hard to quantify.  Risk estimation by any method  is exceed-
ingly  difficult  in such cases, and these are families  where  it is worth  putting  in
extra efforts  to define  the mutation  so that direct testing can be offered.
3.3. Risk  Estimation  In  Cystic  Fibrosis  (CF)
As described in Chapter 5, most CF mutations are detected using direct muta-
tion  analysis. The  necessity for  risk  calculations  arises when  no  mutation  is
seen. A negative  result on mutation  screening does not exclude the presence of
a rare mutation  that is not included  in the direct testing panel. For  any particu-
lar geographical  location  and testing protocol,  one can estimate the population
frequency  of  these “mvisible”  CF mutations.  It  is a function  of  the overall  CF
frequency,  of the distribution  of mutations in that population,  and of  the proto-
162  Read
3  1  I  5  <<NO  OF  LOCI,  RISK  LOCUS,  SEXLINKED  (IF  I)  PROGRAM
1  I  DOE-0004  I  OOE-0004  0  <<  MUT  LOCUS,  MUT  RATE,  HAPLOTYPE  FREQUENCIES  (IF  I)
213
I  2  <<AFFECTION,  NO.  OF  ALLELES  [DMD  locus]
0  999800  0  000200  <<GENE  FREQUENCIES
11  <<NO  OF  LIABILITY  CLASSES
0  0000  0  0000  I  0000  [hablhty  class  for  obligate  carrlers]
00000  10000
0  100009000  10000  [hablhty  class  for  CK  C  NC  odds  I  91
00000  10000
0200008000  10000  [hablhty  class  for  CK  C  NC  odds  2  81
00000  10000
0  3000  0.7000  I  0000  [habthty  class  for  CK  C  NC  odds  3  71
00000  I0000
0  4000  0.6000  1  0000  [hablhty  class  for  CK  C  NC  odds  4  61
00000  10000
0500005000  10000  [hablhty  class  for  CK  C  NC  odds  5  51
0  0000  I  0000
0600004000  10000  [hablhty  class  for  CK  C  NC  odds  6  41
00000  I0000
0700003000  10000  [habthty  class  for  CK  C  NC  odds  7  31
00000  10000
0800002000  10000  [habthty  class  for  CK  C  NC  odds  8  21
00000  IO000
090000  1000  10000  [hablhty  class  for  CK  C  NC  odds  9  I]
00000  10000
099000010010000  [hablhty  class  for  mamfestmg  carrters]
0  0000  I  0000  <<  PENETRANCES
2  cc  ALLELE  AT  RISK
3  4  cc:  ALLELE  NUMBERS,  NO  OF  ALLELES  [marker  locus  with  4  alleles]
0  2500000  0  2500000  0  2500000  0.2500000  -z<  GENE  FREQUENCIES
3  4  <<  ALLELE  NUMBERS,  NO  OF  ALLELES  [2nd  marker  wtth  4  alleles]
0  2500000  0  2500000  0  2500000  0  2500000  cc  GENE  FREQUENCIES
0  0  <<  SEX  DIFFERENCE,  INTERFERENCE  (IF  I  OR  2)  [these  next  3  lines  are  requrred,  but
0  05000  0  05000  <<  RECOMBINATION  VALUES  m  fact  not  used  by  the  program,  If
1  0  10000  0  06000  <<  REC  VARIED,  INCREMENT,  FINISHING  VALUE  you  use  LCP]
Fig.  5. Preplink file for risk estimation in DMD using Mhnk. The 11 liability classes
allow creatine kinase data to be incorporated m the risk calculation (see Note 11).
co1 used for  direct  testing. Invisible  mutations  must then be considered  in two
contexts, population  screening and family  studies.
3.3.1.  CF  Population  Screening
If  the frequency  of  invisible  mutations  in a population  is q, the risk of  a CF
child  to a couple both  of  whom  test negative  is q2/4. This  is likely  to be negli-
gibly  low,  but  the risk  to  couples  one  of  whom  tests positive  and the  other
negative  is much higher,  at q/4. It has been suggested that a screenmg program
does more harm  than good unless q/4 is lower  than the prescreenmg  risk. For
the United  Kingdom  this would  require  detection  of  96% of  all  CF mutations.
Most  authors agree that this criterion  is excessively stringent.
Risk  Analysis  163
3.3.2.  Diagnosis  in  CF  Families
Chromosomes  come in  four  classes:
1.  Those carrying visible mutations;
2.  Those  known  to  carry  invisible  mutations  (tracked  from  the parent  of an affected
child  who  has an  invisible  mutation);
3.  Those  with  no  visible  mutation  but  the  population  risk  q of  carrying  an invisible
mutation;  and
4.  Those  known  not  to  carry  any  mutation  (identified  as the  other  chromosome  of a
known  carrier,  who would  be affected  if  it  carried  any  mutation)
When only  one mutation  can be detected in a CF-affected  child,  the parents
can still  be offered  prenatal  diagnosis in  future  pregnancies, usmg a combma-
tion  of direct  testing for  the visible  mutation  and gene tracking  for  the invisible
one. With multiallele  microsatellite  markers, no complicated calculatton should
be needed, because each parental  chromosome  usually  can be distinguished.
Giving  carrier  risks to a relattve  of the invisible  mutatton carrier  is more tricky.
Chromosomes  must be tracked across the family.  Unless all  intervening  rela-
tives  are available  for  study, the uncertainties  mount rapidly  because of  the risk
of  recombination  and because of  possible failure  to distinguish  chromosomes
identical  by state but not by descent.
3.4.  The  Problem  of  Locus  Heterogeneity
Extra  uncertainty  attends the  interpretation  of  gene tracking  results  when
the identical  disease can be produced  by mutations  at more  than one locus. In
the  occastonal  large  family,  linkage  analysis  can  identify  which  locus  is
involved.  Usually,  however,  one does not know.  Adult  polycystic  kidney  dis-
ease (APKD)  is an example:  86% of  families  have  a mutation  mapping  to the
PKDl  locus  on  chromosome  16~13,  while  the  rest  mostly  have  a mutation  at
the currently  unidentified  PKD2  locus on chromosome  4q. Risk  estimation  is
based on gene tracking, using the many polymorphic  markers tightly  linked  to
the PISDl  and  PKD2  loci.  Somebody who  inherits  a low-risk  PKDl  marker
from  an affected  parent  has a risk  of  inheriting  a disease allele  given  by: (the
chance the disease is PKD 1 and there is a recombinant) + (the chance the disease
is not PKDl  x l/2).  The  l/2  is because if  the disease is unlinked  to the markers
studied, there is the standard mendelian  1 in 2 risk.
Flanking  markers are very  much more powerful  than single markers for  pin-
pointing  heterogeneity.  Informative  meioses can be classified  into  three types:
1.  Nonrecombinants;
2.  Single  recombinants  (with  a marker-marker  recombination);  and
3.  Apparent  double  recombinants,  where  somebody  inherits  a  nonrecombinant
haplotype  of  flanking  markers  m  conjunction  with  the  “wrong”  disease  status
164  Read
Single  recombinants  are uninformative:  They  merely  show that a crossover
has occurred  somewhere  between  the  flanking  markers.  Apparent  double
recombinants  are likely  to be the result of misdiagnosis  or locus heterogeneity.
The  patient  should  be reevaluated  to confirm  the disease status. Two  or  more
confirmed  “double  recombinants”  in a family  make it virtually  certain that the
disease locus is unlinked  to the markers used.
The  probabilities  can be quantified  by a Bayesian calculation,  or more  sim-
ply by using the Linkage  programs.  Suppose  the  markers  Ml  and  M2  flank  the
normal  disease locus D with  recombmation  fractions  8 1 and 82. The  likelihood
of  the data  is  calculated  for  two  alternative  maps:
Ml-Ol-D-02-M2  and  D-OS–Ml-(81  +  92)-M2
The  ratio  of  the  likehhoods  1s the  odds  of  heterogeneity  (see  Note  15).
4.  Notes
1.
2.
3.
4.
Noncommercial  users  can  obtain  the  Linkage  package  by  anonymous  ftp  from
ftp  york.ccc.columbia.edu  (give  login  name  ANONYMOUS;  no  password
required;  details  m  README.TXT  file)  or  on  disk  from  Professor  Jurg  Ott
(Columbia  University  Unit  58,  722  West  168th  St.,  New  York,  NY  10032).  The
standard  version  1s for  a PC  using  DOS,  but  other  versions  are available.
For  UK  users, the  HGMP-RC  is at Hinxton  Hall  (Cambridge  CBlO  1RQ).  Con-
sult  your  network  supervisor  about  access to  the  Internet  and  World  Wide  Web
(WWW).  At  the  time  of  writing  one  of  the  easiest  ways to  access all  biological
databases  is through  the Baylor  College  of  Medicine  Genome  Centre  at Houston
(WWW  address http://gc.bcm.tmc.edu:8088).  The  Genome  Database  and OMIM
are  accessible  at  http*//gdbWWW.gdb.org/,  and  the  HGMP-RC  at  http://
http://www.hgmp.mrc.ac.ukl.
A  formal  statement  of  Bayes’  theorem  is:
P(H,IE)  =  P(H,)P(EIH,)/~P(H,)P(EJH,)
P(H,)  means  the  probability  of  the  ith  hypothesis,  and  the  vertical  line  means
“given,”  so that  P(EIH,)  means  the  probability  of the  evidence  (E)  given  hypoth-
esis H,  (a conditional  probability).
You  might  have  expected  the  answer  to  be  112  x  112  =  114.  This  discrepancy
illustrates  an important  general  point  about  risk  calculations.  Both  answers are
correct,  but  they  are  answers  to  different  questions.  Of  all  40-yr-olds  whose
father  had  HD,  one  m  four  will  carry  the  HD  gene  but  be  free  of  symptoms.  A
second  one  of  the  four  will  have  the  gene  and  already  be  showing  symptoms.
Therefore,  of  all  symptom-free  40-yr-olds  whose  father  had  HD,  one  m  three
carries  the  HD  gene.  It  often  happens  that  two  logical  and  correct  methods  of
calculating  the  same  risk  give  different  answers  because  they  are  answering
subtly  different  questions.  It  is important  to  be  sure that  you  are  answering  the
question  the  patient  asked.
Risk Analysis  165
5.  If  more  than  one conditional  probability  is used,  it  is essential  that  they  should  be
logically  independent  of  each  other.  If  there  were  types  for  a second,  flanking
DNA  marker,  these  could  not  be used  as a separate  conditional  probability.  The
two  markers  are  linked,  and  so the  information  they  give  is  not  independent.
Assuming  the  flanking  markers  have  not  recombined  wrth  each  other,  a  single
conditional  probability  would  be  used,  based  on  the  likelihood  of  a  double
recombination.
6.  Considering  a lethal  X-linked  condition  such as DMD,  let  the  carrier  risk  of  any
randomly  chosen woman  be x.  Then  the  risk  that  her daughter  is a carrter  IS made
of  three  components:
a.  A  risk  x/2  that  she is  a carrier  by  inheritance  from  her  carrier  mother.
b.  A risk  u that  she has a new mutation  on  the  maternal  X  chromosome  (u  is  the
mutation  rate  in  females).
c.  A  risk  v that  she has a new mutation  on  the paternal  X  chromosome  (v  is  the
mutation  rate  in  males).
The  daughter’s  overall  risk  is  therefore  x/2  +  u  +  v.  But  since  the  daughter
is  equally  a randomly  chosen  female,  her  risk  must  also  be x.  It  follows  that
x  =  2(u  +  v).  Usually  one  makes  the  assumption  that  the  mutation  rates  are  the
same  m  both  sexes, in  which  case the  prior  risk  x  = 4  u.
7.  Note  that  u  cancels  out  in  the  calculation,  so it  does not  matter  that  its value  is not
known.  The  term  in  p2 in  the  noncarrierJoint  probability  can be ignored,  because
for  any  realistic  value  of  u,  u2 will  be  orders  of  magnitude  smaller.
8.  A  woman  can also  be a carrier  because  her  father  was affected.  The  frequency  of
affected  males  will  be 4 =  (x/2  +  u),  and  the  frequency  of carrier  females  will  be
x =  (xl:!  +  2  p  +  qf), assuming  equal  male  and  female  mutation  rates.  It  follows
that  x =  x/2  +  2  u +  (x/2  +  pv,  which  simphfies  to  2  ~(2  +A/(1  -j).
9.  The  number  of  possible  haplotypes  is  the  number  of  alleles  at  the  disease
locus,  multiplied  by  the  number  of  alleles  at marker  locus  1, multiplied  by  the
number  of  alleles  at  marker  locus  2,  and  so  on.  A  disease  with  two  alleles
(affected,  unaffected),  tracked  with  microsatellites  with  8  and  10  alleles,
respectively,  creates  2  x  8 x  10 =  160 possible  haplotypes.  The  time  required
to  run  the  analysis  rises  exponentially  with  the  number  of  haplotypes,  and
quickly  becomes  impossibly  long;  moreover,  the  standard  versions  of  the
Linkage  package,  run  on  a  PC  under  DOS,  cannot  handle  more  than  64
haplotypes.  One  way  around  this  problem  is  to  redefine  the  markers  to  have
fewer  alleles  (5).  In  a typical  recessive  family,  at  most,  four  different  alleles
of  any  marker  are seen,  even  though  the  marker  may  have  10 different  alleles
in  the  wider  population.  Even  with  markers  reduced  to  four  alleles,  only  two
(4  x  4  x  2  haplotypes  including  the  disease)  can  be  handled,  plus  maybe  an
extra  2-allele  marker.  It  is  important,  therefore,  to  look  carefully  at  the  data
and  ask which  markers  actually  are contributing  useful  information.  In  Fig  4A,
marker  A  gives  no  information  that  the  more  tightly  linked  marker  B  does  not
give.  Markers  B  and  C  are  recoded  as having  four  alleles  each,  to  give  the
pedigree  in  Fig.  4C.
166  Read
10.  The  processed  pedigree  file  contains  added  pointers  to  the  pedigree  structure,
calculated  automatically  by  the  Makeped  program.
11.  The  Linkage  package  allows  a disease  to  have  several  liability  classes with  dif-
ferent  penetrances  Each  person  in  the  pedigree  is  assigned  to  a liability  class.
This  operates  in  an  obvious  way  for  age-dependent  penetrances,  as in  HD.  For
DMD,  the  liability  classes are used  m  a nonmtuitive  way to  manipulate  the  pen-
etrances  so that  the  computer  ends  up  putting  m  the  appropriate  CK  odds  ratio.
The  CK  dtstribution  is  divided  arbitrarily  into  12 different  classes,  each  giving
odds  carrier:noncamer  of  R(n)  In  the  Preplink  file,  n  corresponding  liability
classes are  defined  for  DMD  with  penetrances.
Genotype  l-l  2-l
(normal  (carrier)  Faffected
homozygote)  homozygote)
Penetrance  R(n)01 + R(n)1  l/[l  +  R(n)]  1
The  penetrance  assigned  to  the  affected  homozygote  is  immaterial-the  com-
puter  demands  a number,  but  in  practice  there  will  not  be any  such  females.  The
other  two  penetrances  work  as follows  Suppose  R(n)  is  2, that  is,  the  CK  gives
2:l  odds  a woman  is  a  carrier.  Mlink  assigns  penetrances  213 for  homozygous
normal  and  l/3  for  a carrier.  The  penetrance  is the  probability  of being  affected,
given  the  genotype.  Mlmk  calculates  that  an  unaffected  woman  m  this  liability
class  is twice  as likely  to  be a carrier  as to  be a normal  homozygote,  because  the
penetrances  tell  it  that  homozygous  normal  women  are  less  likely  to  be  unaf-
fected.  Thus  the  computer  is  trtcked  into  including  the  CK  data.  The  trickery
matters  only  for  unaffected  women  who may  or may  not  be carriers.  For  obligate
carrier  females,  a special  habihty  class can be used, with  the  standard  penetrances
of  0,  0,  and  1 for  genotypes  l-l,  2-1,  and  2-2,  respectively.  The  pedigree  must
include  the relevant  affected  males,  so that  the computer  can work  out  that  she is
an  obligate  carrier  Males  are  either  affected  or  unaffected,  and  every  liability
class  has the  male  penetrances  0  and  1, as common  sense requires.  Thus  males
can be assigned  to any  liability  class. An  alternative  to using  liabthty  classes is to
define  DMD  as a quantitative  phenotype  instead  of  as a disease,  but  this  seems
even  more  counterintuitive.
12.  Mlink  uses the  standard  Hardy-Weinberg  equation  to  calculate  the  frequency  of
carriers  as 2pq,  where  p  and  q  are  the  frequencies  of  the  normal  and  disease
alleles.  Thus  the prior  probability  of a woman  being  a carrier  1s 2pq.  But  the  prior
probability  needs  to  be  4  JJ (see Note  6).  To  get  correct  results,  therefore,  the
frequency  of the  disease allele  is given  as 2  x  lOA,  regardless  whether  this  is the
true  value  m  the  population.  A  similar  maneuver  would  be  used  for  nonlethal
diseases,  where  the  prior  carrier  probability  is  a  different  function  of  p,  as
explained  (Note  8)
13.  The  unique  size  and  complexity  of  the  dystrophin  gene  means  that  in  different
DMD  families  the  mutation  might  map  to different  sides  of an intragenic  marker.
Linkage  programs  require  a definite  map.  One  has to use common  sense in  defin-
Risk  Analysis  167
ing  the  locus  order  and recombmation  fractions.  If  the  common  strategy  of  hav-
ing  one  intragenic  and two  flanking  markers  IS used,  it  may  be  necessary to  cal-
culate  the risk  twice,  once for mutations  lying  either  side of the intragenic  marker.
The  final  risk  is then  an average,  maybe  weighted  by  a “guesstimate”  of the prior
probability  that  a mutation  would  map  m  either  interval.
14.  The  linkage  programs  do  not  allow  for  germinal  mosaicism  (or  the  risk  of
nonpaternity,  switched  samples,  maternal  contamination  of  a  chorion  ~111~s
sample,  and  so on).
15.  It  is important  in this  calculation  to  use the actual  likelihood  of the pedigree  at the
correct  recombination  fractions,  which  is  included  on  the  Mlink  output.  Mlink
also  outputs  the  lod  score, but  this  is  contaminated  by  the  known  lmkage  of  Ml
and  M2,  and  should  not  be used  for  estimating  heterogeneity
References
1.  Mosteller,  F., Rourke,  R.  E. K  , and  Thomas,  G.  B.  (1970)  Probability  with  Statis-
tical  Applications,  2nd  ed.,  Addison-Wesley,  London.
2.  Bridge,  P.  (1993)  The Analysis  of  Genetic  Rusks  Johns  Hopkins  University  Press,
Baltimore,  MD
3.  Ott,  J.  (1991)  Analysis  of  Human  Genetic  Linkage.  Johns  Hopkins  University
Press, Baltimore,  MD.
4.  Terwilliger,  J.  and  Ott,  J.  (1994)  Handbookfor  Human  Genetx  Lmkage  Johns
Hopkins  University  Press, Baltimore,  MD.
5.  Ott,  J.  (1978)  A  simple  scheme  for  the  analysis  of  HLA  linkages  in  pedigrees.
Ann.  Hum.  Genet.  42,255-257.

Hemoglobinopathies
Community  Clues  to  Mutation  Detection
John  M.  Old
1.  Introduction
The hemoglobinopathies  are a diverse  group  of inherited  recessive disorders
consisting  of  the  structural  hemoglobin  variants  and the  thalassemias. They
can occur at very  high carrier  frequencies  in the malarious  regions  of the world
and are regionally  specific, with  each population  having  a unique  combination
of  structural  variants  and thalassemia mutations. Therefore,  knowledge  of  the
ethnic origin  of  a patient  is usually  essential for  the quick  identification  of  the
underlying  molecular  defect(s)  in the globin  genes.
1.1.  Regional  Variation
Of  the structural  variants,  the most important  clinically  is Hb  S @-globin
codon 6, A +  T),  which  reaches its highest frequencies in Africa,  Saudi Arabia,
and  India.  Sickle  cell  disease  results  from  the  homozygous  state  for  the
mutation,  and also in varying  degrees from  the combination  of a Hb  S mutation
coupled  with  either  a Hb D  Punjab, Hb  0  Arab,  Hb C, or P-thalassemia muta-
tion  in  the other  P-gene. Hb  D  Punjab (codon  121, G +  C)  1s found  in  India,
Hb 0  Arab (codon 12 1, G +  A) m the Middle  East, and Hb C (codon 6, G +  A)  in
West Africa.  The second most important  abnormal  hemoglobin  is Hb  E (codon
26,  G  +  A).  The  mutation  causes a splicing  defect  resulting  m  a  mild  p’
thalassemia phenotype  and it can combine  with  P-thalassaemta trait  to produce
a severe hemoglobinopathy,  depending  on the type of  P-thalassemia mutation.
Hb E is extremely common  in a region  stretching from  northern  India  to China,
reaching  frequencies  of  up to 50% in  some populations.
From*  Methods  m  Molecular  Medicine:  Molecular  Diagnosis  of  Genetic  Diseases
Edlted  by  R  Elles  Humana  Press  Inc  , Totowa,  NJ
169
170  Old
More  than  120 different  P-thalassemia mutations have been described world-
wide  (I),  and for  most countries the spectrum of mutations has been determined
(2). The  relative  frequencies of  the mutations in  selected countries are listed in
Table  1 (pp. 172,173). Although  this information  can be very useful  for mutation
screening in  specific  cases, for  practical  purposes the P-thalassemia mutations
can be classified into four  ethnic groups: Mediterranean,  Asian Indian,  Chinese,
and Black  African.  For  each group  there are just  a small number  of  common
mutations  that account for  more than 90% of  those found  and therefore  muta-
tions can be identified  for  most couples at risk in one screening assay.
The  a-thalassemia  mutations  are classed as either  the a+ types (one inactive
a-globin  gene per chromosome)  or the a0 types (two  inactive  a-globin  genes
per chromosome)  (3). The o”  types all result from  large DNA  deletions  and are
found  m Mediterranean  countries,  e.g., Italy,  Greece, and Cyprus  (the –MED
and-[oJ20  5 alleles) or southeast Asia (–SEA), Thailand  (–THA1), and the Philip-
pines  (– FIL)  It  has  also  been  found  to  occur  at  very  low  frequencies  in .
nonmalarious  regions,  e.g., northern  Europe  (–BRIT allele).  The  a+ types can
result from  either  gene deletions  or point  mutations. The  most common  alleles
are the  3.7-kb  deletion  (-03s7), found  in  African,  Mediterranean,  and  Asian
populations,  and  the  4.2-kb  deletion  (-04s2),  found  in  southeast Asian  and
Pacific populations.  Of  the nondeletion  types, the most widespread  is Hb  Con-
stant Spring,  found  throughout  southeast Asia.  In  general,  both  nondeletion
and aO-thalassemia are rare in comparison to the CY.+ thalassemta deletion  genes.
7.2. Methods  of  Detection
Three  ccO-thalassemia deletions  can be detected by  PCR  using  primers  to
amplify  across the breakpoints  (4). However,  in my laboratory  I  have  encoun-
tered  much  difficulty  in  getting  reliable  amplificatton  with  these  primers
because of  the high  G-C  content  of  the a-globin  gene region  and continue  to
identify  cc-thalassemia deletions by Southern blot  analysis. BumHI  digests are
hybridized  with  an a-gene  probe and BgZII digests with  a c-gene probe initially
and  then  if  required  the  filters  can be stripped  and  rehybridized  to  the other
probe.  Table  2 (p.  174)  lists the abnormal  fragments  (underscored)  observed
for  all the common deletions  (4-7).  The  two  alleles,–THA1 and –FIL, cannot be
identified  with  these probes  because they  involve  deletions  that remove  the
entire  a-globin  gene complex  and require  a probe  from  a region  4 kb upstream
of  the r-gene  for  their  detection  (8).
The  P-globin  gene cluster DNA  sequence is very  easily amplified  and nearly
all  the known  mutations  can be diagnosed by PCR. Four  PO-thalassemia dele-
tion mutations  (9), five  (GP)“-thalassemia deletions, three deletions resulting  in
hereditary  persistence of  fetal hemoglobin,  and the intergene  deletion  creating
the  abnormal  Hb  Lepore  (10)  can be diagnosed  by  amplification  across the
Hemoglobinopathies  171
deletion  breakpoints.  Point mutations  and insertions or  deletions  of just  a few
nucleotides in  the P-globin  gene are detected directly  by the polymerase  chain
reaction  (PCR) techniques of  allele-specific  oligonucleotide  hybridization  (1 I)
or the allele-specific  priming  method  (121, the technique  discussed m the next
section and in Chapter  5. A few  of  the mutations  create or abolish  a restriction
enzyme  site  (see Table  5)  and  can be  screened  for  in  a  similar  manner  to
restriction  fragment  length polymorphisms  (RFLPs).  This approach can be use-
ful  for  the confirmation  of  a particular  P-thalassemia mutation, but is of  limited
use for  general screening of unknown  samples. However,  it is widely  used for  the
molecular  diagnosis of  the fi-globin  variants  giving  rise to  Hb  S, Hb  E, Hb  D
Punjab, and Hb  0  Arab. The primer  sequences used in my laboratory for  this pur-
pose are listed in Table  3 (p. 175) (see Note 7). Finally, more than 17 RFLPs have
been described in the P-globin  gene cluster and a number of  these are extremely
useful  for  haplotype analysis and prenatal diagnosis (13). The  primer  sequences
for the investigation of  10 of these RFLPs by PCR are presented in Table 4 (p. 176).
1.3.  Allele-Specific  Priming  Technique
This  technique is illustrated  in Fig.  1 (p. 177) and is known  as the amplifica-
tion  refractory  mutation system (ARMS).  It was first described by Newton  et al.
(14).  For  prenatal  diagnosis two  primers  must be  designed that will  generate
specific amplification  products, one with  the mutant allele and the other with  the
normal  sequence. The  nucleotide  at the 3’-terminus  of  each primer  is comple-
mentary  to the base in the respective  target sequence at the site of  the mutation.
In addition  a deliberate  mismatch to the target sequence is included  at the third
or fourth  base from  the 3’ end. The  deliberate  mismatch enhances the specific-
ity of the primer  since all 3’ terminal mismatches on then own  except for  C-C, G-
A,  and  A-A  mismatches  will  allow  some extension  of  the primer  and  thus
generate nonspecific  amplification  product  (15). The mutation-specific  ARMS
primers  for  the  most  common  P-thalassemia  mutations  and  P-globin  vari-
ants are listed in Table  5 (p.  178,179) . All  are the same length (30 mers) so that
all can be used at one annealing temperature (65OC). Primers for the specific detec-
tion  of  the corresponding normal  allele are listed in  Table  6 (p.  180). These are
required  for prenatal diagnosis in cases where both partners of  a couple at risk for
P-thalassemia carry  the  same mutation.  Each normal  ARMS  primer  must be
tested to  check  that  it  is working  correctly  using  DNA  from  an  individual
homozygous for that particular mutation, The list of primers in Table 6 is shorter than
Table  5 because of  the lack of  appropriate  DNA  controls in the laboratory.
Each ARMS  primer  requires  a second primer  to generate the allele-specific
product  and in addition,  two  control  primers  must be included  in the PCR reac-
tion  in  order  to generate an unrelated  product  that indicates the reaction  mix-
ture was set up properly  and everything  is working  correctly  (see Notes  1-4).
09
0
09
0
t
0  9 0
172
IVSId(T  +  C)  16.3  7.4  17.5
IVSI-1  lO(G  +  A)  29.8  43.7  41.9
IVSII-l(G  +  A)  1.1  2.1  9.7
IVSII-654(C  +  T)  15.7  8.9
IVSII-745(C  +  G)  3.5  7.1  2.7
6 19-bp  deletion  23.3  13.3
Others  4.1  2.2  9.7  0.5  0.9  6.8  7.9  10.6
“Expressed  as percentage  gene  frequencies  of the  total  number  of  thalassemia  chromosomes  studied.
bCD,  codon;  IVS,  Intervening  sequence;  bp,  basepaIrs
174  Old
Table  2
Restriction  Fragment  Sizes (kb)  of  Various  a-Globin  Allelesa
Allele
a-Gene  fragment  G-Gene  fragment
BamHI  BglII  BamHI  BglII
aa
4×31
-ix42
-(a)2o5
-NED
–SEA
14.0
10.3
98
4.0  10.5
None  None
None  None
None  None
None  None
12 6
7.4
16.0
74
11.3-10  Ob
59
11.3-10  Ob
5.9
11.3-10  Ob
5.9
59
20
5.9
5.9
59
12 6
12.6lO.Ob
16.0
12.0-lO.Ob
12 0-lO.Ob
8.7
10.5
139
10.5
7.8
7.0
%haracterlstrc abnormally  srzed fragments are underscored.
*Varrable size owing to the 6 hypervarrable region.
In  most cases the control  product  is generated from  the 3’ end of  the  P-globin
gene by primers  that span the breakpoints  of  the 6 19 bp deletion  P-thalassemia
mutation.  If  this deletion  gene is present m the target DNA,  a 242-bp  product
instead of  the normal  861  bp fragment  is generated (16).
2.  Materials
1,  PCR  buffer  used  in  the  standard  Cetus  buffer:  50  n-&f  KCl,  10  mA4 Tris-HCl
(pH  8.3  at  room  temperature),  1.5 mM  MgC12,  100  pg/mL  gelatin.  A  10X  stock
buffer  can be prepared  by adding  together  0.5 mL  of  lMTns-HCl,  pH  8.3,1.25  mL
2M  KCl,  75 &  lMMgCl,,  5 mg  of gelatm,  and 3.275 mL  of distilled  water. The  stock
buffer  is heated  at 37’C  until  the gelatin  dtssolves  and  then  frozen  m  ahquots.
2.  Stock  deoxynucleotrde  mixture  1.25  mM  each  dNTP:  Add  together  50  uL  of  a
100~mM  solutron  of  each  dNTP  and  3.8  mL  of  distilled  water.  The  1.25  mA4
dNTP  stock  should  be  stored  at -20°C  m  0.8-mL  aliquots.
Ready  made  100 mMdNTP  solutions  are now easily  obtainable  commercially
(e.g.,  from  Boehringer  Mannheim,  Mannheim,  Germany),  although  purists  may
still  wish  to  make  up  their  own  stocks  from  dNTP  salts  (which  are  less  expen-
sive)  as follows*  Dissolve  to  approx  200  mM,  neutrahze  carefully  with  0.05M
Tns  base to  a pH  of 7.0  by  checking  droplets  on pH  paper,  read  the  optical  den-
sity  of a diluted  ahquot  at the correct wavelength  (259  run-A,  253  nm-G,  27 1 run-C,
260  rim-T),  calculate  the  concentration  from  the  extinction  coefficient  (for  a  l-cm
path  length:  1.54  x  104-A,  1.37  x  104-G,  9.1  x  103-C,  7.4  x  103-T),  and  finally
adjust  to  100 mM  with  distilled  water.
Table  3
Oligonucleotide  Primers  for  the  Detection  of  ps,  FE, pDPunjab,  and  p”Arab  Mutations  as  RFLPs
Mutation  and  Primer  sequence,
affected  RE  site  s-3
Annealing
temperature,  Product  Absence  Presence
“C  size,  bp  of  site,  bp  of  site,  bp
PSCD6  (A  +  T)
(Loses  D&I  site)
z
PECD26  (G  +  A)
(Loses  MdI  site)
PD Punjab
CD121  (G  +  C)
(Loses  EcoRI  site)
POArab
CD121  (G  +  A)
(Loses  EC&I  site)
ACCTCACCCTGTGGAGCCAC  65  4.43  386
GAGTGGACAGATCCCCAAAGGACTCAAGGA  65  67
ACCTCACCCTGTGGAGCCAC
GAGTGGACAGATCCCCAAAGACTCAAGGA
CAATGTATCATGCCTCTTTGCACC
GAGTCAAGGCTGAGAGATGCAGGA  65  309
CAATGTATCATGCCTCTTTGCACC  65  861  861  552
GAGTCAAGGCTGAGAGATGCAGGA
65  443  231
89
56
35
33
65  861  861
201
175
67
171
89
60
35
33
552
309
Table  4
Oligonucleotide  Primers  Used  for  Analysis  of  /3-Globin  Gene  Cluster  RFLPs
Primer  sequence,  Annealing  Product  Absence  Presence
RFLP  S-3’  temperature,  “C  size,  bp  of  site,  bp  of  site,  bp
s-Hi&I
G-pXmnI
Ay-HindIII
s
S’@HnzdII
Sy&4VUII
3’@-HindII
P-RSUI
p-Am11
p-Hi&l
TCTCTGTTTGATGACAAATTC  55
AGTCATTGGTCAAGGCTGACC  55
AACTGTTGCTTTATAGGATTTT  55
AGGAGCTTATTGATAACTCAGAC  55
AGTGCTGCAAAGAAGAACAACTACC  65
CTCGCATCATGGGCCAGTGAGCCTC  65
ATGCTGCTAATGCTTCATTAC  55
TCATTGTGTGATCTCTCTCAGCAG  55
TCCTATCCATTACTGTTCCTTGAA  55
ATTGTCTTATTCTAGAGACGATTT  55
TCCTATCCATTACTGTTCCTGAA  55
ATTGTCTTATTCTAGAGACGATTT  55
GTACTCATACTTTAAGTCCTAACT  55
TAAGCAAGATTATTTCTGGTCTCT  55
AGACATAATTTATTAGCATGCATG  55
CCCCTTCCTATGACATGAACTTAA  55
GTGGTCTACCCTTGGACCCAGAGG  65
TTCGTCTGTTTCCCATTCTAAACT  65
GGAGGTTAAAGTTTTGCTATGCTGTAT  55
GGGCCTATGATAGGGTAAT  55
760
650
323
635
794
794
914
1200
328  328
475  320
155
760
650
323
635
794
794
914
692
413
100
314
446
450
200
235
98
327
308
687
107
442
352
480
434
692
331
100
82
227
101
219
155
108
Hemoglobinopathies  177
IVSI-5(G>C)
-b  285  4-  -+  861  c
B  M  E  CONTROL  D
Fig.  1. Diagram  showing  the  P-globin  gene  and the  position  of the  mutation  IVSIJ
(G  +  C) in  the  intervening  sequence (IVS)  1, together  with  the positions  of the mutant
ARMS  primer  (M)  to detect  IVSI-5,  primer  B,  and the  control  pair  of primers  D  and  E.
The  result  of  screening  16  DNA  samples  from  individuals  with  P-thalassemia  trait
with  primers  A,  M,  D,  and  E are shown herein.  The  285-bp  product  seen in  nine  tracks
indicates  the  presence  of  IVSI-5  (G  +  C).
3.  PCR  reaction  mixture  stock  solution  (4  mL)  Add  together  0.5  mL  10X  Cetus
buffer,  0.8  mL  1.25  mA4 dNTP  stock  solution,  and  2.7  mL  distilled  water.
4.  Dilute  aliquots  of  primer  stock  solutions  to  make  working  solutions  at  a concen-
tration  of  1 OD  U/mL.  The  primers  are  synthesized  commercially  by  OSWEL
DNA  service  (Southampton,  UK)  and  are HPLC  purified.  Store  at -20°C.
5.  Taq  DNA  polymerase:  AmpliTaq  (Applied  Biosystems,  Warrington,  UK)  is the
gold  standard  but  cheaper  thermostable  DNA  polymerases  may  be used success-
fully  (e.g.,  Advanced  Biotechnologies,  Leatherhead,  UK).
3.  Methods
3.1.  PCR  Conditions
For  both  ARMS-PCR  and RFLP-PCR  a total  reaction  volume  of  25  PL  is
used with  the following  final  concentrations:  10 mMTris-HCl,  pH  8.3,50  mM
KCl,  1.5 mit4MgC12,  0.01% gelatin,  0.2 w  each primer,  200  @t4 each dNTP,
0.1-0.5  pg of  genomic  DNA,  0.25 U of  Tug  polymerase.
1.  Add  20  pL  of  the  PCR  reaction  mixture  into  a 0.5~pL  Eppendorftube.
2.  Add  1  pL  of  each  required  primer  (four  for  ARMS-PCR,  two  for  RFLP-PCR)
plus  0.25  U  of  enzyme per tube. To  decrease pipeting errors, the enzyme and
Table  5
Primer  Sequences  Used  for  the  Detection  of  the  Common  P-Thalassemia  Mutations
by  the  Allele-Specific  Priming  Techniquea
Oligonucleotide  sequence,  Second  Product  Alterec
Mutation  S-3  pruner  size,  bp  restriction
-88(C  +  T)
-87(C  +  G)
-3O(T  +  A)
-29(A  +  G)
-28(A  -+  G)
CAP+I(A  +  G)
CDS(-CT)
T;  CD6(-A)
00  CD8(-AA)
CD8/9(+G)
CDlS(G  +  A)
CD16(-C)
CD17(A  +  T)
CD24(T  +  A)
CD39(C  +  T)
CD4  l/42(-TCTT)
CD71/72(+A)
IVSI-l(G  +  A)
IVSI-l(G  +  T)
IVSI-S(G  +  C)
IVSId(T  +  C)
IVSI-1  lO(G  +  A)
TCACTTAGACCTCACCCTGTGGAGCCTCAT
CACTTAGACCTCACCCTGTGGAGCCACCCG
GCAGGGAGGGCAGGAGCCAGGGCTGGGGAA
CAGGGAGGGCAGGAGCCAGGGCTGGGTATG
AGGGAGGGCAGGAGCCAGGGCTGGGCTTAG
ATAAGTCAGGGCAGAGCCATCTATTGGTTC
TCAAACAGACACCATGGTGCACCTGAGTCG
CCCACAGGGCAGTAACGGCAGACTTCTGCC
ACACCATGGTGCACCTGACTCCTGAGCACG
CCTTGCCCCACAGGGCAGTAACGGCACACC
TGAGGAGAAGTCTGCCGTTACTGCCCAGTA
TCACCACCAACTTCATCCACGTTCACGTTC
CTCACCACCAACTTCATCCACGTTCAGCTA
CTTGATACCAACCTGCCCAGGGCCTCTCCT
CAGATCCCCAAAGGACTCAAAGAACCTGTA
GAGTGGACAGATCCCCAAAGGACTCAACCT
CATGGCAAGAAAGTGCTCGGTGCCTTTAAG
TTAAACCTGTCTTGTAACCTTGATACCGAT
TTAAACCTGTCTTGTAACCTTGATACCGAAA
CTCCTTAAACCTGTCTTGTAACCTTGTTAG
TCTCCTTAAACCTGTCTTGTAACCTTCATG
ACCAGCAGCCTAAGGGTGGGAAAATAGAGT
A  684
A  683
A  626
A  625
A  624
A  597
A  528
B  207
A  520
B  225
A  500
B  238
B  239
B  262
B  436
B  439
C  241
B  281
B  281
B  285
B  286
B  419
+FokI
-A~11
+NlaII
-DdeI
-DdeI
+Mael
-BSpM
-BspM
+SfaN
IVSII-I(G  +  A)  AAGAAAACATCAAGGGTCCCATAGACTGAT  3  634  -HphI
IVSII-654(C  +  T)  GAATAACAGTGATAATTTCTGGGTTAACGTb  D  829
IVSII-745(C  +  G)  TCATATTGCTAATAGCAGCTACAATCGAGGb  D  738  +RsaI
pCD6(A  +  T)  CCCACAGGGCAGTAACGGCAGACTTCTGCA  B  207  -DdeI
PCCD6(G  +  A)  CCACAGGGCAGTAACGGCAGACTTCTCGTT  B  206
PECD26(G  -+  A)  TAACCTTGATACCAACCTGCCCAGGGCGTT  B  236  -MdI
me  above primers  are coupled as mdtcated with  primer  A.  CCCCTTCCTATGACATGAACTTAA,  B. ACCTCACCCTGTGGAGCCAC,  C.
TTCGTCTGTTTCCCATTCTAAACT,  or D  GAGTCAAGGCTGAGAGATGCAGGA.
%e  control  primers  used were  primers  D plus E. CA.4TGTATCATGCCTCTTTGCACC  (which  yield a 86 1 -bp product  as shown  in Fig.  1) for
all the above mutation  specific  ARMS  pnmers  except these two  primers.  Control  pruners  used with  these two  are the o-@ndlII  RFLP  primers
listed in Table 4
Table  6
Primer  Sequences  Used  for  the  Detection  of  the  Normal  DNA  Sequence  by  the  Allele-Specific  Priming  Technique
Mutation  Oligonucleotide  sequence,  S-3’  Second  primer  Product  size,  kb
-87  (C  +  G)
CD5  (-CT)
CD8  (-AA)
CD819  (+G)
CD15  (G  +  A)
CD39  (C  -+  T)
s
CD41/42  (-TCTT)
IVSI-  1 (G  +  A)
IVSI-1  (G  +  T)
IVSI-5  (G  +  C)
IVSI-6  (T  +  C)
IVSI-  110 (G  +  A)
IVSII-1  (G  +  A)
IVSII-654  (C  +  T)
IVSII-745  (C  –+  G)
ps  CD6  (A  +  T)
PE CD26  (G  +  A)
CACTTAGACCTCACCCTGTGGAGCCACCCC
CAAACAGACACCATGGTGCACCTGACTCCT
ACACCATGGTGCACCTGACTCCTGAGCAGA
CCTTGCCCCACAGGGCAGTAACGGCACACT
TGAGGAGAAGTCTGCCGTTACTGCCCAGTA
TTAGGCTGCTGGTGGTCTACCCTTGGTCCC
GAGTGGACAGATCCCCAAAGGACTCAAAGA
TTAAACCTGTCTTGTAACCTTGATACCCAC
GATGAAGTTGGTGGTGAGGCCCTGGGTAGG
CTCCTTAAACCTGTCTTGTAACCTTGTTAC
AGTTGGTGGTGAGGCCCTGGGCAGGTTGGT
ACCAGCAGCCTAAGGGTGGGAAAATACACC
AAGAAAACATCAAGGGTCCCATAGACTGAC
GAATAACAGTGATAATTTCTGGGTTAACGC
TCATATTGCTAATAGCAGCTACAATCGAGC
AACAGACACCATGGTGCACCTGACTCGTGA
TAACCTTGATACCAACCTGCCCAGGGCGTC
A  683
A  528
A  520
B  225
A  500
A  299
B  439
B  281
A  455
B  285
A  449
B  419
B  634
D  829
D  738
A  527
B  236
‘See  Table  5  legend  for  detads  of  primers  A-D  and  control  primers
Hemoglobinopathies  181
primers  m  most  cases can be mixed  together  in  a separate tube  before  addition  to
the  reaction  mix.
3.  Add  1 uL  of DNA  solution  (at  0.1-0.5  mg/mL).
4.  Add  30  yL  of  light  paraffin  oil  and place  tubes  in  a PCR  machine.
5.  For  ARMS-PCR,  program  for  25 cycles  (see Note  5) of 94’C  for  1 mm,  65°C  for
1 min,  72°C  for  1.5 mm,  with  a final  extension  period  of  3 min  at 72’C  after  the
last  cycle.  For  RFLP-PCR,  program  for  30  cycles  of  94°C  for  1 min,  55  or  65°C
(see Table  4)  for  1 mm,  72°C  for  1.5 mm,  with  a final  extension  pertod  of  3 mm
at  72’C  after  the  last  cycle
3.2. Analysis  of  ARMS-PCR  Product
1.  Remove  tubes from  the PCR  machine  and add  5 pL  of blue  dye (15%  ticoll/O.O5%
bromophenol  blue).  Mix  and  spin.
2  Load  a 20-uL  sample  onto  a 3%  agarose gel  and  run  at  100 V  for  approx  45  min
in  Tris-acetate  buffer  (40  mil4  Tris-acetate-l  mA4 EDTA).
3  Stain  gel  in  ethidmm  bromide  solution  (0.5  pg/mL)  for  15-30  min,  visualize
bands  on  a UV  light  box  (312  nm),  and  photograph  with  an  electronic  camera
system  or  a Polaroid  camera  fitted  with  an orange  filter  (e g , Wratten  22A)
3.3. Analysis  of  RFLP-PCR  Product
1.  Remove  tubes  from  PCR  machine  and  add  5-10  U  of  the  appropriate  restriction
enzyme  plus  2  uL  of  the  correspondmg  1 OX buffer.
2.  Incubate  at 37’C  for  a mimmum  of  1 h. Add  5  uL  of blue  dye,  mix,  and  spin.
3  Load  sample  onto  an agarose  gel  made  of  1.5%  agarose  and  1.5%  NuSieve  GTG
agarose (FMC)  and electrophorese,  stain, and photograph  as described  (see Note  6).
4.  Notes
1.  Both  positive  and  negative  controls  for  each  RFLP  or  mutation  bemg  screened
always  must  be  amplified  and  run  on  the  gel  alongside  the  test  samples.
2.  The  relationship  of  fragment  intensities  should  be  constant  for  all  DNA  samples
of  the  same  genotype.  Any  deviation  to  the  expected  pattern  of  band  intensities
should  be  treated  as suspect (e.g.,  a partial  digestion  or  a false-positive  ARMS-
PCR  result)  and  the  sample  retested.
3.  As mentioned,  sometimes  an ARMS  primer  may  produce  a positive  signal  that  is
less intense  relative  to  the control  fragment  than  expected.  If  the  same  faint  band
is observed  in  the  negative  control  sample,  the result  is a false positive.  This  occurs
when either  there  has been  a subtle  change  of reaction  conditions  or  if  the  ARMS
primer  has  started  to  lose  its  specificity.  The  latter  has  occurred  occasronally
with  the  stock  primer  solutions  and posstbly  results  from  some  degradation  of the
3’ end  of the oligonucleotide,  in  which  case the primer  has had to be resynthesized.
4.  No  amplification  product  may  result  from  the  DNA  sample  being  too  dilute
(reprecipitate  in  a smaller  volume),  the  DNA  being  too  concentrated  (try  a 1 in  10
dilution),  or  the  DNA  containing  impurities.  The  latter  may  be  overcome  by
cleaning  up  the  DNA  with  a repeat  phenol  extraction,  but  if  the  DNA  sample  is
182  Old
too  small  and prectous  for  such treatment,  the  addition  of spermidine  to the  PCR
reaction  mixture  at  a final  concentration  of  1 mM  usually  allows  amplifica-
tion  to  proceed.
5.  Always  use a limited  number  of cycles  to avoid  false-posttive  results  with  ARMS
primers  and  also  the  possibility  of amplifying  any  contaminating  maternal  DNA
in  a fetal  DNA  sample.  If,  as a last  resort,  a larger  number  of  cycles  is required,
amplify  diluted  DNA  controls  so  that  band  intensities  between  samples
remam  comparable.
6.  For  the  separation  of  small  DNA  fragments  very  similar  in  size,  increase  the
percentage  agarose  gel  to  4%  (3%  NuSieve/l%  agarose)  or  even  4.5%  (3.5%
NuSieve/l%  agarose).
7.  Finally,  before  synthesizing  a  primer,  always  check  the  published  sequence
against  the  known  P-globin  DNA  sequence  for  any  mistakes  or  typing  errors
(authors  are the  worst  proofreaders).
References
1  Baysal,  E.  (1992)  The  p  and  8 thalassemia  repository.  Hemoglobin  l&237-258.
2.  Flint,  J.,  Harding,  R.  M.,  Boyce,  A.  J.,  and  Clegg,  J.  B.  (1993)  The  population
genetics  of  the  haemoglobmopathres,  in  Baillltre  ‘s  Clinical  Haematology:
Haemoglobznopathies  (Higgs,  D.  R.  and  Weatherall,  D.  J., eds.),  Bailhere  Tindall
and  W.B.  Saunders,  London,  pp.  215-262.
3.  Higgs,  D.  R.  (1993)  a-thalassaemta,  m  Baillike’s  Clinical  Haematology.  The
Haemoglobinopathies  (Higgs,  D  R.  and  Weatherall,  D.  J., eds ), Baillibre  Tindall
and  W.B.  Saunders,  London,  pp.  117-150.
4.  Higgs,  D.  R.,  Pressley,  L.,  Aldridge,  B.,  Clegg,  J  B.,  Weatherall,  D.  J., Cao,  A.,  et
al.  (198 1) Genetic  and molecular  diversity  in  nondeletion  HbH  disease. Proc.  Natl.
Acad  SCL  USA  78,5833-5837
5.  Wimchagoon,  P.,  Higgs,  D.  R.,  Goodbourn,  S. E.  Y.,  Clegg,  J. B.,  Weatherall,  D
J., and Wan,  P. (1984)  The  molecular  basis of a-thalassaemia  in  Thailand.  EMBO
J  3,1813-1818.
6.  Vandenplas,  S., Higgs,  D.  R.,  Nicholls,  R.  D.,  Bester,  A.  J., and  Mathew,  C.  G.  P.
(1987)  Characterization  of  a  new  ct”  thalassaemia  defect  in  the  South  African
population.  Br  J.  Haematol.  66,539-542.
7.  Higgs,  D.  R.,  Ayyub,  H.,  Clegg,  J. B.,  Hill,  A.  V.  S., Nicholls,  R.  D.,  Teal,  H.,  et
al.  (1985)  a-Thalassaemia  in  British  people.  Br.  Med.  J.  290,  1303-1306.
8.  Fuchel-Ghodsian,  N.,  Vickers,  M.  A.,  Seip,  M.,  Winichagoon,  P.,  and  Higgs,  D.
R.  (1988)  Characterization  of  two  deletions  that  remove  the  entire  human  <-a
globin  gene  complex  (–THAr and  –FIL).  Br  J  Haematol  70,233-238
9.  Faa, V.,  Rosatell],  M.  C.,  Sardu,  R.,  Meloni,  A.,  Toffoh,  C.,  and  Cao,  A.  (1992)  A
simple  electrophoretic  procedure  for  fetal  diagnosis  of  P-thalassaemia  due to  short
deletions.  Prenat  Drag  12,903-908
10.  Craig,  J. E.,  Barnetson,  R.  A.,  Prior,  J., Raven,  J. L.,  and Thein,  S. L.  (1994)  Rapid
detection  of  deletions  causing  Sp  thalassemta  and  hereditary  persistence  of  fetal
hemoglobin  by  enzymatic  amplification.  Blood  83,  1673-1682.
Hemoglobinopathies  183
11.  Ristaldi,  M.  S.,  Pirastu,  M.,  Rosatelli,  C.,  and  Cao,  A.  (1989)  Prenatal  diagnosis
of  S-thalassaemia  in  Mediterranean  populations  by  dot  blot  analysis  with  DNA
amplification  and allele  specific  oligonucleotide  probes. Prenat.  Diag  9,629-638.
12.  Old,  J. M.,  Varawalla,  N.  Y.,  and Weatherall,  D.  J. (1990)  The  rapid  detection  and
prenatal  diagnosis  of  /3 thalassaemia  in  the  Asian  Indian  and  Cypriot  populations
in  the  UK.  Lancet  336,834-837.
13.  Varawalla,  N.,  Old,  J.  M.,  and  Fitches,  A.  C.  (1992)  Analysis  of  S-globin  gene
haplotypes  in  Asian  Indians:  Origin  and  spread  of  P-thalassaemia  on  the  Indian
subcontinent.  Hum.  Genet.  90,443-449.
14.  Newton,  C.  R.,  Graham,  A.,  and  Heptinstall,  L.  E.  (1989)  Analysis  of  any  point
mutation  in  DNA.  The  amplification  refractory  mutation  system  (ARMS).  Nucl.
Acids  Res.  17,2503-25  16.
15.  Kwok,  S.,  Kellogg,  D.  E.,  McKinney,  N.,  Spasic,  D.,  Goda,  L.,  Levenson,  C.,  et
al.  (1990)  Effects  of  primer-template  mismatches  on  the  polymerase  chain  reac-
tion:  human  immunodeficiency  virus  type  I  model  studies.  Nucl.  Acids  Res.  18,
999-1005.
16.  Varawalla,  N.  Y.,  Old,  J.  M.,  Sarkar,  R.,  Venkatesan,  R.,  and  Weatherall,  D.  J.
(199 1) The  spectrum  of  g  thalassemia  mutations  on  the  Indian  subcontinent:  the
basis  for  prenatal  diagnosis.  Br.  J.  Haematol.  78,242-247.

Automated  Genotyping  in  Diagnosis
Jayne  S.  Noble,  Kim  J.  Leach,  Lucy  A.  Ellis,
and  Graham  R. Taylor
1. Introduction
At present automated genotyping  in diagnosis involves  the detection, digitr-
zation,  and  analysis of  labeled  DNA  using  computer  software.  This  chapter
describes  the  use  of  the  Applied  Biosystems  (Foster  City,  CA)  373  DNA
Sequencer and  Genescan 672  software  for  sizing  fluorescently  labeled  PCR
products  in  a  diagnostic  molecular  genetics  laboratory.  The  Applied
Biosystems Genotyper  software  is not covered  since this is not used at present
in  this laboratory.  An  outline  of  the steps involved  in  automated genotyping,
from  polymerase  chain reaction  (PCR)  to archiving  data, is shown  in Fig.  1.
Fluorescently  labeled  PCR products and size standards are electrophoresed
in the same lane through  denaturmg  polyacrylamide  gels in the electrophoresis
chamber  of  the 373  DNA  Sequencer. An  argon  ion  laser sited a defined  dis-
tance from  the origin  of  electrophoresis  scans the width  of  the gel.  When  the
fluorescently  labeled  fragments  migrate  through  the path of  the laser, fluores-
cence is emitted.  The  fluorescence  is refocused  onto  a photomultlplier  tube
and the information  is drgitrzed  and presented for  analysis with  the  672  soft-
ware.  The  emitted  fluorescence  is detected in 4-wavelength  bands for  each of
two  filter  sets. Four  dyes therefore  are detected per  lane. One dye is reserved
for  the size standard, leaving  three dyes for  the detection  and analysis of  PCR
products.  A  computer  software  algorithm  creates a calibration  curve  for  the
size standard and the PCR products are compared with,  and hence sized against,
the curve  created for  each lane.
Two  advantages arising  from  the detection of  four  dyes per lane are the use
of  internal  lane standards, and the potential  for  high  order  multiplexing  result-
ing in  high  throughput.  With  the use of  internal  lane standards, the sample and
From:  Methods  m  Molecular  Medrone’  Molecular  Diagnosis  of  Genetic  Diseases
Edlted  by  R  Elles  Hurnana  Press  Inc  ,  Totowa,  NJ
185
186  Noble  et  al.
Ruorescont Mmors  Auoroscont dRTPs
labellid  PCR hoduct  Cast 001
Denaturatlon
I
Eloctrophoresls
Rwltch on Collect Rata
Anahrso Data,Transfor to Another Comuutor
Raw Data Ale  Chock Tracking
\
Pfeurocessed Rel Rle
\  /
and slzo tango
of gel uaramoters
Analwed Results RIO
I
Record Peak Sizes as Results
I
Results Checked
Fig.  1.  Overview  of  the  procedure.  Labeled  PCR  products  are produced  by  either
incorporation  of  fluorescent  dNTPs  or  labeled  primers.  A  polyacrylamtde  gel  is  cast,
scanned,  and  prerun,  and  the  Genescan  collection  and  analysis  files  are  set up.  The
PCR  products  are  mixed  with  a size  standard,  denatured,  and  loaded  onto  the  prerun
gel.  Afier  electrophoresrs  the  collected  data  is  transferred  to  another  Macintosh  for
analysis.  A  results  tile  is generated  and the  PCR  products  are scored and  checked.  The
results  rile  is then  archived
the  standard  experience  the  same  electrophoretic  environment  removing  any
problems  arising  from  lane  to  lane  and  gel  to  gel  variation  in  mobility.  The
potential  for  multiplexing  is  greater  than  that  for  radioactive  detection.  Differ-
Automated  Genotyping  in  Diagnosis  187
ent sized products  for  each dye can be multiplexed  and in addition  products  of
similar  sizes can also be multiplexed  if  they  are labeled  with  different  dyes.
The  highest  order  of  multiplexing  so far  in  this  laboratory  has been of  seven
microsatellites  from  within  the dystrophin  locus.
Further  advantages of the system include  the elimination  of the use of  radio-
isotopes and the speed at which  results can be obtained;  less than 4 h compared
with  at least 16 h for  radioactive  detection. In  addition,  since all  the products
migrate  the  same distance  (i.e.,  to  the  laser)  before  detection,  they  are  all
resolved  to the same extent so some of  the problems  associated with  reading
the larger  microsatellites  present in a radiolabeled  multiplex  are reduced.
2.  Materials
2.1.  PCR
1.  Tczq DNA  polymerase  (Stratech  Scientific,  Luton,  UK):  Store  at -2O’C
2.  1X  Tuq DNA  polymerase  reaction  buffer:  10 mA4Tris-HCl,  pH  9.0,50  r&KC&
1.5  mA4  MgCl.,,  0.1%  Triton-X  100:  A  10X  stock  is  prepared  and  stored  in
aliquots  at -20°C.
3.  dNTP  mixture  (Pharmacia,  Uppsala,  Sweden):  A  100X  stock  solution  of20  mM
each of dATP,  dCTP,  dGTP,  and dTTP  is prepared  and stored in  aliquots  at -20°C.
4.  Low  G  dNTPs  (Pharmacia):  A  100X  stock  of  solution  of  20  mJ4  each of  dATP,
dCTP,  and  dTTP  and  5 r&4  dGTP  is prepared  and  stored  at -2O’C.
5.  7-deaza-2’-dGTP  (Pharmacia):  Store  as supplied,  5 mM  (30X  stock)  at -20°C.
6.  Dimethyl  sulfoxide  (DMSO)  (Sigma,  St.  Louis,  MO).
7.  Oligonucleotide  primers  (see Section  3.1.1.).
8.  Formamide  stop solution  and gel  loader  0.25  g dextran  blue  m  250 mL  formamide.
Deionize  and  store  m  aliquots  at -2O’C.
2.2.  Gel  Running  and  Data  Analysis
1,  Alconex  detergent (Aldrich,  Milwaukee,  WI):  Dissolve  5 g in  approx  4 L of hot water.
2.  6%  Denaturing  acrylamide  sequencing  gel  solution  (Severn  Biotech,  Malvern,
UK):  Store  at room  temperature  in  the  dark.  (Note:  Neurotoxin.)
3,  TEMED  (N,N,N’,N’-tetramethylethylenediamine)  (BioRad,  Hercules,  CA):  Store
at room  temperature  in  the  dark.
4.  10%  (w/v)  Ammonium  persulfate  (Sigma).
5.  1X  TBE  buffer:  O.O45MTris-borate,  O.OOlMEDTA.  A  5X  stock  is prepared  and
stored  at room  temperature.
6.  Size standards: Genescan-  ROX,  2500  TAMRA,  350  ROX,  and  350
TAMRA  (Applied Biosystems) (see Note 1). Store at 4°C.
7.  Microcapillary  flat  tip  pipet  tips  (Sigma).
8.  Applied Biosystems 373 DNA  Sequencer and Genescan 672 software (Applied
Biosystems).
9.  Apple  Macintosh  IIci  connected  to  the  373  DNA  Sequencer.
10.  Networked  Apple  Mats  for  data  analysis  (see Note  2).
188  Noble  et  al.
2.3.  Fluorescent  ARMS  Assay
Primers:  Common  primer:  5’ GGA  CAG  AGA  CAT  ACA  TTT  CTA  TC  3’.
Variant  primer:  5’ FAM-CTT  GCT  TTC  TGA  TAT  AAT  TTG  TTT  3’. Wild-
type primer:  5’ JOE-CTT  GCT  TTC  TGA  TAT  AAT  TTG  TTC  3’.
2.4.  MutEx  Assay
1  Centricon  100  filters  (Amwon,  Danvers,  MA).
2  1X  Exonuclease  buffer:  50  m&I  Tris-HCl,  pH  7.6,  7  n&I  MgCl*,  5  mM  DTT.
Store  at -20°C
3.  MutS  protem  (Umted  States  Biochemicals,  Cleveland,  OH).  Store  in  aliquots
at -80°C.  (MutS  loses  80%  of  its  activity  after  two  freeze-thaw  cycles).
4.  T7  DNA  polymerase  (New  England  Biolabs,  Beverly,  MA).  Store  at -2O’C.
2.5.  Safety
Consider the following  hazards when running  gels on the 373 DNA  Sequencer.
1.  Electrical  shock  hazard:  The  373  DNA  Sequencer  contains  a high  voltage  power
supply.  The  mstrument  IS designed  so that  the power  supply  is drsconnected  when
the  door  IS open.  Follow  operating  procedures  as outlined  m  the  user’s  manual.
2.  Laser hazard: The  373 DNA  Sequencer contains  a laser. Follow  operating  procedures
as outlined  in  the  user’s manual  to prevent  physical  harm  from  radiation  exposure.
3.  Chemical  hazards:  Some  of  the  chemrcals  used with  the  instrument  are hazard-
ous  (for  example,  acrylamide  is  a neurotoxin).  Follow  all  safety  procedures  as
outlined  in  the  manufacturer’s  instructions  and  local  rules  regarding  the  use and
disposal  of  such  chemicals
3.  Methods
3.7.  Labeling  Methods
There  are  several  possible  ways  in  which  PCR  products  can be made  to
fluoresce:  using  intercalating  dyes (ethidium  bromide,  YO-YO, and  To-To,
Molecular  Probes Inc., Eugene, OR), incorporation  of fluorescent  dNTPs  or by
the use of  labeled  primers.  Intercalating  dyes are not effective  in  high  resolu-
tion  denaturing  conditions  and are not discussed further.
3.1.1.  Labeled  Primers
In  spite  of  their  cost disadvantage,  fluorescently  labeled  primers  give  the
best resolution  and are easy to use. In  addition  the option  of  multiplexing  dif-
ferent  colors  can increase efficiency,  offsetting  the cost of  primer  synthesis.
Two  sets of primer  label are available  from  Applied  Biosystems, using filter
set A or B. The original  set comprises FAM,  JOE, TAMRA,  and ROX,  seen as
blue,  green,  yellow,  and  red,  respectively,  on  filter  set A.  These  dyes were
coupled  to oligonucleotides  by an aminolink  and required  extensive  purifica-
Automated  Genotyping  in  Diagnosis  189
tion, with  consequent loss of yield.  A second set of  labels comprises of  GFAM,
TET,  HEX,  and  TAMRA,  which  are  seen as blue,  green,  yellow,  and  red,
respectively,  on  filter  set B.  6-FAM,  TET,  and  HEX  are  each  available  as
amidites  and can be attached to the oligonucleotide  during  synthesis. 6-FAM
and FAM  can each be detected as blue with  filter  set A or B, and HEX  and JOE
have  similar  fluorescent  properties  appearing  as green on filter  set A  and yel-
low  on filter  set B. The  advantages of  the amidite  dyes is that primers  can be
used  straight  off  the  column  following  ethanol  precipitation,  provided  high
efficiency  synthesis was achieved  during  synthesis. We have  successfully car-
ried  out multiplex  PCR amplifications  using  ethanol-purified  eluate. If  neces-
sary further  purification  can be achieved  using an oligonucleotide  purification
cartridge  (Applied  Biosystems) or  by  reverse  phase HPLC,  but  each method
loses over  50% of  the product.
Fluorescent  dyes are unstable in  ammonia  and should  be stored either  fro-
zen, as solid, or in 50% glycerol  at -2OOC. We have maintained  stocks of pooled
primers  (approx  20 pmol/pL  of  each primer)  for  multiplex  PCR in  50% glyc-
erol  for  over  12 mo at -2OOC. Labeled  primers  are used in  IO-PL  reactions  at
concentrations  of  between  2.5 and  10 pmol.
3.1.2.  Incorporation  of Labeled  dNTPs
Incorporation  of  fluorescent  dNTPs  has the advantage  that existing  primers
can be used. Labeling  by incorporation  may become the method of choice when
very  high  resolution  is not essential. Fluorescein-  and rhodamine-labeled  dUTP
are  available  from  Amersham.  Applied  Biosystems  are  developing  fluores-
cently  labeled  dNTPs  for  detection  of  allele  expansions by  PCR, since the re-
duced efficiency  by which  larger  alleles are amplified  will  be compensated by
increased levels  of  incorporation  in the expanded alleles.
3.2.  PCR
3.2.1.  Basic  PCR
The essential differences  between PCR for  fluorescent detection and PCR for
radioactive  detection are that less primer  and fewer  cycles are used for  fluores-
cent detection. This has the advantages of faster reaction times and reduced cost.
1.  PCR is carried out in a total reaction volume of  10 pL with 2.5-10 pmol of each
primer, 1X Taq  reaction buffer, 200  pMdNTPs,  0.25  U  of  Taq  DNA  polymerase,
and  100  ng  of  DNA  One  of  the  primers  has a fluorescent  dye  attached  to  the  5’
end  (see Section 3.1.1.), and the other primer is unlabeled. Hot start PCR (I)  is
always  used  and  between  22  and  25  amplification  cycles  are carried  out.
2.  When  the  reaction  is  complete  an  equal  volume  (10  pL)  of  formamide-loading
buffer  is added and the products are either stored at -2OOC or used immediately
(see Note 3).
190  Noble  et al.
3.2.2.  Multiplex  PCR  of  Microsatellites
For  PCR of  microsatellites  a two-step  reaction  is used where  the annealing
and extension  steps are carried  out  at the same temperature  (2).  To  optimize
PCR for  the multiplex  of  microsatellites:
1.  Various  annealing/extension  temperatures  are tried  and the  temperature  at which
all  the  mlcrosatelhtes  amplify  sufficiently  is  chosen.
2.  Imtially  the  same  concentration  of  each primer  is used.  The  concentration  of  the
primers  then  is  adjusted  so that  the  peak  heights  of  the  PCR  products  for  each
primer  pair  are of  similar  intensities  (see Note  4).
3.2.3  PCR  of  Trinucleotide  Repeats
For  the  amplification  of  the  trinucleotide  repeats  associated  with  fragile  X
syndrome,  myotonic  dystrophy,  and  Huntington’s  disease  (HD),  the  following
modlficatlons  to the PCR conditions  are made (see Note  5).
1  DMSO  is added  to  the  reaction  buffer  to  a final  concentration  of  10%  (v/v).
2.  Low  G  dNTPs  and  7-deaza-2’-dGTP  are added  to  the  reaction  mixture  instead  of
the  standard  dNTP  mix  for  amplification  of  the  trinucleotide  repeats  associated
with  fragile  X  syndrome  and  HD.
3.  A  1 0-min  denaturation  step before  the start of the cycles is used for amplification  of
the trinucleotlde  repeats assoctated with  fragile  X  syndrome  and HD
3.3.  Plate  Cleaning  and  Gel  Casting
Plate cleaning and gel casting is carried out as described in the user’s manual.
It  is  essential  that  the  plates  are  as clean  as possible;  any  particles  (dust,
acrylamide,  grease) that may fluoresce  must be removed  (see  Note  6).  Three
different  sizes of  glass plates, 6-,  12-, and 24-cm well-to-read  lengths and two
sizes of  comb,  24  or  36  wells,  are available  for  use (see Note  7).  Approxi-
mately  35 mL  of  6%  acrylamide  gel  solution  with  250  pL  of  10% APS and
25  pL  of  TEMED  are used for  a 12-cm well-to-read  gel (see Note  8). The  gel
can be used 1 h after  casting.
3.4.  Gel  Running
3.4.1.  Setting  Up  the  Genescan  Collection  and  Analysis  Software
The  Genescan 672  software  is divided  into  two  programs,  Genescan (GS)
Collection  and Genescan (GS)  Analysis.  The  two  programs  are linked  by  the
name of the run. The former  is responsible  for  collecting  data generated during
a run,  this  information  is  stored  in  a raw  gel  file.  For  each  run,  GS  Analysis  is
set up to process the data from  that particular  gel, which  is then transferred  into
a gel file  and, on further  analysis a results file  is created.
Automated  Genotyping  in Diagnosis  797
The  computer  linked  to the 373 DNA  Sequencer can be programed  to auto-
matically  open the GS Collection  and Analysis  files  on startup (see Note  9).
Once these files  are open the essential steps for  collection  are:
1.  Name  the  collection  file.
2.  Set the run time.
The GS Analysis  program  initially  preprocesses the raw  gel data to produce
a gel file  that subsequently can be analyzed. The  program  launches automati-
cally  at the end of  the run,  therefore,  the preprocess parameters have  to be set
up before  the start of  the run.
The  essential steps are:
1.  Set  up  and  fill  m  the  sample  sheet.
2.  Define  the  preprocessing  parameters,  including  the  matrix  standards  (see  Sec-
tion  3.4.2.).
All  the above  steps are carried  out  as described  in  the user’s  manual  (see
Note  10).
3.4.2.  Matrix  Standards
On preprocessing,  672 GS software  converts  fluorescent  signals to different
colored  peak  intensities  by comparing  the signals detected with  Matrix  stan-
dards (Applied  Biosystems). Matrix  standards are obtained  by loading  the 373
with  standard reagents labeled  with  each of  the different  fluorochromes.  The
ongmal  dye-primer  sequencing set of FAM,  JOE,  TAMRA,  and  ROX  were  the
first  dyes available  and are used on early GS applications.  They  can be prepro-
cessed using  the instrument  matrix  standard (which  was actually  designed for
sequencing)  but  ideally  a matrix  tile  should  be set up  for  the GS rather  than
sequencing application.  Newer  primers  usually will  be made by the use of  fluo-
rescent amidites. These are currently  available  as 6-FAM,  HEX,  and TET.
3.4.2.1.  DYE  PRIMER  MATRIX  STANDARDS
These  are  FAM,  JOE,  TAMRA,  and  ROX  and use filter  wheel  A.  ROX
usually  is reserved  for  size standards.
1.  Before  use, heat  the  samples  to  50°C  for  10 min,  mix  well,  and  centrifuge  briefly.
2.  Mix  2.5  uL  of  matrix  standard  wrth  2.5  pL  of  formamide,  denature  at  90°C
for  2  min,  chill  on  ice,  and  load.
3.  The  matrix  calculation  is performed  as an option  on  the  672  analysrs  program.
3.4.2.2.  FLUORESCENT AMIDITE  MATRIX  STANDARDS
These are 6-FAM,  TET,  HEX,  and TAMRA  and use filter  wheel  B. TAMRA
usually  is reserved  for  size standards. Load  and  calculate  as described  (see
Note  11).
192  Noble  et a/.
3.4.3.  Setting  Up  the  373
The  electrophoresis  parameters, including  run time  and the filter  set corre-
sponding  to  the  dyes being  used, must be  selected prior  to  electrophoresis.
These are selected as described in the user’s manual.
3.4.4.  Preparing  the  Gel  for  Loading
Once  the gel  has set, it can be placed  in  the  373  electrophoresis  chamber
and prepared  for  loading.  This  is carried  out as described in the user’s manual.
The  plates are scanned by the laser prior  to loading  to check that there are no
signals produced  by particles  fluorescing  on the plates or in the gel.
The  steps are as follows:
1.  Scan the plates.
2.  Clean if  required (see Note 12).
3.  Assemble the buffer chambers, remove the comb, and add 1X TBE running buffer.
4.  Prerun the gel for at least 10 mm prior to loading (see Note 13).
3.4.5.  Sample  Preparation  and  Gel  Loading
The  samples are mixed  with  an internal  lane  standard prior  to  loading  (see
Note  1).
1  Mix 4 pL of PCR product containing loading buffer  with  1 pL  of standard.
2.  Heat  to  95T  for  2 min  to  denature
3.  Cool  on  ice.
4.  Stop  the  prerun  on  the  373.
5.  Flush  the  wells  with  runnmg  buffer
6.  Load  1.5 pL  of denatured  sample  per  well  using  a microcapillary  flat  tip  pipet  tip.
7.  Start  the  run  on  the  373.
8.  Start data collection on the Apple Macintosh.
3.5.  Data  Analysis
3.5.1.  Creating  the  Results  File
3.5.1.1.  GEL  ANALYSIS
The preprocessing  that occurs immediately  after  a run automatically  creates
a gel file  that,  on subsequent analysis, allows  the results file  to be examined.
Both these files are placed m a folder  that is identified  by the run name and date.
All  the unprocessed information,  received  direct  from  the 373, is stored in a
raw  gel  file.  If  necessary, this can be repreprocessed with  newly  defined  pre-
process parameters  by  double  clicking  the  raw  gel  file.  The  gel  file  is  then
placed in a new  folder  of  the same title appended with  , 1, .2, and so on for  each
new folder.  This  function  allows  alteration  of the gel file,  for  example, to allow
previously  cut off  size standards to be included  in the analysis.
Automated  Genotyping  in Diagnosis  193
After  preprocessing,  an analysis control  panel is displayed.  Before  analyz-
mg the lanes on the gel check that:
I.  The  lanes  are tracked  correctly.
2  The  size  standards  have  been  assrgned correctly  (if  automatically  defined).
Both these functions  are made easier by adjusting the gel contrast (gel menu),
which  makes the red  dye of  the  standards and the dyes of  the  PCR products
easier to vlsuahze.  These are carried  out as described m the user’s manual.
We use the third-order  least squares method to size PCR products, as previ-
ously  described.  This  sizing method  gives  accurate and reproducible  results;
we have  found  that sizes are generally  within  1 base for  duplicates both within
and between gels (3). It  1s rmportant to make sure that at least one standard band
passes the laser after the largest PCR product to enable accurate size calculation.
3.5.1.2.  ELECTROPHORETOGRAM RESULTS
Once the  lanes have  been  analyzed the electrophoretogram  results can be
examined  and used to  score peak sizes. Failure  to size peaks is usually  due to
an anomaly  in the size standards of  that particular  lane. This  can be confirmed
by selecting  “define  new”  on the analysts panel and naming  the lane in  ques-
tion.  The  values  can be altered if  necessary, for  example:
1.  If  a  split  peak has occurred: The minor peak generated can be assigned as zero
and this lane is then reanalyzed alone.
2  If  a lane  has a high  background  level  for  the  red  dye,  creating  false  peaks  m  the
size  standards.  The  threshold  level  for  recognition  of  this  color  can be increased
in  the  “maximum  peak  heights  per  dye”  section  of the  analysis  parameters.  Srm-
ply  increase  the  value  for  red  to  above  the  default  value  of  50 (1.e , to  150-200)
and  reanalyze  this  lane  alone.
3.5.1.3.  HELPFUL  FEATURES
1  Electrophoretograms  are automatically  scaled  to  the  size of the  largest  peak.  The
Data  Scaling  application  m  the “view”  menu  allows  smaller  peaks to be examined.
2  Peaks  that  are close  together  can be resolved  usmg  the  Zoom  application  also  m
the  “view”  menu
3.  In  order  to  compare  lanes  (e.g.,  to  look  for  sample  carryover)  they  can be  super-
imposed  Altering  the  color  of one  of the  lanes  then  allows  easy visualization.
All  of  the preceding  features are described in  the user’s manual.
3.5.1.4.  PROBLEMS  ENCOUNTERED
1.  Overloading or overamplification of samples: This may produce broad peaks that
cannot  be  sized,  because  the  program  splits  the  broad  peak  into  several  peaks
with  different sizes This problem can be overcome by diluting the sample (e.g.,
1 m  5) in  loading  buffer.  Overamphfication  also  generates  extra  peaks  m  addition
to  the  mam  product.
194  Noble  et al.
2  With  the  new dyes  (6-FAM,  TET,  HEX,  and  TAMRA)  TAMRA  is  reserved  for
size  standards  m  most  cases  When  used  as  a  primer  label  (coupled  via  an
ammolink)  we have  found  that  it  can be unstable  and  cause arttfactual  peaks.  The
effect  can be reduced  by ethanol  precipitation  of the primers  leaving  free TAMRA
m  solution  For  this  reason  we prefer  not  to  use TAMRA-labeled  primers
3  Some  mtcrosatellites  (D15S113  [see Section  3.7.7.1  and  F8C  IVS13  [see Section
3 7  6 1) have  been  found  to  be prone  to  a stzing  artifact  whereby  PCR  products
differ  by  1 base (Fig  2)  It  1s possible  that  this  artifact  is caused  by  the  termmal
transferase-like  activity  of  Tug polymerase  This  artifact  makes  allele  asstgn-
ment  within  families  dtfficult  and  there  is a danger  that  results  could  be misinter-
preted  because  of  it.  If  this  occurs  mformation  is  not  used  from  the  markers.
3.5.2.  Scoring  Results,  Checking  Procedures,  and  Quality  Control
The  operator  who  has set up the run reads the result initially  (see Note  14).
The scoring  of  the alleles is then checked independently.  The following  factors
are taken mto account for  both  scoring and checking.
1.  Peak  height  A  mmimum  peak  height  of  50  is used.  If  the  peak  height  is  low
(50-150)  the  electrophoretograms  from  the  two  neighboring  lanes  are taken  mto
consideration  to exclude  the possibiltty  of lane-to-lane  contamination.  If  the peak
height  of the  majority  of the  samples  on  the  gel  1s high  (3000-4000)  the  samples
with  low  peak  heights  (50-150)  are repeated
2.  Negative  control.  If  there  is  slight  contamination  of the  negative  control  the  peak
height  of  the  preceding  lane  is taken  mto  consideration  (see Note  15)
3  Other  controls*  For  example,  a delta  F508  heterozygote  control  is  included  for
each delta  F508  PCR
4.  Sample  information*  The  names  on  the  lane  and  on  the  PCR  worksheet  are
cross-checked  to  ensure  the  correct  result  is recorded  on  the  PCR  worksheet
3.5.3.  Archiving  Data
Once all the analysis IS complete (mcluding  the checking  of  results) a file  is
prepared  for  storage  on  an optical  disc. The  raw  gel  file,  sample  sheet, and
processed gel tile  are deleted and the results file  IS archived  so that a record  of
the results IS always available  from  any run.
3.6.  Defection  of  Mutations
Detection  of  mutations  is becoming  an essential part  of  the  core  work  of
Clinical  Molecular  Genetics. Many  of  the  popular  methods  (SSCP, DGGE,
chemical  cleavage  of  mismatches) have  been adapted for  fluorescent  analysis.
Of  these, probably  chemical  cleavage  has  produced  the  most  impressive  results
so far,  since both strands can be labeled and essentially all mutations  should be
revealed  (4). Nevertheless,  the method IS labor  intensive  and uses toxic  chemi-
cals. We have  developed  a technique  that should give  analogous results, using
enzymatic  procedures  (see Section 3.6.2.)  (5).  For  easy detection  of  known
mutations, we have used competitive  priming  using differentially  labeled primers.
Automated  Genotyping  in  Diagnosis  195
3.6.1.  Nuorescent  Detection  of  Known  Mutations
Using  Competitive  Hybridization  and  Priming  (Fluorescent  ARMS)
The ARMS  technique (6) in its usual format requires two sets of tubes to mom-
tor amplification  using primers designed to detect wild-type  and mutant sequences
(see Chapter 5).
Designing  reliable  primers  and  optimizing  condltlons  can be  difficult  for
conventional  ARMS  tests. By  including  both  wild-type  and  mutant  primers
labeled  wrth  different  fluorochromes  in  the  same reactlon,  the test becomes
much more robust. This  is presumably  because the primers  compete with  each
other  not only  at the primer  extension  step, but  also at the hybridization  step.
The  increase in  specificity  1s so marked that the usual strategy of  deliberately
mismatching  the  3’ position  IS not  essential. The  method  described  here was
adapted to detect a sequence polymorphism  in human hMSH2  (7).
1  Carry  out  PCR  m  a  total  reaction  volume  of  20  pL  with  10 pmol  of  all  three
primers,  1X  Taq reaction  buffer,  200  fl  dNTPs,  1 25  U  Tuq DNA  polymerase
(essential  to  have  no  3’–5’  proofreadmg  activity),  and  50 ng  of DNA.
2.  Use hot  start PCR  and set the anneahng  and extension  steps to the same temperature
A single peak is seen at 285 bases (Fig. 3); either green for  wild-type  or blue
and  green  for  variant/wild-type  heterozygotes. Variant  homozygotes  (so  far
not  seen) would  appear as blue peaks only.
3.62.  Detection  of  Unknown  Mutations  Using  the  MutEx  Assay
The MutS-Exonuclease (MutEx)  assay depends on the ability  of the mismatch
binding  protein  that  attaches to  heteroduplex  molecules  at  the  srte of  mis-
matches (point  mutation  or  l-4  base insertion/deletions)  and protects the mol-
ecule from  processive  exonuclease attack (5).
1.  Conduct  PCR  as normal  and  check  for  the  presence  of  a product  using  agarose
gel  electrophoresis
2.  Exchange  the PCR  buffer  including  dNTPs  for exonuclease  buffer  by centrifugal
dialysis  (Centricon  100).
3.  Form  heteroduplexes  by heating  to  95°C  then  coolmg  to  65°C  at  1°C every  40 s.
4.  Add  4 pmol(5  pL)  MutS  to 2 pmol  of heteroduplex  DNA  on ice  m  a final  volume
of  12 pL.  The  magnesium  concentration  1s adjusted  to  8 rruI4.
5.  After  15-60  min  on  ice  add  10-l  5 U  of T7  DNA  polymerase  and  leave  the  tubes
on  ice  for  a further  1 min.
6  Transfer  the  tubes  to  a 37’C  water  bath  for  3 mm
7.  Add  an equal  volume  of formamide  loading  buffer  and  store the  samples  either  at
-20°C  or  denature  and  load  immediately  onto  a gel  as described  previously
The  results show clear peaks corresponding  to wlthm  20 bases of  the muta-
tion  with  low  background.
196  Noble  et  al.
p-d-4  .rL
D15.S..  DlSSlO  GABRB3
Fig.  2.  Electrophoretogram  of  the  sizing  artifact  observed  with  D 15s  1 13. The  PCR
products  from  separate  amplifications  of  one  individual  have  been  superimposed.  The
red  and  pink  peaks  are  from  one  amplification  and  the  blue  and  green  peaks  are  from
the  other.  The  PCR  products  from  Dl5SIO  and  GABRB3  are  identical  in  size  and
superimpose  exactly.  The  PCR  products  from  Dl5Sl  13 are  not  identical  in  size  and  do
not  superimpose  exactly;  the  alleles  vary  in  size  by  I  base.
Fig.  3.  Electrophoretograms  of  PCR  products  obtamed  with  Fluorescent  ARMS.  A
smgle  peak  (285  bases)  is  seen  m  the  green  channel  only  for  homozygote  wild-type
and  a  stngle  peak  (285  bases)  IS seen  in  both  the  blue  and  the  green  channels  for  vart-
antiwtld-type  heterozygote.
Automa  ted  Geno  typing  in  Diagnosis  197
3.7.  Applications:  The  Use  of  the  373  DNA
Sequencer  and  Genescan  672  Software
in  the  Diagnostic  Molecular  Genetics  Laboratory
The  use of  the 373  DNA  Sequencer and GS 672 software  m the diagnostic
molecular  genetics  laboratory  allows  for  rapid  automated  genotyping.  Two
approaches are used routmely:
1.  The  detection  of  known  mutations  (deletions,  trmucleotlde  repeat  expansions).
2.  Linkage  analysis  using  highly  polymorphic  microsatellites  markers  (8)
Protocols  for  the diagnosis  of  cystic fibrosis,  Duchenne  muscular  dystro-
phy, myotonic  dystrophy, fragile  X  syndrome, HD,  Hemophilia  A, Prader-Willi
syndrome, Angelman  syndrome, familial  adenomatous polyposis,  and familial
breast/ovarian  cancer have  been  developed.  A  protocol  has also been  estab-
lished  for  identity  testing.
3.7.1.  Cystic  Fibrosis
A multiplex  reaction is used which  contains primers  for  the region  spanning
the  delta  F508  deletion  in  exon  10  of  the  cystic  fibrosis  transmembrane  regula-
tor  (CFTR)  gene (9)  and the intron  8 (10)  and mtron  17 b microsatellites  (II)
(Fig.  4). The microsatellites  are useful  for  linkage  analysis if  delta F508  is not
the mutation  present m the family.
3.7.2.  Duchenne  Muscular  Dystrophy
A multiplex  reaction  is used that contains primers  for  microsatellites  within
and flanking  the dystrophin  gene. The  microsatellites  flanking  the dystrophm
gene are 3’CA,  S’DYS  I,  and  S’DYS II  and the  intragemc  microsatellites  are
STR44,  STR45,  STR49,  and  STRSO (in  mtrons  44,  45,  49,  and  50, respec-
tively)  (12-14).  Microsatellites  with  PCR products of  similar  sizes are labeled
with  different  dyes  allowmg  unambiguous  detection  (Fig.  5).  The  micro-
satellites are used  for  prenatal  diagnosis  where  no  deletion  is present  in  the
family  and  for  carrier  detection  by  linkage  analysis. The  intragenic  micro-
satellites  have  proved  to  be useful  for  determining  carrier  status in  at-risk
females  from  either  apparent  nonmheritance  of  alleles  or  heterozygosity  at a
deleted site previously  characterized in the proband.
3.7.3.  Myotonic  Dystrophy
Primers to amplify  the CTG  triplet  repeat present in the Myotonin  gene are
used (15). Alleles  within  the unexpanded range and minimally  expanded alleles
are detected. Minimal  expansions are less intense than unexpanded  alleles and
show  stuttering  (peaks  3 bases apart)  of  the  repeated  unit  (Fig.  6).  (Larger
expansions are detected by Southern blotting.)  PCR is used as a screen to iden-
tify  most unaffected  individuals  (two  unexpanded alleles)  and only individuals
with  one unexpanded  allele  are analyzed with  Southern  blotting.
198  Noble  et  al.
F508  IVS-8  IVS-17b
Fig.  4.  Electrophoretogram  of  PCR  products  from  the  CFTR  multiplex.  The  mdt-
vidual  1s heterozygous  for the  delta  F508  deletion  (96  and  99 bases) and  heterozygous
for  alleles  of the  IVS-8  and  IVS-  17b mtcrosatelhtes
130  240  Bases
3’  CA  STR  .i5  5’CA-I  STR  44  5’  CA-If  SIR49  sTR50
Fig.  5.  Electrophoretograms  of  PCR  products  from  the  DMD  microsatellite  multi-
plex.  The  electrophoretograms  obtained  from  each  channel  have  been  superimposed.
The  blue  channel  shows the  alleles  from  STR44  and  STRSO,  the  green  channel  alleles
from  STR45  and  STR49  and  the  yellow  channel  alleles  from  the  flankmg  markers
3’CA,  S’DYSI,  and  S’DYSII.
Automated  Genotyping  in  Diagnosis  199
,86  ,106  ,126  ,146  ,166  ,186  ,206  ,226  p46  ,266  SC36  ,306  ,326  ,346  ,366  $86  ,406  ,426.,4$6  ,466
2400
2000
1600
1200  //
800
400
0  “”I.^-  .?..A-,  SCJ  L.-&-,-.—-.–  ,-,-d+  *…  –  –+…..  –..,-  L_”  —  ^__-……”  ^  ee,.x  J
Fig.  6. Electrophoretogram of PCR products from the CTG  repeat present m the
Myotonin gene. The first peak 1s from an unexpanded allele (about 17 repeats) and the
second  peak  IS from  an expanded  allele  (about  68 repeats).  The  expanded  allele  is less
intense  than  the  unexpanded  allele  and  shows stuttering,  with  peaks  3 bases apart,  of
the  repeated  unit
3.7.4.  Fragile  X  Syndrome
Primers to amplify  the CGG  triplet  repeat assoctated with  the fragrle  X  syn-
drome  are  used  (16),  Alleles  within  the  normal  range,  6-56  repeats,  are
detected. Expanded  alleles  above  approx  70 repeats will  not be detected  and
Southern analysis is used to detect these. As with  myotonic  dystrophy,  PCR is
used to screen out most unaffected  individuals  (one unexpanded allele  m males
and two  in females)  prior  to Southern analysis.
3.7.5.  Huntington  Disease
Primers  to amplify  the CAG  triplet  repeat present in  the HD  gene are used
(17).  Both  unexpanded  and expanded  alleles are detected (the expansions  are
smaller than those associated with  myotonic  dystrophy  and fragile  X  syndrome)
and PCR is used for confirmation  of diagnosis and predictive  testing.
3.7.6.  Hemophilia  A
Primers to amplify  the microsatellite  present in intron  13 of  the factor  VIII
gene are used for  carrier  detection by linkage  analysis (18).
3.7.7.  Prader-  Willi and  Angelman  Syndrome
A  multiplex  reaction  is used to  amplify  five  microsatellites  that  span the
region  of chromosome  15, 15ql l-l  3, where the loci  for  these two  disorders  lie.
The markers are D15S113, D15S10, D15Sl1,  GABR133, and GABRAS  (19-23).
Haplotype  construction  in  the affected  individual  and their  parents can allow
the detection  of  deletions  and uniparental  disomy.
200  Noble  et  al.
3.7.8.  Familial  Adenoma  tous  Polyposis
A  multiplex  reactlon  1s used to  amplify  four  mlcrosatelhtes  CB83,  CB26,
DP 1, and MCC  (24-2  7)  High-risk  haplotypes  can be established within  fami-
lies allowing  predictive  tests for  at-risk  family  members.
3.7.9.  Familial  Breast/Ovarian  Cancer
Primers  for  three  mlcrosatellttes  THRAl,  D17S857,  and D17S579  that are
m the region  of  chromosome  17q where  the BRCAl  gene is located  are used
(28-30,  These  primers  are not  multiplexed  as they  ampltfy  under  different
conditions.  High-risk  haplotypes  can be established within  families  allowing
predictive  tests for  at-risk  family  members.
3.7.10.  ldentlty  Testmg
A multiplex  reaction  has been designed for  use in cases when  inheritance  or
sample  mix-up  is being  queried.  The  multiplex  consists of  five  primer  pairs
that ampli@ D21S11, D13S308, AMGL,  and MBP  on chromosome 18 (31-34).
The  AMGL  marker  is used to confirm  the sex of  the sample. The  other  highly
polymorphic  markers are used to clarify  the identity  of the sample. These mark-
ers are trinucleotide  and tetranucleotide  repeats (see Note  16).
4.  Notes
1.  The  Genescan-  ROX  and  Genescan-  TAMRA  standards  are used  rou-
tinely  These  have  been  developed  for  use with  6%  denaturing  polyacrylamlde
gels  and  detect  products  in  the  range  50-500  bases  Further  standards  are  also
available;  the  Genescan-  ROX  and  350  TAMRA  standards  have  been  used
recently.  These  standards  contam  fragments  ranging  m  size  from  50-350  bases
and are useful  for  detectmg  shorter PCR  products,  for example,  the delta  F508  dele-
tion  In  addition,  the use of a standard with  the  largest  fragment  of 350  bases allows
the option  of reusing  the polyacrylamlde  gel  once the largest fragment  has migrated
past  the laser.  The  choice  of standard  depends  on  the  fluorescent  dyes used  m  the
PCR  and the  size of the  PCR  products.  In  addition  sufficient  pomts  are needed  on
the  calibration  curve  for  accurate  sizing,  at least  one  point  above  the  size  of  the
largest  product  to  be  detected  1s necessary  We  have  found  that  third  order  least
squares approximation  for  calculating  the  standard  curve  works  adequately.  Mix
the  standards  thoroughly  before  use.
2  In  order  to  fully  support  the  Genescan  software  and  analyze  all  the  data  gener-
ated,  we  found  that  an  additional  Macmtosh  Quadra  computer  was necessary,
along  with  a color  printer  and  read/write  optical  disk  drive  for  archiving  data.
More  recently,  a third  Quadra  has been  added  to  the  network,  with  all  the  com-
puters  lmked  up by  ethernet  for  rapid  transfer.  Potential  users are advised  to  dis-
cuss computer  optlons  with  Applied  Biosystems,  since  the  product  range  of both
Apphed  Biosystems  and  Apple  Computers  are  subject  to  frequent  changes.
Automated  Genotyping  in Diagnosis  207
3.  We  have stored PCR  products in  loading  buffer at -20°C  for up to 2 wk with  no effect
on stability.  However,  PCR  products mixed  with size standards are not  stored at -2O’C.
4.  In  a multiplex  reaction  some  PCRs  are  intrinsically  less efficient  than  others  in
reaction  conditions  that  are suboptimal  for  some  primer  pairs.
5.  The  trinucleotide  repeats  associated  with  these  conditions  are  G-C  rich.  This
affects the  efficiency  of  the  PCR  owing  to  secondary  structure  of  the  DNA  frag-
ments.  Reagents  which  reduce  the  effect  of  the  secondary  structure  such  as
DMSO  and  7-deaza  dGTP  are therefore  added  to  the  reaction  mixture.  We  have
found  that  the  DNA  must  be  in  solution  and  samples  are  occasionally  heated  to
55°C  prior  to  amplification  if  a result  is urgently  needed.
6.  When  the  plates  are  submerged  m  the  Alconex  solution,  gently  rubbing  the  sur-
face  of the  plates  with  the  fingertips  is enough  to  dislodge  any  grease.  To  speed
up  plate  drying,  a hairdryer  can be used. Tape  the  plates  together  so that  the  same
sides  of  the plates  are always  on the  inside.
7.  The  well-to-read  length  (the distance  the  fragment  migrates  before  being  detected
by  the  laser)  can  be  varied  to  suit  the  resolution  desired.  A  6-cm  well-to-read
length  will  give  2  base resolution  in  1.5 h  and  a 24-cm  well-to-read  length  will
give  1 base  resolution  in  5  h.  A  well-to-read  length  of  12 cm  was found  to  be
adequate  for  most  applications,  including  microsatellites  and  trinucleotide
repeats.  The  optimal  run  time  should  also  be taken  mto  consideration.  The  use of
the  12-cm  well-to-read  plates  allows  up  to three  runs per  day.  We  have  found  that
by  using  a 36-well  comb  several  PCR  reactions  can be run  on the  same  gel;  that
is,  diseases  can be batched  together.
8.  Any  air  bubbles  in  the  gel  can  be  allowed  to  rise  to  the  surface  of  the  gel  by
holding  the  gel  in  a vertical  position.  They  can  also  easily  be  removed  using  a
“bubble-getter”  (Promega,  Madison,  WI)  or  by  gently  tapping  the  gel  plates.
Drawing  the  gel  solution  into  a 30-mL  syringe  and inJecting  it  between  the  plates
allows  more  even  casting  and  prevents  overflow.
9.  The  GS  Collection  and Analysis  files  both  have alias  files.  By  dragging  these tiles
into  the start-up  alias  icon  they  are both  automatically  opened  when the computer  is
switched on and the GS  Collection  tiles  for map,  scan, and gel are displayed
10.  The  GS  quick  reference  card  is  very  useful  when  setting  up  the  Collection  and
Analysis  programs
11.  JOE  and  HEX  have  similar  fluorescent  characteristics,  and  can  be  interchanged
provided  that  very  accurate  quantitation  is not  essential.  They  appear  as green  on
filter  set  A  and  yellow  on  filter  set B.  FAM  and  6-FAM  are  also  similar,  both
appear  as blue  on  filter  A  or B.
12.  Scan  the  plates  prior  to  adding  the  running  buffer  to  the  buffer  chambers  so
they  can  be  easily  removed  if  necessary.  If  the  plates  are dirty  the  easiest  way
to  clean  them  is  to  wipe  across  the  region  that  1s scanned  by  the  laser  with
laboratory  tissue  moistened  with  distilled  water.  Start  m  the  middle  of the  plate
and  wipe  toward  the  edges.  If  this  does not  remove  the  dirt  take  the  plates  out  of
the  373  and  wash the  outer  surface  with  running  tap  water,  rinse  with  distilled
water,  and  dry.  Repeat  the plate  check.
202  Noble  et  al.
13.  With  practice,  loading  the  gel  is relatively  easy, however,  it  can be difficult  to  see
the  wells.  Loading  buffer  can be run  mto  the  gel  wells  prior  to prerunning  the  gel.
This  makes  the  wells  much  easier  to  see for  sample  loading.
14.  We  have  found  that  this  1s best  done  by  showmg  the  desired  electrophoretogram
and  selecting  with  the  mouse  the  peak  being  scored.  The  size  of  the  peak  1s
highlighted  m  the  table  and  this  data  can  then  be  recorded  on  the  worksheet.
The  average  of  the  duphcates  is taken  and  recorded  (The  size  is given  m  bases
but  we  actually  record  the  result  as basepairs.)  Prmting  the  data  for  each  elec-
trophoretogram  proved  uneconomical  with  respect  to  the  amount  of  paper
used  and  also,  “eyeballing”  the  size  of  the  peak,  among  all  of  the  data  in  the
table,  was  not  always  easy.
15.  Contamination  1s generally  carry  over  from  loading  of  the  previous  lane.  The
negative  control  is accepted d  the PCR  products  are identical  to those in  the preced-
mg  lane  and  if  the  peak  height  is  <lOoh  of that  of  the  preceding  lane
16.  Slippage  synthesis of simple  sequence DNA  1s a well-known  phenomenon  (35) and
probably  explains  why microsatellites  are polymorphic.  PCR  products  are also  sub-
Ject  to  slippage  synthesis  durmg  amplification  which  produces  artifact  (shadow)
bands. For  dinucleotide  repeats these shadow bands produce  a two-base ladder  and
with trinucleotide  repeats a three-base ladder  is seen. However,  tetranucleotlde  repeats
are far  less prone  to  this  artifact  and  almost  no  laddermg  is  seen. Tetranucleotide
STRs  therefore  are much  more  robust  since not  only  IS less laddering  seen, but  the
alleles  are separated by four  bases instead  of two and therefore  are easier to resolve.
Acknowledgements
We thank Nigel  Hall,  Mark  Robinson,  Janet Hughes, and Virpi  Laitinen  for
their  valuable  contributions  to  the work  described  here.  We  also  thank  Bob
Mueller  for  his  encouragement  with  this  work.
The  373 DNA  Sequencer was purchased through  the kind  generosity  of  the
George  John Livanos  Charitable  Trust.
References
1.  Horton,  R.  M.,  Hoppe,  B.  L.,  and  Conti-Tronconi,  B.  M.  (1994)  Ampligrease:  hot
start  PCR  using  petroleumJelly.  BioTechniques  l&42,43.
2.  Noble,  J.  S.,  Taylor,  G.  R.,  Stewart,  A  D.,  Mueller,  R.  F.,  and  Murday,  V.  A
(1991)  A  rapid  PCR-based  method  to  distinguish  between  fetal  and  maternal  cells
m  chorionic  biopsies  using  microsatellite  polymorphisms.  Dis.  Markers  9,301-306.
3.  Taylor,  G.  R.,  Noble,  J.  S.,  and  Mueller,  R..  F.  (1994)  Automated  analysis  of
multiplex  microsatellites.  J.  Med.  Gene&  31,937-943
4.  Harris,  I.  I.,  Green,  P.  M.,  Bentley,  D.  R.,  and  Giannelli,  F.  (1994)  Mutation
detection  by  fluorescent  chemical  cleavage:  application  to  haemophilia  B.  PCR
Methods  Apphc  3,268-27  1.
5.  Ellis,  L.  A.,  Taylor,  G.  R.,  Banks,  R.,  and  Baumberg,  S.  (1994)  MutS  bmdmg
protects  heteroduplex  DNA  from  exonuclease  digestion  zn vitro:  a simple  method
for  detecting  mutations.  Nucleic  Acids  Res.  22,27  lo,27  11.
Automated  Genotyping  in  Diagnosis  203
6.  Newton,  C.  R.,  Graham,  A.,  Heptinstall,  L.  E.,  Powell,  S.  J.,  Summers,  C.,
Kalsheker,  N.,  Smith,  J.  C.,  and  Markham,  A.  F.  (1989)  Analysis  of  any  point
mutation  in DNA.  The  amplification  refractory  mutation  system  (ARMS).  Nucleic
Acids  Res.  11,2503-25  16.
7.  Hall,  N.  R.,  Taylor,  G.  R.,  Finan,  P.  J.,  Kolodner,  R.  D.,  Bodmer,  W.  F.,  Cottrell,
S.  E.,  et  al  (1994)  Intron  splice  acceptor  site  sequence  variation  in  the  HNPCC
gene  hMSH2.  Eur  J  Cancer  30A,  1550-1.552.
8.  Weber,  J. L.  and May,  P.  E.  (1989)  Abundant  class of  DNA  polymorphisms  which
can be typed  using  the polymerase  chain  reaction.  Am.  J.  Hum  Genet.  44,388-396.
9.  Taylor,  G. R.,  Noble,  J. S., Hall,  J. L.,  Quirk,  P.,  Stewart,  A.  D.,  and Mueller,  R.  F.
(1989)  Rapid  screening  for  delta  F508  in  cystic  fibrosis.  Lancet  II,  1345.
10.  Estivill,  X.,  Morral,  N.,  Casala,  T.,  and  Nunes,  V.  (1991)  Prenatal  diagnosis  of
cystic  fibrosis  by multiplex  PCR  of mutation  and microsatellites.  Lancet  338,458.
11.  Zielenski,  J.,  Markiewicz,  D.,  Rinisland,  R.,  Rommens,  J.  M.,  and  Tsui,  L.-C.
(1991)  A  cluster  of  highly  polymorphic  dinucleotide  repeats  in  m&on  17b of  the
CFTR  gene.  Am.  J.  Hum  Genet.  49,1256-126  1.
12.  Beggs,  A.  H.  and  Kunkel,  L.  M.  (1990)  A  polymorphic  CACA  repeat  in  the  3’
untranslated  region  of  dystrophin.  Nucleic  Acids  Res.  18,  193 1.
13.  Feener,  C.  A.,  Boyce,  F.  M.,  and  Kunkel,  L.  M.  (1991)  Rapid  detectlon  of  CA
polymorphisms  in  cloned  DNA:  application  to the 5’ region  of the  dystrophm  gene.
Am.  J.  Hum.  Genet  48,621-627.
14.  Clemens,  P.  R.,  Fenwick,  R.  G.,  Chamberlain,  J. S., Gibbs,  R.  A.,  deAndrade,  M.,
Chakraborty,  R.,  and  Caskey,  C.  T.  (199 1) Carrier  detection  and  prenatal  diagno-
sis  in  Duchenne  and  Becker  muscular  dystrophy  families,  using  dinucleotide
repeat  polymorphisms.  Am.  J  Hum.  Genet  49,951-961.
15.  Brook,  J.  D.,  McCurrah,  M.  E.,  Harley,  H.  G  ,  Buckler,  A.  J.,  Church,  D.,
Aburatani,  H.,  et al.  (1992)  Molecular  basis  of myotonic  dystrophy:  expansion  of
a trinucleotide  (CTG)  repeat  at the 3’  end of a transcript  encoding  a protein  kmase
family  member.  Cell  68,  799-808.
16.  Fu,  Y-H.,  Kuhl,  D.  P.  A.,  Pizzutl,  A.,  Pieretti,  M.,  Sutcliffe,  J. S., Richards,  S., et
al.  (1991)  Variation  of  the  CGG  repeat  at  the  Fragile  X  site  results  m  genetic
instability:  resolution  of  the  Sherman  paradox.  Cell  67,  1047-1058.
17.  The  Huntington’s  Disease  Collaborative  Research  Group  (1993)  A  novel  gene
containing  a trinucleotide  repeat  that  is  expanded  and  unstable  on  Huntington’s
disease  chromosomes.  Cell  72,97  l-983.
18.  Lalloz,  M.  R.  A.,  McVey,  J.  H.,  Pattinson,  J.  K.,  and  Tuddenham,  E.  G.  (1991)
Haemophilia  A  diagnosis  by  analysis  of a hypervariable  dinucleotide  repeat  within
the  factor  VIII  gene.  Lancet  338,207-2  11.
19.  Mutirangura,  A.,  Greenberg,  F.,  Butler,  M.  G.,  Malcolm,  S.,  Nicholls,  R.  D.,
Chakravarti,  A.,  and  Ledbetter,  D.  H.  (1993)  Molecular  dissection  of  the
Prader-Willi/Angelman  syndrome  region  (15qll-  13)  by  Y,AC  cloning  and  FISH
analysis.  Hum.  Mol.  Genet.  1,417-425.
20.  Lindeman,  R.,  Kouts,  S.,  Woodage,  T.,  Smith,  A.,  and  Trent,  R.  J.  (1991)
Dinucleotide  repeat  polymorphism  at  D15SlO  in  the  Prader-Willi  chromosome
region  (PWCR).  Nuclex  Acids  Res.  19,  5449.
204  Noble  et al.
2 1.  Mutn-angura,  A.,  Kuwano,  A.,  Ledbetter,  S. A.,  Chinault,  A  C.,  and  Ledbetter,  D.
H.  (1992)  Dinucleotide  repeat polymorphism  at the D15S  11 locus  in  the Angelman/
Prader-Will1  region  (AS/PWS)  of chromosome  15. Hum  Mol.  Genet  1,  139.
22.  Mutirangura,  A.,  Ledbetter,  S., Kuwano,  A.,  Chinault,  A.  C.,  and  Ledbetter,  D.  H.
(1992)  Dinucleotide  repeat  polymorphism  at the  GABA*  receptor  p3  (GABRB3)
locus  in  the  Angelman/Prader-Willi  region  (ASIPWS)  of  chromosome  15. Hum.
Mol.  Genet.  1,67.
23  Glatt,  K  A.,  Sinnett,  D.,  and  Lalande,  M.  (1992)  Dinucleotide  repeat  polymor-
phism  at  the  GABA*  receptor  a5  (GABRAS)  locus  at  chromosome  15qll-q13.
Hum  Mol.  Genet.  1,348.
24.  Breukel,  C.,  Tops,  C , van  Leeuwen,  C , van  der  Klift,  H.,  Fodde,  R.,  and  Khan,
M.  P  (1991)  AT  repeat  polymorphtsm  at  the  D15S122  locus  tightly  linked  to
adenomatous  polyposis  coli  (APC).  Nucleic  Acids  Res  19,6665.
25  van  Leeuwen,  C.,  Tops,  C.,  Breukel,  C., van  der Klift,  H.,  Fodde,  R.,  and Khan,  P
M.  (1991)  CA  repeat  polymorphism  at the  D15S299  locus  linked  to  adenomatous
polyposis  co11 (APC).  Nucielc  Acids  Res  19,5805.
26.  Spirro,  L.,  Joslyn,  G.,  Nelson,  L.,  Leppert,  M.,  and White,  R.  (1991)  A  CA  repeat
30-70  kb  downstream  from  the  adenomatous  polyposis  coli  (APC)  gene.  Nucleic
Acids  Rex  19,6349.
27.  van  Leeuwen,  C.,  Tops,  C.,  Breukel,  C.,  van  der  Klift,  H.,  Deaven,  L.,  Fodde,  R.,
and  Khan,  P.  M.  (199 1)  CA  repeat  polymorphrsm  within  the  MCC  (mutated  in
colorectal  cancer)  gene.  Nucleic  Acids  Res.  19,5805.
28.  Bowcock,  A.  M.,  Anderson,  L.  A.,  Friedman,  L.  S., Black,  D.  M.,  Osbourne-Law-
rence,  S.,  Rowell,  S. E  , Hall,  J.  M.,  et  al.  (1993)  THRAl  and  D17S183  flank  an
Interval  of  <4cM  for  the  breast-ovarian  cancer  gene  (BRCAI)  on  chromosome
17q2 1. Am.  J.  Hum.  Genet  52,718-722.
29.  Anderson,  L.  A.,  Friedman,  L.,  Osboume-Lawrence,  S., Lynch,  E.,  Weissenbach,
J., Bowcock,  A.,  and  Kmg,  M.-C.  (1993)  High-density  genetic  map  of the BRCAl
region  of  chromosome  17q12-q2 1 Genomzcs  17,618-623.
30.  Hall,  J. M.,  Friedman,  L.,  Guenther,  C.,  Lee,  M.  K.,  Weber,  J  L  , Black,  D.  M  ,
and  Kmg,  M.-C.  (1992)  Closing  in  on  a breast  cancer  gene  on  chromosome  17q.
Am.  J.  Hum.  Genet.  50,1235-1242.
3 1.  Sharma,  V.  and  Litt,  M.  (1992)  Tetranucleotide  repeat  polymorphism  at  the
D21S  11 locus.  Hum.  Mol.  Genet.  1,67.
32  Haddad,  L.  A.  and  Pena,  S. D.  J.  (1993)  CAT  repeat  polymorphism  in  a human
expressed  sequence  tag  (EST0044)  (D13S308).  Hum  Mel  Genet.  2,  1748.
33.  Sullivan,  K.  M.,  Mannucci,  A,,  Kimpton,  C.  P.,  and  Gill,  P.  (1993)  A  rapid  and
quantitative  DNA  sex test:  fluorescence-based  PCR  analysis  of  X-Y  homologous
gene  amelogenin.  BioTechniques  15,636.
34.  Polymeropoulos,  M.  H.,  Xiao,  H.,  and Merril,  C. R.  (1992)  Tetranucleotide  repeat
polymorphism  at the  human  myelin  basic protem  gene  (MBP).  Hum  Mol.  Genet
1,658.
35.  Schlotterer,  C. and Tautz,  D.  (1992)  Slippage  synthesis  of simple  sequence  DNA.
Nucleic  Acids  Res  20,21  l-2  15
11
Genetic  Counseling  and  Molecular  Testing
Lauren  Kerzin-Storrar
1. Introduction
The  provision  of  genetic  counseling  should  be  an  Integral  component  to
molecular  diagnostic  testing for  two  important  reasons: The  potential  impact
(medical  and psychosocial)  for  the individual  being  tested and for  then  family
is great (I)  and ensuring  informed  choice is crucial as uptake of  genetic testing
varies  between  conditions  and may be <lOoh (24).  Many  people,  once coun-
seled, choose not to be tested, and this choice might  be lost rf counseling  is not
provided.  Genetic  counseling  is comprehensive  and includes:
1.  Diagnosis and discussion of prognosis;
2.  Explanation of the mode of inheritance and recurrence risks;
3.  Discussion of options, including reproductive and testing;
4.  Facilitating decision making; and
5.  Support toward adjusting to the genetic tmphcatrons.
Genetic counseling  is usually  provided  by medically  trained  clinical  geneti-
cists together  with  nonmedical  genetic  counselors.  In  North  America,  most
nonmedical  genetic counselors have  a masters degree in genetic counseling  or
nursing;  in the United  Kingdom  most are specialist nurses without  formal  train-
ing, although  there is now  an MSc course in genetic counseling  at the Univer-
sity  of  Manchester  open  to  nursing  and  science  graduates  (5,6).  Genetic
counseling  services are organized  on a regional  basis m the United  Kingdom
where  each Regional  Genetic  Service  runs pediatric,  adult,  and reproductive
clinics primarily  for  families  at increased risk. However,  screening at the popu-
lation  level  now  means that elements of  genetic counseling  are being provided
in  other  specialty clinics,  as well  as in  general practice  and community-based
centers (7,s).  In  North  America,  regional  services based in teaching  hospitals
From*  Methods  m  Molecular  Medmne  Molecular  Diagnow  of  Genetz  Diseases
Edlted  by  R  Elles  Humana  Press  Inc  ,  Totowa,  NJ
205
206  Kerzin-Storrar
are also common,  although  smaller  hospitals  and  clinics  may  also provide  a
genetic counseling  service,  along with  disease-specific clinics.
Advances  in molecular  technology,  and the potential  for  diagnostic,  predic-
tive,  carrier,  and  prenatal  testing,  has brought  with  it  a large  increase  in
workload  for  those providing  genetic  counseling,  but  has also reinforced  the
need for  such counseling  to be associated with  the laboratory  provision  of  a
genetic test. It  was probably  fortunate  that the first  uses of  molecular  testing
depended  on  linkage,  as this  necessitated close collaboration  between  those
working  in  the laboratory  and those in  contact with  the families,  not  only  to
clarify  pedigrees and obtain appropriate  blood  samples, but also so that genetic
counselors could  develop  techniques for  explaining  complex  tests to families
in a clear and effective  way. Although  mutation  testing may be more straight-
forward  in  concept, there  are still  many advantages  to retaining  the model  of
Regional  Genetic  Services, which  provide  genetic  counseling  and laboratory
services  “under  one roof.”  This  is not always  possible,  for  example,  where  a
laboratory offers a supraregional service, or a single disease service where samples
come from  clinicians in many centers, however,  at the very  least, clinicians,  gen-
etic counselors, and clinical  molecular  geneticists need to talk to one another!
The  implicattons  and protocols  for  DNA-based  testing  differ  according  to
the  type  of  test, and  this  chapter,  therefore,  considers  diagnostic,  presymp-
tomatic, carrier,  and prenatal testing separately before  addressing more general
issues pertaining  to genetic registers, ethical considerations,  and the emotional
impact for  laboratory  staff.
2.  Diagnostic  Testing
A diagnostic test is one which  confinns  that an affected individual  is suffering
from  a named condition.  This  implies that the patient is showing  symptoms, and
the diagnostic test is often used to confirm  a clinical  diagnosis. In  a clinical  DNA
laboratory,  samples may be received  on boys or men with  muscular dystrophy,
infants with  cystic fibrosis,  adults with  Huntington’s  disease, and so on. In  some
mstances the diagnosis may be firm before DNA  testing, whereas in other instances
the DNA  test is being  used to exclude one of  several  possible diagnoses.
Diagnostic  samples will  often  be received  from  clinicians  outside genetics,
and indeed  genetic counseling  would  not be appropriate  if  a genetic condition
has not  yet  been  confirmed.  However,  where  a molecular  diagnosis  is  then
made, the  laboratory  report  might  include  a statement indicating  the  genetic
implications  of the diagnosis with  the suggestion of referral  of family  members
for  genetic  counseling.
Although  diagnostic  samples are largely  not problematic  from  the point  of
view  of  pre-test counseling,  it is important  that laboratory  staff  are happy that
referring  clinicians  do clearly  indicate  that this is a genuine diagnostic  request
Genetic  Counseling  and  Molecular  Testing  207
for  an individual  already showing  symptoms to avoid  mistakenly  performing  a
presymptomatic  test. Because of  the serious implications  of  presymptomatic
tests for  Huntington’s  disease and other  late onset neurological  disorders  (see
Section 3 .), some laboratories  now  require  an accompanying  consent form  for
Huntington’s  diagnostic  tests, based on the form  originally  devised by the late
Professor  Harding  at the Institute  of  Neurology,  London  (see Fig.  1).
3. Presymptomatic  Testing
Molecular  testing  is a powerful  tool  for  predicting  the  future  health  of  an
individual,  a whole  family,  or potentially  whole  populations.  Predicting  illness
in  advance  of  symptoms is relatively  new  to medicine  and  little  was known
about  the  impact  of  this  use of  DNA  technology.  Concerns  were  therefore
high,  and most predictive  test programs  began as research projects where  both
pre-test  counseling  and  assessment of  long  term  sequelae has been  incorpo-
rated into  study design.
Uptake  of  presymptomatic  testing  is very  low  among  those  at  risk  of
Huntington’s  disease  (2),  but  much  higher  for  conditions  such  as adult
polycystic  kidney  disease (3,4),  and familial  adenomatous polyposis  coli  (4).
The important message is that many at-risk individuals  prefer to remain at risk, and
it is therefore imperative that a presymptomatic test is only performed atIer informed
consent is obtamed. Laboratories  may assume that this has been dealt with  by
the referring  clinician,  but guidelines  are often  helpful.
Because of the concerns related to Huntington’s  disease (given  its particular
combination  of  distressing  features  and lack of  effective  treatment),  national
and international  protocols  (9) have been drawn up for  predictive  testing. These
include the extent of  pre- and post-test counselmg, and a number  of  procedural
assurances including  completion  of  a consent form  (Fig.  2). A particular  point
of  relevance  for  laboratory  staff  is the arrangement  for  communicatmg  results.
An  appointment  for  the results  session is  made  when  the  blood  sample  is
obtained.  Because of  the unacceptable distress caused m these highly  emotive
situations  if  results are not  available  for  the designated appointment,  both  the
laboratory  staff  and  the  genetic  counselors  should  agree  on  a suitable  time
period.  Laboratory  staff  should be informed  of  the result appomtment  date so
that  any problems  encountered  in obtaining  a result  can be communicated  to
clinical  staff  in advance  of  the appointment.  The  at-risk  individual  requesting
the test is informed  that they may change their  mind  right  up until  they arrive
for  their result, and it is therefore  preferable  that clinical  staff in direct commu-
nication  with  the patient are not made aware of  the result until just  before  they
see the patient.  This  can be achieved  by  the report  being  issued in  a  sealed
envelope,  and  laboratory  staff  respecting the need for  discretion  if  a result  is
obtained  well  in advance  of  the result  session.
208  Kerzin-Storrar
CONSENT  FORM
DIAGNOSTIC  TESTING  FOR  THE  I-WNTINGTON’S  DISEASE  MUTATION
I  understand  that  it  IS possible  to  have  a test  to  see whether  or  not  l/my  relative  have/has
Huntington’s  disease,  and I  wish  to  proceed with  this  test.
I  understand  that the test  will  show  one of  the following:
1)  That I/he/she  do/does  have this  condition,  and that my  children  may be at risk  of carrying
the  abnormal  gene
2)  That  I/he/she  do/does  not have/has  HD
3)  That the  result  is  difficult  to  interpret
NAME  (block  capitals).  …………………………………..  ………………………
ADDRESS  ……………………………….  ……………  …..  ………………….  . .
.  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  ..I…  ..*……..*…*………………..  s…….,…..  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .
*……..**…..*………*……,…  . ..*……………..*…..*…  . ..+….  . . . . . . . . . . . . . . . . . .  . . …*…  . .  .
DATE  .  . . . . . . . . . . . . . . . . , . . . . . . . . . . . . . .  HOSPIML  NO  . . . . .  . . .  , . . . . . . .  . . . .  . . . . . .  .  .
Signature  of  patient  . . . . . . . . . . .  . . . . .  . . . . . . . .  . .  * . . . .  . . . . . . . . . . .  .  .  . . . . . . .  . . .  . . . . . . . . . . . .
Signature  of  spouse/partner  . .  . . .  . . . . . . . . . . . .  . ..*……  (not  essentral  but  preferred  If
applicable)
OR  Signature  of  next  of  kin  .  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . , .  . . .  .*.  . . . . . . . . . . . . . . . . . . .  . . .
(if  patient 1s unable to give  informed  consent)
For  medical stafl.
I  have  explained the principles  and implications  of  HD  testing  to  the above,  as detarled in
the supplied  information  sheet,  and have sent  a copy  of  this  form  to  the DNA  laboratory
I  have  reason  to  believe that  he/she has  HD,  as  opposed to  being  at risk  with  (or  without)
unrelated  symptoms
Signature  . . . . . . .  . . . .  . . . .  . . . . , . . . .  . . . . . . . . .  .
Name  in caprtals.. . . . .  . . .  . . . . .  . . . . .  . .  . . .  . .  .  . .
Fig.  1. Example  of  a consent  form  for  use  with  diagnostic  test  requests.
Genetic  Counseling  and Molecular  Testing
PRELXTIW  TEST  CONSEYNI’  FORM
209
I  . . . . .  . . . . . . . .  . .  . . .  . . . .  . .  . . .  . .  . .  .  1.  *……..,
OF. ………………………………………………….  …………..
.  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .*.  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .*..*.  .  .  .  .  .  .  .  .  .  1.  .  .  .  .  .  ..*…
*…….  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  e……  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .  ..*…*…………  .  .  .  .  .  .  .  .  .  .  .  .  .  .  .
hereby  consent  to  undergo  presymptomatic  testing  for  Huntington’s  disease.  I  wish
to  be informed  of  the  result  of  the  test.  I  confirm  that  I  discussed  the implications  of  tins
with  . . .  . . .  .  . . .  . . . . . . . . . . . . . . .  . . . . .  . . .  and  that  the  potential  disadvantages  of  the  test
have been explained to  me.
I  agree/do  not  agree  for  my  family  doctor  (Dr  .  . . . .  . . .  .  .  . . . .)  to  be  informed  of
the  result.  I  understand  that  the  result  of  the  test  will  not  be  conveyed  to  any  other
person  without  my  explicit  permission.
Signed . . . . . . . . . . . . . . . .  . . . . . . . . . . . . .  . . . . . . . .  Date  . . . . * . .  . . . . . .  . . . . . . . . . . . . . . . . .
Fig.  2. Example  of  a consent  form  for  predictive  testing.
Whether  the  particular  case of  Huntington’s  disease can be  extended  to
presymptomatic  testing  for  other conditions  is currently  being  investigated  in
studies looking  at testing  for  familial  adenomatous polyposis  coli,  dominant
breast and ovarian  cancer, and other conditions.  Although  the potential  for  pre-
vention  and treatment  of  symptoms will  influence  recommendations  made for
the appropriate  use of  presymptomatic  tests, it is unlikely  that any presympto-
matic  testing  should  be performed  without  some pre-test  counseling,  formal
consent, and arrangements for  follow-up.
210  Kerzin-Sforrar
Fig.  3. Predictive  test request  for a dommant  condttion  from  an Individual  at 60%  rusk.
The particular  problems that arise when presymptomatic  testing is requested
for  individuals  at  ~50%  risk  where  there  are  living  intervening  relatives  (see
Fig.  3), or for  children  in  late onset disorders,  is discussed in the next  section.
4.  Carrier  Testing
Testing  for  heterozygote carrier  status for  autosomal and X-linked  recessive
conditions  is probably  the most common type of  request for  molecular  testing.
Heterozygote  carrier  testing may be performed  on:
1.  Presumed  obligate  carriers  (parents  of  a  known  affected  chrld,  usually  with  a
view  to  prenatal  diagnosis  in  future  pregnancies),
2.  Those  at  increased  risk  because  of  a family  history  (cascade screening);
3.  Those  at  increased  risk  because  of  their  ethnic  background  (targeted  populatron
screening);  and
4.  Those  at  no  special  risk  (population  screening).
Genetic  counselmg  surrounding  carrier  tests will  obviously  vary  according
to which  of these situations apply. Although  identification  of heterozygote car-
rier  status does not  usually  have  serious  health  implications,  psychological
sequelae to  discovering  that  one carries  an “abnormal”  gene has been  docu-
mented.  Studies of  carriers  identified  on population  screening for  the hemo-
globinopathies  (81, Tay Sachs disease (10, I I),  and cystic fibrosis  (7,12)  suggest
that  carrier  status can affect  psychological  well-being;  decisions  regarding
marriage  and choice of partner;  and stigmatization from  noncarriers,  insurance
companies, and employers. Many  of  these adverse effects  may be the result of
poor  understanding  (both in carriers and in society) about the carrier  state, and
underline  the importance  of  both pre-  and post-test counselmg.
Uptake  of  carrier  testing for  females in families  with  X-lmked  conditions  is
usually  high,  perhaps because of  the significant  implications  for  reproduction
as well  as the severity  of  many X-linked  conditions  (e.g., Duchenne  muscular
Genetic  Counseling  and  Molecular  Testing  211
dystrophy,  fragile-X,  Menkes’  disease, X-linked  hydrocephalus),  but  is also
high  for  less severe  conditions  where  subsequent uptake  of  prenatal  diag-
nosis is  lower  (e.g.,  Becker  muscular  dystrophy,  hemophilia).  Historically,
molecular  testing  for  many  X-linked  conditions  has involved  ongoing  stud-
ies using  new  techniques  as they  develop  particularly  because of  the  com-
plexities  of  identifying  a heterozygote  gene carrier.  Continued  testing  after
initial  test results  has important  counseling  implications,  Does  the  woman
know  that further  tests will  be performed  and that these may clarify  the initial
results, but  may also change her  situation  significantly?  The  clinical  labora-
tory  should  have  an explicit  understanding  with  clinical  staff  about  whether
ongoing  tests should  be  automatically  performed,  or  whether  the  patient
should  be contacted  first.  An  ideal  approach  to this  is the development  of  a
Regional  Genetic  Register  service  where  families  are regularly  reviewed  by
clinical  and laboratory  staff,  and families  expect regular  updates on their  situ-
ation  (13)  (see Section 7.).
5.  Prenatal  Testing
One of  the aims of  carrier,  and to a lesser extent presymptomatic/diagnos-
tic testing,  is to be in  a position  to offer  prenatal  testing  to those individuals
at significant  risk.  Indeed  the  possibility  of  an accurate  molecular  prenatal
test has had a dramatic  impact  on many  families’  reproductive  plans. Before
accurate  prenatal  molecular  tests were  possible,  many  parents  of  children
with  spinal  muscular  atrophy  and cystic fibrosis  chose not to  have  any fur-
ther  pregnancies,  and  many  sisters/mothers/aunts/cousins  of  boys  with
Duchenne  muscular  dystrophy  experienced  the trauma  of  a midtrimester  ter-
mination  of  a male fetus. For  these families,  the option  of prenatal  diagnosis
has been  a prerequisite  for  embarking  on a pregnancy.  Indeed  many  healthy
children  have  been born  who  would  otherwise  have been terminated  in utero,
or never  been conceived,  if  prenatal  testing had not been possible. Neverthe-
less, prenatal  diagnosis  and the associated option  of  termination  of  pregnancy
can have  considerable  psychological  sequelae for  pregnant  women  and their
partners  (14).
Although  prenatal  diagnosis is now  possible for  an ever-increasing  range of
Mendelian  conditions,  uptake varies  considerably  between  conditions.  In  gen-
eral, requests for  prenatal diagnosis are most common for  disorders with  onset
in infancy/childhood,  with  more severe prognosis  and little  prospect for  treat-
ment;  whereas prenatal  diagnosis is less likely  to be requested for  conditions
with  late  onset, less severe symptoms, and some prospect of  treatment,  Very
few  women  at high  risk  of  having  a son with  Duchenne  muscular  dystrophy
will  take the risk, whereas most people  at risk of  transmitting  adult  polycystic
kidney  disease accept the risk to their  children  without  availing  themselves of
212  Kerzin-Storrar
prenatal  diagnosis  (3,4).  However,  for  each disorder,  individual  couples will
make different  decisions. Of  two  pregnant  couples with  the same family  his-
tory  and same risk of recurrence, one may choose prenatal diagnosis and termi-
nation  of  an affected  fetus whereas the other may carry on with  the pregnancy
without  testing.
Decision  making  can be particularly  difficult  where  the severity  of  the con-
dition  is  variable,  such  as in  neurofibromatasis  and  myotonic  dystrophy.
Requests for  prenatal  diagnosis for  these conditions  are infrequent,  but surveys
of  these patients  suggest that uptake  would  be higher  if  molecular  diagnosis
were  a better  indicator  of  phenotype  (15,16).  Decision  making  also may  be
complicated  when  molecular  diagnosis  is by linkage,  leaving  a residual  risk.
Residual  risks of <5% are often, but not always, acceptable to patients, and the
use of  flanking  markers to reduce the residual  risk may be requested. It  is also
important  to point  out here that making  the decision to have prenatal  diagnosis
does not  imply  a decision to terminate  a high-risk  fetus; some couples choose
prenatal  diagnosis  in order  to prepare  themselves for  an affected  child.
These issues make clear the necessity for  pre-  and post-test counselmg. The
majority  of  molecular  prenatal  diagnoses will  be to couples with  a family  his-
tory,  although  some tests for  the hemaglobinopathies,  Tay  Sachs disease, and
cystic fibrosis  will  be the result of  population-based  carrier  screening. Couples
at known  high  risk  should  have  access to genetic counseling  via  the relevant
genetic service.
Communication  between  clinical  staff  and the laboratory  carrying  out  the
prenatal  testing is important  in  two  regards.  First,  laboratory  staff  need to be
clear  precisely  what  tests are being  requested: for  example,  should  flanking
markers  be used and if  so, has the patient  been made aware  of  the possibil-
ity  of  an ambiguous  result  owing  to recombmation  between the markers;  and
is the sample for  a Huntington’s  disease prenatal  test for  mutation  testing,  or
exclusion  testing  only  using  linkage?  Second, it is crucial  that laboratory  and
clinical  staff  are  clear  about  the  timing  of  results  of  tests. The  majority  of
molecular  prenatal  testing will  be on chorionic  villus  samples (CVS),  and the
laboratory  would  expect to have  some advance notice  of  the samples’ arrival.
Because of  the controversy  over  CVS  being  possibly  associated with  a small
increased risk  of  limb  abnormalities  when  carried  out before  10 wk  of  preg-
nancy (171, many centers now  opt for  CVS at 1 O-l  1 wk.  One of  the important
advantages  of  CVS  to couples at high  genetic  risk has been its availability  in
the  first  trimester  to  enable, where  necessary, a transcervical  termination  of
pregnancy  under  general  anesthetic. However,  as this method  of  termination
can usually  only  be performed  safely until  14 wk  gestation there will  be limited
time available  following  CVS to complete molecular  tests. Diagnosis  later than
this may  lead to termination  by induction  of  labor.
Genetic  Counseling  and  Molecular  Testing  213
6.  Ethical  Considerations
Ethical  issues surrounding  genetic testing have been the source of  consider-
able  debate  and the  subject  of  many  reports  over  recent  years  (18–20),  and
would  not  appropriately  be  considered  in  detail  here.  There  are  however,
three  issues of  relevance  to  clinical  molecular  genetic  laboratories  worth
highlighting:  consent, testing  children,  and inadvertent  discovery  of  genetic
information.
As  mentioned  in  Section  3. on  predictive  testing,  international  guidelines
(9)  have  ensured that a written  consent form  is completed  by  the patient  and
his or her  doctor  before  a Huntington’s  disease predictive  test is carried  out.
Currently  in  the  United  Kingdom  consent  forms  are not  routinely  required
for  all  genetic  tests, although  some centers have  begun  to  introduce  these.
Laboratories  may  choose to assume, on  receiving  a sample from  a clmician,
that consent has been obtained  from  the patient  verbally  or  in  a written  form
tiled  in  the patient’s  clinical  notes. Alternatively,  laboratories  may  decide  to
require  that a consent form  be included  as part of the request card accompany-
mg the  sample. Consent  forms  for  genetic  testing would  normally  include  a
clear  statement of  the purpose  for  which  the sample has been taken, and  the
signatures  of  the patient  and  the health  professional  who  has discussed the
possible  implications  of  the  test with  them  (including  implications  for  other
family  members).  It  is particularly  important  that  laboratory  staff  are  made
aware  of  whether  consent has been  given  for  clinical  testing,  research pur-
poses, or for  storage only.
The pros and cons of  genetic testing in  children  is under debate. A working
party  of  the UK  Clinical  Genetics Society (20)  published  preliminary  recom-
mendations  in  1994 which  were  only partly  endorsed by the UK  Genetic Inter-
est Group,  an umbrella  organization  speaking for  families  affected  by  genetic
disease (21). There  is general consensus that diagnostic testing for  a child show-
ing  symptoms of  a genetic  condition,  or  predictive  testing  where  this  would
lead to early  treatment,  is not problematic,  and that predictive  testing for  late
onset disorders without  early treatment  options (e.g., Huntington’s  disease) is
not  usually  appropriate.  There  is  considerably  less agreement  on  whether
heterozygote  carrier  testing  should  be done  in  children.  A  survey  of  chnical
molecular  genetic laboratories  in the United  Kingdom  by the Clinical  Genetics
Society working  party  showed that laboratories  do regularly  receive  samples
from  children  for  carrier  testing  for  cystic fibrosis  and other  recessive  disor-
ders,  commonly  from  pediatricians,  and  that  most  laboratories  do  not  have
guidelines  for  these requests. The  clinical  and  laboratory  geneticists  m  our
department  in  Manchester have jointly  decided  that, locally,  carrier  testing in
children  should  be discouraged.
214  Kerzin-Storrar
It  is in  the nature  of  molecular  genetic testing that unsolicited  information
about family  members may be discovered  inadvertently.  Nonpaternity  can be
identified  through  family  testing and may exclude an individual  from  being  at
genetic risk. Diagnosis  can be revealed  by implication  from  testing individuals
in a family  linked  through  a relative  who  has not requested testing (such as in
the example  shown  in  Fig.  3). Heterozygote  carrier  status on an unborn  baby
will  be  revealed  when  testing  a prenatal  sample for  the primary  purpose  of
diagnosing  a (homozygous)  affected pregnancy. Laboratory  guidelines  for  gen-
erating  and reporting  this information  should be considered carefully  and after
discussion with  clinical  colleagues.
7.  Genetic  Registers
Regronally  organized  genetic  family  registers  provide  a  mechanism  for
extending  access to genetic counseling  to all  individuals  at significant  risk  of
chosen disorders,  as well  as a system for  maintaining  long-term  contact with
these  families.  Relatives  of  probands  referred  to  the  genetic  service  are
proactively  offered  genetic counseling  and continuing  follow-up  (4). Relatrves
are only  contacted after  careful  discussron with  the proband,  and where  appro-
priate,  the general  practitioner.  Individuals  are only  included  on  the register
with  their  explicit  permission  after  genetic  counseling.  It  is essential to pre-
serve confidentiality  and privacy  for  family  members, and information  included
on the register  must not be divulged  to third  parties without  the explicit  agree-
ment of  the individual  concerned. Because of  the sensitive  nature of the infor-
mation  held  on  extended  families,  it  has been  recommended  that  genetic
registers  should  normally  be  organized  regionally  rather  than  nationally  or
internationally.  Disorders  chosen for  the register  approach  are usually  ones
where  the implications  extend through  the generations;  autosomal  dominant
conditions  such as Huntington’s  disease, neurofibromatosis,  adult polycystic
kidney  disease, familial  adenomatous polyposis  coli, and other  dominant  can-
cers; X-linked  disorders  such as Duchenne  and Becker muscular  dystrophies
and  fragile  X;  and  the balanced  chromosome  translocations.  Genetic  coun-
seling  and annual  contact is provided  by the clinical  genetic  team. This  fam-
ily-centered  approach  is  ideal  for  molecular  testing  because  it  facilitates
collection  and  storage  of  samples  from  appropriate  relatives  in  extended
kindreds  (13).  Because families  agree to  long-term  follow-up,  they  are pre-
pared to receive  updated laboratory  results and to provide  additional  samples if
needed. A  further  advantage  of  this approach  is that proactive  counseling  and
testing  usually  from  the  teens onward  decreases requests for  family  testing
urgently  in pregnancy. When the molecular  laboratory  and the genetic register
service  are based in the same place, close collaboration  can focus resources on
prioritizing  molecular  testing  for  those individuals  for  whom  it  is most  rel-
Genetic  Counseling  and  Molecular  Testing  215
evant.  At  a  practical  level,  integrating  laboratory  and  clinical  register  data-
bases may be helpful,  as well  as regular  working  meetings between  laboratory
and clinical  register  staff.
8.  Personal  Issues  for  Laboratory  Staff
Clinical  scientists are commonly  asked to provide  blood  samples for  use as
controls or  in developing  new  techniques in the laboratory.  Similarly,  students
and junior  staff  are often  set to do their  own karyotype  and cystic fibrosis  gene
screen. This  should be approached  with  caution  where  information  of  poten-
tially  clinical  significance  could  be generated. The  basic premise that genetic
testing should not be done without  some element of  pre-test counseling,  is just
as applicable  to laboratory  scientists who  are, after  all,  human first  and scien-
tists second!
Although  the need for  providing  emottonal  support  to staff  working  in  the
health services is being  increasingly  acknowledged  (22), this has been focused
primarily  on staff  involved  directly  in patient  care. Little  attention  is paid  to
the feelings  of  laboratory  staff  who  may be under  continual  pressure to gen-
erate urgent  test results  which  have  serious  clinical  significance.  This  is of
particular  relevance  in  clinical  molecular  genetic  laboratories  where  test
results  may  lead  to terminations  of  pregnancy  or presymptomatic  diagnosis
of  serious genetic  diseases. Clinical  staff are trained  in “breaking  bad news”  to
patients, but laboratory  scientists may also experience an element of the stresses
of  giving  bad  news when  in  the position of  communicating  results verbally  to
clinical  staff closely involved  with  the patient. Laboratory  staff should be encour-
aged to discuss the emotional  demands of  their  work,  and this could  be incor-
porated  into  laboratory  meetings,  as well  as through  informal  contact  with
clinical  colleagues.
9.  Summary
Molecular  genetic  testing can provide  powerful  information  about disease
and risk of  disease, both pre-  and postnatally,  for  individuals  and their  nuclear
and extended families.  Because of the potential  psychological  as well  as medi-
cal implications  of  genetic testing, counseling  before  and after  testing must be
available  as an integral  component of  the testing service, and the right  to make
a choice not to have  a genetic test must be an option.  Communication  between
the  clinical  molecular  genetic  laboratory  and  clinical  colleagues  providing
genetic counselling  is essential to ensure that molecular  genetic advances bring
the  best possible  benefits  with  the  least possible  harm.  Clinical  molecular
geneticists should contribute  to discussion and debate about the human  impli-
cations of  their  work.
216  Kerzin-Storrar
References
1.  Andrews,  L.  B.,  Fullarton,  J.  E  ,  Holtzman,  N.  A.,  and  Motulsky,  A  G.  (eds.)
(1994)  Assessing  Genetic  Risks.  Impllcatlons  for  Health  and  Social  Policy,
National  Academy  Press,  Washmgton,  DC.
2.  Craufurd,  D.,  Kerzm-Stonar,  L.,  Dodge,  A,  and  Harrrs,  R.  (1989)  Uptake  of
presymptomatlc  predictive  testing  for  Huntington’s  disease.  Lancet  2,603-605.
3.  Hodgkmson,  K.  A.,  Kerzm-Storrar,  L.,  Watters,  E.  A.,  and Harris,  R.  (1990)  Adult
polycystic  kidney  disease:  knowledge,  experience  and  attitudes  to  prenatal  diag-
noses. J.  Med.  Genet.  27,  552-558.
4  Kerzm-Storrar,  L.,  Khan,  A.  A.,  Watters,  E.  A.,  Craufiud,  D.,  et  al.  (1991)  A
regional  genetic  family  register.  Am.  J.  Hum.  Genet  49,42.
5  Walker,  A.  P.,  Scott,  J  A.,  Biesecker,  B.  B.,  Conover,  B.,  Blake,  W.,  and
Djurdjinovtc,  L  (1990)  Report  of  the  1989  Asllomar  meeting  on  education  m
genetic  counsellmg.  Am  J.  Hum.  Genet.  46,  1223-1230.
6.  Kerzin-Storrar,  L.  (1993)  A  new MSc  course  in  genetic  counselling  for  non-med-
ical  co-workers  m  clmrcal  genetics.  J  Genet  Counsellzng  2,44.
7.  Hans,  H.,  Scotcher,  D.,  Hartley,  N.,  Wallace,  A,  Craufurd,  D.,  and  Harris,  R.
(1993)  Cysttc  fibrosis  carrrer  testing  in  early  pregnancy  by  general  practitioners.
Br  Med.  J  306,1580-1583.
8.  Wooldndge,  E.  Q.  and  Murray,  R.  F.  (1989)  The  health  orientation  scale:  a mea-
sure of  feeling  about  sickle  cell  trait.  Sot.  Biol.  35,  123-136.
9.  Tyler,  A.,  Walker,  R.,  Went,  L.,  and  Wexler,  N.  (1994)  Guidelines  for  the
molecular  genetics  predictive  test  in  Huntington’s  disease.  Clinical  practice  in
medical  genetics.  J.  Med.  Genet.  31,555-559.
10  Zeesman,  S., Glow,  C. L.,  Cartrer,  L.,  and  Striver,  C.  R.  (1984)  A private  view  of
heterozygosity:  eight-year  follow-up  on  carriers  of  Tay-Sachs  gene  detected  by
high  school  screening.  Am.  J.  Med  Genet  l&769-778.
11.  Marteau,  T.  M.,  van  Duijn,  M.,  and Ellis,  I.  (1992)  Effects  of  genetic  screening  on
perceptions  of  health:  a pilot  study.  J  Med  Genet.  29,24-26.
12.  Mitchell,  J., Scrrver,  C. R.,  Clow,  C. L.,  and Kaplan,  F. (1993)  What  young  people
thmk  and  do when the option  for cystic  fibrosis  carrier  testing  is available.  J.  Med
Genet  30,538-542.
13.  Read,  A.  P.,  Kerzin-Storrar,  L.,  Mountford,  R.  C.,  Elles,  R.  G.,  and  Harris,  R.
(1986)  A  register  based  system  for  gene  tracking  m  Duchenne  muscular  dystro-
phy.  J  Med  Genet.  23,581-586.
14.  Abramsky,  L.  and  Chapple,  J. (eds.) (1994)  Prenatal  Dzagnoszs  The Human  Side,
Chapman  and  Hall,  London.
15  Benjamin,  C. M.,  Colley,  A  , Donnai,  D., Kingston,  H.,  Harris,  R.,  and Kerzm-Storrar,
L.  (1993)  Neurofibromatosis  type  1:  knowledge,  experrence,  and  reproducttve
decisions  of  affected  patients  and  families.  J.  Med.  Genet  30,  567-574.
16.  Faulkner,  C., Clancy,  T.,  and Kingston,  H.  (1995)  A study  investigating  the  knowl-
edge,  views  and  experience  of  myotonic  dystrophy  (MD)  among  a  group  of
affected  women  (poster,  autumn  1995),  Clinical  Genetics  Socrety,  London.
Genetic  Counseling  and Molecular  Testing  217
17.  Firth,  H.  V., Boyd,  P.  A.,  Chamberlain,  P. F., MacKenzie,  I.  Z., Morriss-Kay,  G.  M.,
and  Huson,  S. M.  (1994)  Analysis  of  limb  reduction  defects  in  babies  exposed  to
chorionic  villus  sampling.  Lancet  343,  1069-107  1.
18.  Nuffield  Council  on  Bioethics  (1993)  Genetzc Screenzng*  Ethzcal  Issues,  Author,
London.
19.  Clarke,  A.,  Fielding,  D.,  Kerzin-Storrar,  L.,  Middleton-Price,  H.,  Montgomery,
J.,  Payne,  H.,  Simonoff,  E.,  and  Tyler,  A.  (1994)  The  genetic  testing  of children:
report  of  a working  party  of the  Clinical  Genetics  Society  (UK  ). J.  Med  Genet.
31,785-797.
20.  Dalby,  S. (1995)  GIG  response  to  the  UK  Clmical  Genetics  Society  report  “The
genetic  testing  of  children.”  J.  Med.  Genet.  32,49@–494.
21.  British  Medical  Association  (1995)  The BMA  ‘s Views on  Genetic  Testing,  Author,
London.
22.  Friedrich,  E.  (1994)  Carmg  for the carers, in  Prenatal  Diagnosis  The Human  Side
(Abramsky,  L.  and Chapple,  J.,  eds.), Chapman  and Hall,  London,  pp.  202-212.

12
Molecular  Approaches  to  the  Detection
of  Deletions  and  Uniparental  Dlsomy
in  Prader-Willi  and  Angelman  Syndromes
John  F. Harvey  and  John  A. Crolla
1. Introduction
The  chromosomal  region  15qll  +ql3  exhibits  one of  the best characterized
examples  of  genomic  imprinting  in  humans  in  that biparental  inheritance  of
this region  is essential for  normal  development.  Prader-Willi  syndrome (PWS)
and  Angelman  syndrome  (AS)  are clinically  distinct  neurogenetic  disorders
caused by the loss of  function  of  the paternal  (PWS) or maternal  (AS)  contri-
bution  of  closely apposed genes within  15q 11 -+q 13.
In  approx 75%, of  PWS patients, the loss of the paternal allele(s) is caused by
deletion, or very  rarely, by translocations involving  breakpoints in  15ql l+q13,
whereas the remaining  25% present with  maternal uniparental  disomy  (UPD).
By  contrast, whereas  -60%  of  AS  patients have  maternal  deletions,  only  4%
have  paternal  UPD  and the remainder  have  no detectable abnormalities  (I),
Historically,  the diagnosis  of  PWS and AS depended on the use of  conven-
tional  cytogenetic  methods  for  the detection  of  interstitial  deletions  or  other
structural  anomalies  involving  bands  15qll  +q  13. However,  conventional
microscopic  diagnosis  of  interstitial  deletions  particularly  in  this  region  is
notoriously  difficult,  and  both  false-positive  and negative  results  have  been
demonstrated.  Furthermore,  cytogenetic  analysis per  se cannot identify  cases
of UPD.  The  identification  and cloning  of  15qll  +ql3  specific probes for  use
in  polymerase  chain  reaction  (PCR)-based  microsatallite  CA  repeat  analysis
[(CA)n],  Southern  blotting,  and  fluorescence  in  situ  hybridization  (FISH)
studies  now  make  possible  the  implementation  of  combined  conventional
cytogenetic,  molecular  cytogenetic,  and DNA  approaches to the diagnosis  of
the majority  of  PWS and AS patients caused by deletion  or UPD.
From  Methods  in  Molecular  Medicine:  Molecular  Dfagnosrs  of  Qenetic  Diseases
Edited  by*  R.  Elles  Humana  Press  Inc  ,  Totowa,  NJ
279
220  Harvey  and  Crok
In  order  to  harness this  battery  of  techniques  to  their  best advantage,  we
have  developed  a sequential strategy for  deletion  and UPD  detection. Initially
all  PWS/AS referrals  are examined with  conventional  cytogenetic  analysis to
exclude a structural  abnormality  of  any chromosome.  Screening for  deletions
in proximal  15q is carried  out using FISH  with  cosmid probes cloned  from  the
PWS/AS  critical  regions  (21, a  strategy  that  will  successfully  diagnose  the
majority  (but  not  all)  PWS and  AS  patients  with  deletions.  If  a deletion  is
detected, no further  action is required  and a report  can be issued. If  no deletion
is  seen, however,  further  samples  from  the  proband  and  both  parents  are
required  so that DNA  analysis can be employed  to diagnose/exclude  UPD.
Two  main  molecular  approaches are used. The  first  is  PCR-based  (CA)n
repeat  analysis  (3),  which  is  both  rapid  (2  d)  and  highly  informative,  but
requires  parental  DNA  for  the correct  mterpretation  of  the results,  The  sec-
ond  is  the  slower  (1-2  wk)  Southern  blotting  approach  using  the  probe
PW7 1 b(D 15863),  which  exploits  the differential  methylation  patterns within
this imprinted  region  (45).
The  vast  majority  of  classical PWS and -65%  of  AS  patients will  be con-
firmed  using  these combined  molecular  approaches. However,  it  should  be
noted  that  a number  of  rare  methylation  mutations  and locus-specific  micro-
deletions  patients have  been reported  m the literature  (6,7),  and particularly  in
cases with  clearly  defined  PWS/AS phenotypes where  UPD and deletions have
been  excluded,  more  specialist  investrgations  may  be  required  to  make  a
definitive  diagnosis.
2.  Materials
Many  of  the reagents, including  the probes  for  FISH  studies, are available
commercially.  Any  reagents prepared in the laboratory  should be made up with
analytical-grade  reagents,  and ultrapure  (or  similar  grade)  water.  The  FISH
protocol  given  below  assumes the use of commercially  available  digoxigenin-
labeled  probes  for  the PWS/AS region  and their  detection  using  fluorescein
isothiocyanate  (FITC)  conjugated  reagents.  Please note  that  although  the
detection  method  described  here  differs  slightly  from  that  recommended  by
the probe  manufacturer,  it nevertheless  gives reliable  and reproducible  results
m this laboratory.
2.1.  FISH  Analysis
2.1.1.  Slide  Preparation  and  Denaturation
1.  Methanol.
2.  Glacial acetic acid.
3.  70% Industrial methylated spirits (IMS).
Prader- Willi and Angleman  Syndromes  221
4.  2X  SSC:  Prepare  from  20X  SSC  stock:  3MNaCl  and  0.3Mtrisodium  citrate  (see
Note  1).
5.  RNase  A*  IO mg/mL  RNase  in  RNase  buffer:  10 mM  Tris  and  15 mMNaC1  at pH
7.5  (see Note  2).
6.  Formamide:  caution  (see  Note  3).
7.  Water  bath  at  72’C.
8.  Glass  microscope  slides.
9.  Microfuge.
2. I. 2.  Hybridization
1,  Commercial  probe  mixtures  of  D15S  11,  GABRB3,  and/or  SNRPN  (ONCOR
probes  supplied  by  Alpha  Laboratories,  Eastleigh,  UK)  (see Notes  5  and  6).
2.  2x  ssc.
3.  70,90,  and  100%  IMS  solutions  at  room  temperature.
4.  70%  IMS  at -20°C.
5.  Water  bath  at  37°C.
6.  Humidified  incubation  chamber  for slides,  e.g.,  a plastic  lunch  box  with  a sealable
lid,  containing  5 mL  of 2X  SSC  m  the  base for  humidification  (see Note  7)
7.  Suitable  slide  rack  for  holding  slides  in  transverse  position  during  hybridization.
8.  Rubber  solution  (Dunlop,  UK).
9.  22  x 22-mm  Glass  coverslips.
10.  20-,  loo-,  and  1000~yL  micropipets  (Gilson,  Anachem,  Bedfordshire,  UK).
2.1.3.  Posthybridization  Stringent  Washing and  Detection
1.  20x  ssc.
2.  2x  ssc.
3,  4X  SSClTween-20  wash solution:  4X  SSC  and  0.05%  Tween-20  (see Note  8).
4,  1% Boehringer  block  solution  (Boehringer  Mannheim,  Lewes,  UK)  (see Note  9).
5.  Antidigoxigenm  (mouse  monoclonal)  diluted  1:500  in  1%  Boehringer  block
solution  (see Note  10).
6.  Antimouse-FITC  (made  in  rabbit)  (Sigma,  Poole,  UK)  diluted  1:500  in  1%
Boehringer  block  solution  (see Note  10).
7.  Antirabbit-FITC  (made  in  goat)  (Sigma)  diluted  1:500  in  1% Boehringer  block
solution  (see Note  10).
8.  Antifade  solution  (Vector,  UK)  (see Note  11).
9.  Propidium  iodide  (PI):  0.05  mg/mL  (Sigma).
10.  Epifluorescent  UV  microscope  (e.g.,  Carl  Zeiss,  Axiostop,  Germany)  fitted  with
suitable  barrier  and excited  filters  (Carl  Zeiss  filter  combination  15 or  Pinkel83
series  filter  set. Chroma  Technology  Corps.,  Brattleboro,  VT)  for  the  visualiza-
tion  of  the  probe  (green-FITC)  and  red chromosomal  (PI)  signals.
11.  Water  bath  at 42°C.
12.  Either  24  x 50-mm  glass coverslips  (see Note  12) or  Shandon  plastic  coverplates
(Shandon  Life  Scrences,  Basingstoke,  UK)  (see Note  12).
222  Harvey  and  Crolla
2.2.  DNA  Extraction
1.  50-,  15-,  and  1.5-mL  (Eppendorf)  disposable  centrifuge  tubes  (Sarstedt,  Lei-
tester,  UK).
2.  Refrigerated  microfuge  and bench-top  centrifiges  (Sorvall  refrigerated  microfuge
RMC  14  and  a refrigerated  bench-top  centrifuge  RT6000B  with  an  H-1000B
swinging  bucket  rotor).
3.  Crushed  ice  and  double-distilled  water  supplies.
4.  Sucrose  lysis  buffer:  0.32M  sucrose,  10 miI4  Tris-HCI,  5 mM  MgC&,  1%  Triton
X-lOO,pH75.MaketolL.
5.  Resuspension  buffer:  0.075MNaC1,  O.O24MEDTA,  pH  8.0.  Make  to  1 L.
6.  Proteinase  K  at  50  mg/mL.
7.  Sodium  dodecyl  sulfate  (SDS)  (as a 20%  [w/v]  ready-made  stock  by  Amresco
from  CamLab,  Cambridge  UK).
8.  TE:  10 mMTris-HCl,  1 mMEDTA,  pH  8.0.
9.  Ethanol  99.7-100%  (v/v).
2.3.  CA  Repeat  Analysis
1.  Vertical  “sequencing  gel”  electrophoresis  apparatus  with  3000-V  power  supply
(Bio-Rad  Labs,  Ltd.,  Hamel  Hampstead,  UK,  Sequi-Gen  Sequencing  Cell  and
Power-Pat  3000).
2.  Thermal  cycler  and  thin-walled  reaction  tubes  (0.5  mL)  (Perkin  Elmer,  Applied
Biosystems  Ltd.,  Warrington,  UK).
3.  Stock  5X  Tris/horate/EDTA  (5X  TBE):  0.445M  Tris  borate  and  O.OlM  EDTA,
pH  8.3,  commercially  available  (Sigma).
4.  Stock  acrylamide/bis-solution:  40%  (w/v) acrylamide-2.1%  (w/v) bis:acrylamide-
ratio  19:1,  commercially  available  (Sevem  Biotech  Ltd.,  Kidderminster,  UK).
Store  at 4°C.
5.  iV,N,N’,N’,-tetramethyleneethylenediamine  (TEMED):  Store  at 4°C.
6.  Ammonmm  persulfate  (APS):  Dissolve  1 g  in  10 mL  distilled  water.  Freeze  as
800~PL  aliquots  at -20°C
7.  Urea  (Sigma).
8.  Stop  buffer:  A  lo-mL  solution  of  45%  formamide,  20  mM  EDTA,  0.05%
bromophenol  blue,  0.05%  xylene  cyanole.
9.  Siliconizing  solution  (Acrylease  by  Stratagene,  Cambridge,  UK).
10.  Redivue  [Y~~P]ATP  at  3000  Ci/mmol  Amersham  International  (Amersham,
Slough,  UK).  Store  at 4°C.  Caution  (see Note  22).
11,  T4  Polynucleotide  kinase  and  10X  enzyme  buffer  as provided  by  enzyme  manu-
facturers  (CamBio,  Cambndge,  UK)  Store  at -20°C.
12.  Tuq  DNA-polymerase  and  Mg-free  10X  enzyme  buffer  as provided  by  enzyme
manufacturers  (Promega,  Southampton,  UK).  Store  at -20°C.
13.  Stock  25-mMMgCl*  solutions  (Promega).  Store  at -2O’C.
14.  Stock  of four,  100  rnJ4 dNTPs  (Promega).  Store  at -20°C.
15.  Mineral  oil,  light  white  oil  (if  required)  (Sigma).
Prader- Willi and Angleman  Syndromes
Table  1
Oligonucleotide  Primers  Used  in the  Multiplex  PCR  Reaction
223
Probe  Locus  Primer  sequence  Size,  bp
4-3 RCA  D15Sll  F 5’-GACATGAACAGAGGTAAATTGGTGG-3’  243-263
R 5’-GCTCTCTAAGATCACTGGATAGG-3’
GABRBSCA  GABRB3  F 5’-CTCTTGTTCCTGTTGCITTCAATACAATACAC-3  181-201
R 5’-CACTGTGCTAGTAGATTCAGCTC-3’
AFlvQOOwb4  D15S122  F 5’-GATAATCATGCCCCCCA-3’  143-159
R  S-CCCAGTATCTGGCACGTAG-3’
LS6-1CA  D15S113  F 5’-CATGTACTGTTTTATCCCTGTGTGGC-3’  130-140
R  5’-CTGCTGCTTATACTCTTTCTCTATTC-3’
16.  Oligonucleotide  dinucleotide  repeat primers,  4-3RCA(D15S  11) (8),  AFM200wb4
(D15S122)  (9),  LS6-lCA(D15S113)  (3),  and  GABRB3CA  (10)  for  multiplex
PCR  (Oswel  DNA  Service,  Southampton,  UK)  (see Table  1).
17  Autoradiography  cassettes: with  intensifying  screens.
18.  X-ray  film:  for  example,  Kodak  X-Omat  AR5  (Kodak,  Cambridge,  UK)
2.4.  Methyla  tion  Analysis
1.  Horizontal  gel  electrophoresis  apparatus  with  20  x  20124  cm  gel  formers  and
combs  (Bethesda  Research  Labs,  Cambridge,  UK)  and  300-V  power  supply
(Northumbria  Biologtcals  Ltd.,  Cramlington,  UK).
2.  Agaruse  (Appligene,  Durham,  UK).
3.  5 mg  /mL  Ethidium  bromide.  Caution  (see Note  20).
4.  UV  transilluminator.  UV  protective  visor  and  goggles.  Caution  (UV  Prod-
ucts  Inc.,  San  Gabriel,  CA).
15.  CU-5  Polaroid  camera  and  hood  with  Kodak  Wratten  22A  or  23A  red  filter
(Kodak)  and  B  and  W  667  Polaroid  film  (Polaroid,  St.  Albans,  UK).
6.  Restriction  enzymes  HpaII  and  Hind111  and  appropriate  buffer  as recommended
by  the  manufacturer  (Boehringer  Mannheim).
7.  SpermidineiMgClz:  mix  of  equal  volumes  of  120 mA4 spermidine  and  100  mM
MgC&  (Sigma).
8.  Denaturation  solution  (DN):  0.5MNaOH,  1MNaCl.
9.  Neutralization  solution  (N):  lMTris-HCl,  l.SMNaCl,  pH  8.0. Ready-made  pow-
dered  blend  (Sigma).
10.  Blotting  membrane,  e.g.,  Zeta-Probe  GT  (Bio-Rad  Labs.  Ltd.).
11.  80°C  Incubator/oven.
12.  25  x 35-mm  Radiation  bags  (Jencons  Scientific  Ltd.,  Leighton  Buzzard,  UK).
13.  Bag  sealer,  artist’s  roller  tool,  and  darkroom  developing  trays  for  gel  and
filter  washings.
14.  Prehybridization  and  hybridization  mix:  0.25MNa2HP04,  pH  7 2,  7%  SDS.
15.  Shaking  water  bath  or  incubator  with  shakmg  tray.
224  Harvey  and  Crolla
16.  Redivue  [a3*P]dCTP  at  3000  Ci/mmol  (Amersham  International  plc,  Little
Chelfont,  UK).  Caution  (see Note  22).
17  DNAprobe  PW7Ib  (D15S63)  (5).
18.  Labeling  kit,  e.g.,  High  Prime  (Amersham  International).
19.  Water  bath  at  37°C.
20.  Wash  buffer  1: 20  &Na*HPO,,  pH  7.2,  and  5%  SDS.  Wash  buffer  2:  20  mM
Na2HP04,  pH  7.2,  1% SDS
21.  Sephadex  G50-150  and  a  0.7  x  20-cm  glass  column  (Bio-Rad  Labs.  Ltd.,
Econo-Columns).
22.  Autoradiography  cassettes, screens, and  films  (as in  Sectton  2.3.).
3.  Methods
3.7.  FISH  Analysis
3.1.1.  Slide  Preparation  and  Denaturation
1.  Clean  a microscope  slide  by  spraying  with  70%  IMS  and  wiping  dry  with  tissue,
Make  sure that  the  surface  is grease  free.
2.  Make  chromosome  preparations  using  conventional  methods  (3:l  metha-
nol:acetic  acid),  but  it  is  best  to  place  one  drop  of  suspension  centrally  on  each
slide.  Mark  the underside  of the  slide  with  a diamond  pencil,  thereby  defining  the
outer  limits  of  the  cell  suspension  (see Note  4).
3.  Immerse  the  slide  m  freshly  prepared  3.1  methanol:acetic  acid  for  30  min  (i.e.,
postfixation).  Air-dry.
4  RNase  slides  using  a working  concentration  of  100  pg/mL.  made  up  in  2X  SSC
(i.e.,  100 uL  of stock  + 900  pL  of  2X  SSC).  Add  60  uL/slide  under  a 24  x  50 mm
coverslip,  and  incubate  slides  for  30  min  at 37’C  (see Note  2).
5.  Remove  coverslips  gently  and wash slides  briefly  in  2X  SSC  Dehydrate  by  2 min
washes at room  temperature  in  70,  90,  and  100%  IMS  series.  Air-dry.
6.  Make  up and preheat  to 70°C  the denaturing  solution,  take  care  and  wear  gloves:
70%  formamide,  30%  2X  SSC  (see Note  3).
7.  Place  the  slides  in  a stainmg  trough  or coplinJar,  and place  at 72°C  for  l-3  min  to
prewarm.
8.  Pour  the  hot  denaturing  solution  onto  the  slides  and  Incubate  for  2  min  at 72Y.
9.  Pour  off  the  denaturing  solution  and  immerse  slides  in  ice-cold  70%  IMS  for
2  min.
10.  Wash  slides  for  2  mm  in  90%  and  2 min  in  100%  IMS.  Air-dry.
3.7.2.  Hybridization
1.  Approximately  10 min  prior  to  setting  up  the  hybridization,  remove  the  probe(s)
from  the -2O’C  freezer  and place  in  a 37°C  water bath  to  warm  up.  The  commer-
cial  probes  used  in  this  protocol  are  supphed  precompeted  with  human  Cot-l
DNA,  and  so are ready  for  use (see Notes  5 and  6).
2.  Place  the required  number  of 22  x 22-mm  coverslips  on a flat  surface,  and aliquot
10 PL  of  probe  mixture  onto  each trying  to  avoid  bubbling.
Prader- Willi  and Angleman  Syndromes  225
3.  Place  the  slide–denatured  cell  surface downward–gently  onto  the  22  x 22-mm
coverslip  using  the  diamond  pencil  mark  to  identify  where  the  cells  are  located.
Seal  the  edge  of the  coverslip  with  rubber  solution.
4.  Place  the  slide  mto  a  deep-sided  slide  rack  (or  some  suitable  container  that  will
keep  the slides  horizontal  and level  during  incubation).  Position  the  slides/rack  m  a
chamber,  e.g.,  a plastic  lunch  box  with  a sealable  lid,  and pour  5 mL  of 2X  SSC into
the bottom  for humiditiication.  Incubate  overnight  m a 37’C  water bath  (see Note  7).
3.1.3.  Posthybridization  Stringent  Washing and  Detection
1.  Prior  to  beginning  the  next  step (usually  the  morning  after  setting  up  the  hybrid-
ization),  make  up  the  stringent  wash solutions,  and  preheat  them  to  42°C  m  the
water  bath,  i.e.,  50%  formamide,  50%  2X  SSC.  Make  up  sufficient  volume  for
two  5-min  washes.
2.  Gently  remove  the  hybridization  coverslip,  and place  the  slides  immediately  into
2X  SSC  at room  temperature.
3.  When  all  the  slides  have  had their  coverslips  removed,  pour  off  the  2X  SSC,  and
immediately  pour  the  preheated  stringent  wash onto  them.  Incubate  for  5 min  in
the  42°C  water bath.
4.  Pour  off  the first  solution,  and replace  with  the  second  aliquot  of preheated  strm-
gent  wash solution  Incubate  for  5 min  in  the  42OC water bath
5.  Pour  off  the  second  wash and  replace  with  2X  SSC  at room  temperature.  Incu-
bate  for  5 min
6.  Remove  slides  from  2X  SSC,  attach  them  to  a  drsposable  plastic  coverplate
(Shandon),  and  place  them  in  a rack  as shown  in  Fig.  1 (see Note  12).
7.  Inject  100 uL  of block  solution  into  each  slide  well.  Incubate  for  15 min  at room
temperature  (see Note  9).
8.  Inject  100  uL  of  antidigoxigenin  (mouse  monoclonal)  diluted  1:500  in  1%
Boehringer  block  solution  into  each slide  well.  Incubate  for  20  mm  at room  tem-
perature  (see Note  10).
9.  Inject  500  pL  of  4X  SSC/Tween-20  to  each  slide  well.  Incubate  for  2  min  at
room  temperature.
10.  Repeat  step  9.
11.  Inject  100  yL  antimouse-FITC  (made  in  rabbit)  diluted  1:500  in  1% Boehringer
block  solution  into  each  slide  well.  Incubate  for  20  min  at  room  temperature
(see Note  10).
12.  Repeat  washing  steps 9 and  10.
13.  Inject  100  yL  antirabbit-FITC  (made  in  goat)  diluted  1:500  m  1%  Boehringer
block  solution  into  each  slide  well.  Incubate  for  20  mm  at room  temperature.
14.  Repeat  washing  steps 9 and  10.
15.  Remove  slides  from  the  coverplates,  and  immerse  in  4X  SSUTween-20  wash
solution.
16.  Place  one  small  drop  of  antifade  on  22  x  50  mm  coverslip,  and  inject  1 yl.,  of
a 0.05  mg/mL  solution  of PI  (see Note  11).
Harvey  and  Crolla
Fig.  1.  Shandon  cover-plates  and  the  posthybridization  slides  can be  arranged  in  a
“homemade”  rack,  made  in  the  example  from  a  Denley  storage  rack.  One  hundred
microliters  of  each  detection  reagent  are pipeted  (arrow)  into  the  well  formed  by  the
slide  and  coverplate.  The  fluid  drains  down  the  slide  by  gravity,  but  once  the  well  is
empty,  a residue  is trapped  between  the  slide  and  cover-plate by  surface tension.  Add-
ing  0.5  mL  of  the  wash  buffer  reagent  displaces  the  detection  reagent,  washes  the
slide,  and  prepares  the  slide  surface  for the  next  100  l.tL  of detection  reagent.
17.  Drain  slide  briefly  from  4X  SSC/Tween-20,  and place  cell  side  downwards  onto
coverslip/antifade/stain  mixture.
18.  Blot  the  excess thoroughly  with  tissue  paper,  and  seal  the  coverslip  with  rubber
solution.  The  slides  are  now  ready  for  examination  under  a  fluorescent  micro-
scope  using  either  Carl  Zeiss  filter  combination  15 or  Chroma  Technology  Fil-
ters.  With  these  filter  combinations,  the  chromosomes  stain  red  and  the  FITC
signal  is green.  A  minimum  of  10 metaphases  should  be  scored,  and the  distribu-
tion  of  signal  expected  in  normal  and  deleted  patients.
3.2.  DNA  Extraction
Genomic  DNA  was prepared  from  whole  blood  taken in EDTA  tubes from
patients and parents and collected  into  EDTA  tubes. The  following  procedure
Prader- Willi and Angleman  Syndromes  227
was  designed  for  IO-mL  blood  samples but  may be scaled down  for  smaller
volumes  (see Note  13).
1,  Place  blood  on  ice  for  20  min  in  a 50-mL  screw-cap  tube  (see Note  14).
2.  Add  cold  sterile  distilled  water  on  ice  to  a final  volume  of  50  mL
3.  Centrifuge  at  2000g  at 4°C  for  10 min.
4.  Pour  off  supematant  and  resuspend  the  pellet  in  25  mL  ice-cold  sucrose  lysis
buffer  (see Note  15).
5.  Centrifuge  at  2000g  at 4’C  for  10 min.
6.  Pour  off  supematant  and resuspend pellet  m  3 mL  resuspension  buffer.  Add  150 PL
of  10%  SDS  and  8 pL  proteinase  K  (50  mg/mL,  stored  frozen  as 20-PL  aliquots)
(see Note  15).
7.  Incubate  overnight  at 37°C  or  for  2-3  h at 60°C  until  fluid.
8.  Add  1.5 mL  of  6MNaC1,  and  shake  vigorously  for  20  s.
9.  Centrifuge  at 2200g  at room  temperature  for  30  min.
10.  Collect  supematant  in  a 15-mL  tube  and fill  with  100%  ethanol  at room  tempera-
ture.  Invert  two  to  three  times  until  the  DNA  “hair  ball”  forms.
11.  Lift  out  the  DNA  with  a sterile  disposable  syringe  needle  (carefully  “hooked”
by  catching  the  tip  against  the  inside  of  the  needle  case),  and  wash quickly  m
70%  ethanol.
12.  Resuspend  in  1 mL  of TE.
13.  Store  short  term  (weeks)  at 4”C,  or  long  term  (years)  at -20  to -80°C
3.3.  CA  Repeat  Analysis
1.  Prepare  four  hot  kits.  End-label  each  selected  primer  separately  as in  Table  2,
adding  1 pL  of T4  kinase  to  each  hot  kit,  followed  by  [Y~~P]ATP  to  give  a total
volume  of  10 pL/reaction.
2.  Incubate  at 37°C  for  1 h.
3.  Prepare  a multiplex  1 OX  cold  kit  as in  Table  3. This  kit  provides  enough  material
for  9-10  PCR  reactions  and  may  be  stored  at -20°C  for  future  use. After  the  hot
kit  l-h  incubation  add  the  end-labeled  primers  to the  cold  kit  as shown  in  Table  3
(see Note  16).
4.  Add  1 pL  Tuq  polymerase  enzyme,  and divide  into  19-pL  aliquots  in  PCR  tubes.
5.  Add  1 yL  of  DNA  to  each tube  (see Note  16).
6.  PCR  for  24 cycles  with  an initial  denaturation  of 94’C  for  4 min,  followed  by  24
cycles  of 94°C  for  1 mm,  55°C  for 2 min,  72°C  for 2 min,  and  a final  extension  of
72’C  for  10 min.
7.  After  PCR  amplification,  add  20  pL  stop  buffer/tube,  and  denature  at  100°C  for
5 min  just  before  use.
8.  Keep  on  ice  and  load  onto  a 5%  polyacrylamlde  denaturing  gel  as soon  as pos-
sible  (see Note  17).
9.  Run  for  3-3.5  h  at  120 W.
10.  Dismantle  the  apparatus,  remove  siliconized  top  plate  (see Note  18), and  identify
radioactive  products  by  scanning  the  gel  surface with  a Geiger  counter.
228  Harvey  and  Crolla
Table  2
Hot  Kit Preparation
Reagent  volumes,  pL
Primers  Tax  10
2ow  Primer  buffer  HZ0  T4  kinase  [Y~~P]ATP
4-3RCA  F  3  1  4  1  1
GABRB3CA  R  5  1  1  1  2
AFM  200wb4  F  3  1  4  1  1
LS6-1CA  R  5  1  1  1  2
Table  3
Cold  Kit Preparation
Reagents  Volumes,  pL
1 OX  PCR  buffer
25  mh4  MgCIZ
2 mM  dNTP  mix
20  pA44-3RCA
20  wGABRB3CA
20  yMAFM  200wb4
20  pJ4LS6-1CA
H2O
End-labeled  primersa
4-3RCA
GABRB3CA
AFM  200wb4
LS6-ICA
20
12
25
1
2.5
15
2.5
109.5
%ee  Table  2.
11.  Roll  on  an  appropriate  sized  sheet of  Whatman  3MM  paper.
12.  Trim  off  surrounding  gel  with  scalpel,  and  lift  up  gel  on  the  Whatman  paper,
transfer  to  cassette  with  intensifymg  screens,  cover  the  gel  m  polythene,  and
expose  to  an  X-ray  film  at -8O’C  for  2  h  to  overnight  (Fig.  2,  Table  1)  (see
Note  19).
3.4.  Methylation  Analysis
1.  Digest  5  pg  of  DNA  with  30  U  of HpaII  and  20  U  of  HzndIII,  6  nL  10X  ‘M’
buffer  (Boehringer  Mannheim),  and  1 pL  of the  magnesmmspermidme  mix  in  a
total  volume  60  nL  made  up  with  double-distilled  water or  equivalent.
2.  Incubate  overnight  at 37°C.
Prader-  Willi and  Angleman  Syndromes  229
Fig.  2.  Multiplex  PCR  of  four  CA  repeats  in  the  PWSIAS  critical  region  in  two
normal  families.  P,  proband,  F, father;  M,  mother.
3.  Pulse  spin  samples,  and  add  10 uL  tracking  dye to  each  digest.
4.  Prepare  a 20  x 20  cm  horizontal  0.7%  agarose  gel,  including  5  pL/lOO  mL  of
5  mg/mL  ethidium  bromide  into  the molten  agarose  mix.  Caution  (see Note  20).
Electrophorese  the  digests  overnight  at  80 V.
5.  Wear  disposable  gloves  while  handling  the  gel  and  filters  and  using  appropriate
face and eye protective  visor  and goggles,  transfer  the gel  to a UV  transilluminator
and  photograph.
6.  Transfer  the  gel  to  a  tray,  and  cover  with  DN  solution  until  the  gel  can  move
freely.  Shake  gently  for  70  min  (see Note  2 1).
7.  Carefully  pour  off  DN,  holding  gel  down  with  gloved  hand,  rinse  with  distilled
water,  and  then  cover  with  N  solution.  Shake  as before  for  70 min.
230  Harvey  and  Crolla
8.  Remove  the gel,  using  a sheet of old  X-ray  film,  and place  onto  the  bottom  surface
of  an mverted  gel  former,  cover  with  a gel-sized  perspex  sheet (preferably  with  a
block  at one  side  to  prevent  gel  slip),  and  with  hands  at  each end,  Invert  the  gel.
9  For  wet  blottmg,  prepare  a  standard  Southern  blot  apparatus  with  a 20X  SSC
reservoir  and  Whatman  3MM  wick  at  least  two  layers  thick  folded  across  a
glass  or  perspex  platform.  Add  the  inverted  gel  to  the  apparatus  and  follow  the
filter  manufacturer’s  instructions  (Zeta-Probe  GT,  Bio-Rad).  Surround  the  gel
with  cut  strips  of  polythene  or  used  X-ray  film  to  prevent  filter/wick  solution
bypass  effects.
For  dry  blotting,  line  the  bench  with  a sheet  of  polythene,  cut  four  pieces  of
Whatman  3MM  paper  to  the  gel  size,  soak  in  20X  SSC,  stack  on  the  polythene,
add  the  inverted  gel,  and  then  contmue  as for  wet blotting.
10.  Blot  overnight,  remove  towels,  and  turn  over  gel  and  filter.  Mark  well  positions,
track  1 position,  and  umque  filter  number  with  pencil.  Carefully  peel  away  gel
and rinse  filter  in  2X  SSC.  Air-dry  between  two  sheets of  Whatman  3MM  paper
and  bake  at  80°C  for  1 h.
11  Prior  to labeling  PW7  1 b, amplify  the plasmid  insert  and flanking  regions  by PCR
using  the  ScreenTest  Recombinant  Screening  Kit  (Stratagene)  according  to  the
manufacturer’s  instructions.  Check  the  PCR  product  sizes on  an  agarose mini-gel,
running  5  pL  of  the  products  against  known  size standards.  Purify  the  remaining
products  using  the Prep-A-Gene  DNA  Purification  Kit  (Bio-Rad).  Check  the  final
products  as before  for  size  and  concentration  against  known  markers.
Label  25  ng  of  purified  product  with  50  pCi  of  Redivue  [a32P]dCTP,  3000
Ci/mmol  (Amersham)  using  the  High  Prime  Labeling  Mix  for  Random  Prime
Labeling  Kit  (Boehrmger  Mannheim,  UK)  according  to  manufacturer’s  instruc-
tions.  After  a 30-min  incubation  at  37°C  run  the  labeled  probe  down  a  12-cm
Sephadex  G50-150  (TE  buffered)  column  to  remove  free  nucleotides.  Monitor
the  separation  of  free  nucleotides  from  probe  on  the  column  with  a  hand-held
Geiger  counter.  Collect  the  probe  peak  runnmg  ahead  of the (red)  free nucleotide
peak,  in  a “screw-cap”  Eppendorf  tube  held  with  a pair  of  forceps.  Replace  the
Eppendorf  cap,  and  denature  the  probe  m  a boiling  water bath  for  10 min.  Cool
rapidly  on  ice, and then add  to  the  prehybridized  filter  as described  m  the  follow-
ing  step  (see Note  22)
12.  Prehybridize  for  5-30  min.  Hybridize  and wash the membrane  using  the  standard
aqueous  protocol  according  to  manufacturer’s  mstructions  (Zeta-Probe  GT.  Bro-
Rad).  Use  about  40  mL  prehybridization  solution,  and  after  squeezing  out,  add
5-10  mL  of  prewarmed  hybridization  solution  and  the  labeled  probe  PW7lb.
Seal  the  bag  and  thoroughly  treat  with  an  artist’s  roller  to  ensure  mixing.  Incu-
bate  in  a shaking  water  bath  at 65’C  or  preferably  on  a shaking  tray  in  a hot  air
oven  (Hybaid,  Teddington,  UK).  Hybridize  for  at least  18 h.
13.  After  washing  twice  for  30  min  in  wash buffer  1 and  twice  for  30  min  m  wash
buffer  2, enclose  the  filter  in  clear  plastic  wrap,  and transfer  to  a cassette beneath
two facing  intensifying  screens with  Kodak  X-Omat  AR5  X-ray  film  sandwiched  in
between.  Expose  at-80°C  overnight  up to  5 d and  develop  (Fig.  3) (see Note  23).
Prader-  Willi  and  Angleman  Syndromes  231
Fig.  3.  (A)  An  autoradiograph  of  a Southern  blot  analysis  of  the  methylation  pat-
terns  at  the  locus  D15%3(probe  PW7  lb)  in  HindIIIIHpaII-digested  DNA.  The  6-kb
band  represents  the  maternal  methylation  imprint,  and  the  4.4-kb  band  represents  the
paternal  methylation  imprint.  1,  Normal  female;  2,  PWS  sample  deleted  for  the
unmethylated  paternal  allele;  3, normal  male;  4, PWS  sample  with  uniparental  disomy.
(B)  A  gel  photograph  of  the  ethidium  bromide-stained  HindIII/H’aII-digested  DNA
corresponding  to  1,2,  3,  and  4  in  (A),  demonstrating  the  equivalent  DNA  concentra-
tions  of  the  enzyme  digest.
4.  Notes
4.1.  FISH  Analysis
4.1.1.  Slide  Preparation  and  Denaturation
1.  Dissolve  the  salts initially  in  800  mL  water  and  adjust  volume  to  1 L  when  fully
dissolved.  2X  SSC  =  1: 10 dilution  of 20X  SSC  in  ultra-pure  water
2.  RNase  A  stock  solution  of  10 mg/mL  made  up  in  RNase  buffer:  Boil  for  30  min
to  destroy  any  contaminating  DNase.  Store  this  boiled  stock  at -20°C.
3.  Formamide  is a possible  teratogen  and must  be handled  with  caution.  See local  con-
trol  of substances hazardous to health  (COSHH  [UK])  assessments (or other manda-
tory  regulations)  for  the  correct  handling  and  disposal  of this  chemical.
232  Harvey  and  Crolla
4.  Slides  for  in  situ  hybridization  can  be used after  the  short  pretreatment  schedule
noted  here.  However,  older  shdes  can be  used  if  necessary,  but  the  postfixation
step can be omitted.  If  the  only  patient  material  available  is older  unstained  slides,
then  the  in  situ  technique  should  be  attempted.  The  optimal  way  of  storing
material  for  future  studies  1s as cells  suspended  m  3: 1 methanol:acetlc  acid  fixa-
tive  at -2OOC.
4. I .2.  Hybridization
5  The  current  strategy  for  the  use  of  commercially  available  cosmids  from  the
PWS/AS  regions  is based  on  the  observation  that  the  vast majority  of  deletions
Involving  this  region  will  remove  sequences detected  by  the  probes  D15Sll  (at
the  centromeric  end)  and  GABRB3  (at the  telomere  end  of the  region).  However,
very  rare  cases of  PWS  have  been  reported  with  deletions  m  the  SNRPN  region
only.  Since  SNRPN  lies  proximal  to  GABRB3,  it  1s advisable  to  use  SNRPN
together  with  D15Sll  for PWS  and  D15Sll  and GABRB3  for  AS  However,  this
is  an  extremely  active  area  of  research,  and  developments  should  be  carefully
followed  at all  times
6.  ONCORcatalognumbers:  D15Sl1,  P5150;  SNRPN,  P5152;  GABRB3,  P5151.
7  There  are many  ways  m  which  shdes can be  placed  m  a humidified  chamber  for
hybridization,  but  slides  should  be kept  horizontal  and humihfied  during  this  step.
4.1-3.  Posthybridiza  tion  Stringent  Washing  and  Detection
8.  4X  SSClTween-20:  20X  SSC  200  mL,  ultra-pure  water  800  mL,  and  Tween-20
(Sigma,  catalog  #P1379),  500  yL.
9.  Boehringer  blocking  reagent  (catalog  #1096176):  Make  a 1% solution  m  4X  SSC/
Tween-20,  and place  on a magnetic  stirrer  for 1 h. Spin  the  solution  in  a mlcrofuge
for  5 min  to  remove  the  undissolved  solids.  The  block  solution  can be  stored  at
4°C  for  several  weeks
10.  Digoxigenm  detection  reagents:
a.  Antidigoxigenin  (mouse  monoclonal)  (Boehringer  catalog  #133062):  Dilute
1:500  in  1% Boehringer  block  for use. If  stored  at 4”C,  this  reagent  remains  stable
for  several  weeks.
b.  Antimouse-FITC  (made  in  rabbit)  (Sigma  catalog  #F-9137):  Dilute  I:500  in  1%
Boehrmger  block  for use. If  stored at 4”C, this reagent remains  stable for several weeks.
c.  Antirabbit-FITC  (made  III  goat)  (Sigma  catalog  #F-0382):  Dilute  I:500  in  1% Boeh-
rmger  block  for use. If  stored at 4”C,  this  reagent remains  stable  for several weeks.
d.  If  the  FITC  signal  appears  weak  after  this  protocol,  an  additional  layer  of  FITC
can be added by  destaining  the  slides with  two  5-min  washes in  4X  SSClTween-20,
followed  by  incubation  in  antigoat-FITC  (made  in  rabbit)  diluted  I:500  in  1%
Boehrmger  block.  This  reagent  should  be  applied  as described  for  previous  antl-
bodies,  and the  slide  restamed  (see Section  3.1.3 ., steps  13-16).
11  Vector  Vectashield  Mounting  Medium  (Antifade)  catalog  #H-l  000.
Prader- Willi and Angleman  Syndromes  233
12  It  is  highly  recommended  that  the  FISH  staining  protocol  should  use  Shandon
coverplates  for  the  delivery  of  the  staining  reagents  to  the  slides.  This  is  the
method  described  in  this  protocol.  Alternatively,  the reagents  can be delivered  by
adding  60  uL/slide  using  24  x 50  mm  glass  or plastic  coverslip.  If  this  method  is
to be used,  pipet  the  solution  onto  the coverslip,  and invert  the  slide  gently  touch-
ing  the  shde  onto  the  solution-this  helps  to  disperse  the  reagent  and  eliminate
air  bubbles.  Use  a  slide  rack  and  humidified  chamber  for  all  the  incubations.
Shandon  Coverplates  catalog  #7211013.  See Fig.  1 for  details  of  how  a rack  can
be made  for  use with  the  cover-plates.
4.2.  DNA  Extraction
13.  Small  tissue  samples,  such as chorionic  villi,  or  cultured  cells  may  be  extracted
in  Eppendorf  tubes.  For  30 mg  of tissue  (see Section  3.2.,  step 6),  add  500  pL  of
resuspension  buffer,  5  uL  of  10%  SDS,  and  2  uL  of  proteinase  K  (50  mg/mL).
Incubate  as before,  add  150  yL  of  6MNaC1,  shake  vigorously,  and  centrifuge  at
2000g  for  20  mm  Collect  the  supernate,  add  2  vol  of  ethanol,  and  continue  as
before.  If  no  pellet  is obtained,  cool  to  -20°C  for  20  min  and  recentrifuge  at 4°C
for  30  mm.
14.  When  possible,  execute  operations  1,2,4,  and  6 in  a safety  cabinet.
15.  Pour  off  supernatant  into  a freshly  prepared  2%  Vrrkon  solution  (Antec  Intema-
tional,  UK)  solution,  and discard after a minimum  of  15 min.  Ensure the pellets  are
broken  up.
4.3.  CA  Repeaf  Analysis
16.  Possible  cross-contamination  effects may  be avoided  or at least  reduced  by des-
ignating  three  separate  areas  or  rooms  for  PCR  kit  preparations,  DNA  addl-
tions,  and  PCR  product  manipulations,  using  only  designated  pipeters  in  each
area.  Aerosol-resistant  tips  (Northumbrra  Biologicals  Ltd.)  may  be  used  as an
additional  precaution.  It  is  often  beneficial  to  incubate  DNA  samples  at  37°C
for  at  least  30  min  before  use, particularly  after  freezing,  to  ensure  the  solutions
are homogeneous.
The  kits  are  usually  prepared  in  the  multiplex  format  as shown,  but  if  prob-
lems  arise,  it  may  be easier  to  prepare  and  run  each primer  set as separate  kits  at
least until  the problems  are resolved.  Similarly,  if  the relative  intensities  of primer
products  in  the multiplex  reactions  are consistently  unsatisfactory,  it  may  be nec-
essary  to  alter  the  amounts  of each primer  added.
17.  Resolution  of  alleles  tends  to  deteriorate  if  there  is a long  gap  between  dena-
turing  and  gel  loading.  Gels  are  prerun  for  at  least  1 h  before  use  and  loaded
when  hot  (50°C).
18.  To  prevent  sticking  and possible  tearing  of the  gel  on dismantling,  treat  the plates
before  every  run  by  cleaning  twice  with  distilled  water  and  then  twice  with  etha-
nol.  The  top  plate  is  then  siliconized  by  wiping  on  the  siliconizmg  fluid  with  a
tissue,  air-dried,  wiped  with  distilled  water,  and  then  with  alcohol.
234  Harvey  and  Crolla
19.  Ideally  samples  from  both  parents  should  be run  with  the  proband.  Single-band,
homozygous,  or  hemizygous  allele  patterns  are difficult  to  distinguish,  and  lack
of  a  paternal  contribution  (PWS)  or  maternal  contribution  (AS)  may  signify  a
deletion,  isodisomy,  or  nonpaternity  (in  the  absence  of  a paternal  allele).  Prior
FISH  analysis  should  at  least  distinguish  the  first  two  situations  (see Note  5).
Further  microsatellite  or  fingerprint  studies  for  loci  outside  the  PWS/AS  critical
regions  may  be  considered  necessary  if  nonpaternity  is  suspected  Similarly  for
heterodisomy  (the  presence  of  both  alleles  from  the  mother)  when  there  IS  no
paternal  contribution,  nonpaternity  may  need  to  be excluded.  Rare  “null”  alleles
have  been  found  by  some  laboratories  using  LS6-1CA  The  detectton  of  an
apparent  deletion  with  LS6-  1 CA  should  therefore  be confirmed  using  other  mark-
ers from  this  region.
4.4.  Methylation  Analysis
20.  Caution:  Ethidtum  bromide  is  a powerful  mutagen  Handle  with  care.  Do  not
boil  with  the  agarose,  but  add  and  mix  Just prior  to  pourmg  into  the  gel  former.
2 1.  A  depurination  stage involving  a preliminary  wash in  0.25MHCI  for  15 mm  may
be  included  before  denaturation  This  will  slightly  improve  transfer  of larger  frag-
ments  to  the  nylon  membrane.
22.  Follow  national  and  local  safety regulations  when usmg  radroisotopes.  The  probe
may  be  labeled  whtle  the  filter  is prehybridizing  (5  min  to  1 h)  Whole  plasmid
(vector  +  insert)  labeling,  although  usually  successful,  gave  poor  results  with
PW7  1 b. The  Stratagene  kit  is useful  because it  will  efficiently  amplify  from  most
pBR322-based  vectors.
The  success of the  labeling  reaction  can  be easily  monitored  using  a G50-  150
Sephadex  gravity  column  Soak  Sephadex  m  TE  overnight,  or  boll  for  5  min
before  use  A  clear  separation  between  labeled  probe  and the  free nucleotide  peak
(migrating  with  the  red  isotope  dye)  should  easily  be detected.  Ten  microliters  of
Orange  G  (10  mg/mL)  may  be added  to  the  probe  mix  Just prior  to  column  addi-
tion  to  highlight  the  free nucleottde  peak.  Spin  columns  may  be used  as a quick
alternative  to  gravity  columns.  These  are available  commercially  or may  be  sim-
ply  made  from  a  1 -mL  syringe.  Usmg  the  syringe  plunger,  plug  the  syringe  with
a  small  ball  of  glass  wool  Fill  with  Sephadex  G50,  and  centrifuge  in  a  15-mL
centrifuge  tube  with  syringe  flanges  resting  on the  tube  neck,  at  IOOOg for  1 min.
Discard  TE  from  the  tube,  add  a  collecting  “screw-cap”  Eppendorf  tube  (lid
removed),  and  replace  the  syringe.  Add  50  pL  of  TE  to  the  labeled  probe,  and
carefully  add the  mix  onto  the  G50  bed  followed  by  another  50 pL  of TE.  Centri-
fuge  at  1OOOg for  1.5 min.  Carefully  remove  the  Eppendorf  (this  can be  done  by
opening  a pair  of  surgical  long-handled  tweezers  against  the  inside  of  the  tube,
maintainmg  pressure  and  withdrawing),  replace  the  screw-cap  lid,  and  heat-
denature  as before.
23.  Methylation  analysis  allows  direct  detection  of  deletions  or  disomy  without
recourse  to  parents.  At  least  one  positive  (deleted)  control  for  PWS  and/or  AS
and one normal  control  should  be included  with  the  digests.  A uniparental  disomy,
Prader-  Willi and Angleman  Syndromes  235
positive  control  is  also  useful,  if  available,  for  demonstrating  dosage  differences
between  deleted  and  disomy  patients  (Fig.  4).
The  single-allele  deletion  or disomy  pattern  in  PWS  (larger  maternally  methy-
lated  allele[s]  present)  or  in  AS  (smaller  paternally  unmethylated  allele  present)
as opposed  to  the  normal  two-allele  pattern,  is diagnostrc.  In  PWS,  approx  75%
of  cases have  deletions  and  25%  have  maternal  disomy.  In  AS,  the  absence  of
these  pertubations  does not  exclude  the  diagnosis,  since  they  are  not  detected  in
approx  40%  of  AS  patients  (for  AS,  approx  60%  have  deletions  and  4%  have
paternal  disomy)  (I).
A  fainter  5.5-kb  band  lying  between  the  two  normal  alleles  and  an  array  of
faint  smaller  bands  below  the  normal  pattern  are  sometimes  seen on  longer  auto-
radiograph  exposures.  In  PWS-deleted/disomy  cases, long  exposures  sometimes
reveal  a faint  unmethylated  “paternal-like”  band,  suggesting  that  either  maternal
methylation  is not  complete,  or  that  excess methyl-sensitive  enzyme  may  over-
come  the  methyl  Inhibition  and  cut  the  methylated  sue  A  single  allele  at  this
stage combined  with  a normal  FISH  pattern  is indicative  of uniparental  disomy.
However,  an unusually  intense  signal  for  the  single  allele  on the  autoradiograph,
relative  to  the  concentration  of ethidium-bromide  stained  DNA  on  the  gel  photo-
graph,  may  be compared  with  the  DNA  “concentration  to  signal  rattos”  of neigh-
bormg  positive  (deleted)  and  normal  control  tracts,  and  is  a  useful  SubJective
diagnostic  measure.  Alternatively,  the  filter  may  be  hybridized  (together  with,  or
separately  from,  PW71  b)  with  a nonpolymorphic  probe,  chosen to  give  a product
size close  to,  but  outside,  the  PW7lb  product  size  range.  This  allows  direct  sig-
nal-to-DNA  concentration  measurements  by  densitometry,  workmg  within
defined  calibration  limits.  The  speed  of  detection  of  the  radioactive  allele  pat-
terns  can  be  substantially  improved  using  phosphoimaging  techmques,  e.g.,  the
imaging  analyzer  Fujix  Bas  lOOO/Millipore  m  place  of  standard  X-ray  auto-
radiography.  A  1-2  h  imaging  plate  exposure  is  equivalent  to  an  overnight
autoradiograph.  This  has the  advantage  of allowing  the rapid  detection  and repeat
of  failed  tests,  increasing  the  rate  of overall  throughput.
References
1.  Cassidy,  S.  B.  (1992)  Conference  report-first  mternatlonal  scientific  workshop
on  Prader-Willi  Syndrome  and  other  chromosome  15q  deletion  disorders.  Am.  J.
Med.  Genet  42,220-230.
2.  Delach,  J. A.,  Rosengren,  S. S., Kaplan,  L.,  Greenstem,  R.  M,  Cassidy,  S. B.,  and
Benn,  P  A.  (1994)  Comparison  of  high  resolution  chromosome  bandmg  and  fluo-
rescence in  situ  hybridization  (FISH)  for the laboratory  evaluation  of Prader-Willi
Syndrome  and  Angelman  Syndrome.  Am.  J.  Med.  Genet  52,85-9  1.
3.  Mutirangura,  A.,  Greenberg,  F.,  Butler,  M.  G.,  Malcolm,  S.,  Nicholls,  R.  D.,
Chakravarti,  A.,  and  Ledbetter,  D.  H.  (1993)  Multiplex  PCR  of  3  dinucleotide
repeats  in  the  Prader-Willi-Angelman  critical  region  (15q  1 l-q  13)-molecular
diagnosis  and  mechanism  of  uniparental  disomy.  Hum.  Mol.  Genet.  2,  143-15  1.
236  Harvey  and  Cm/la
4.  Dittrich,  B.,  Robmson,  W.  P.,  Knoblauch,  H.,  Buiting,  K.,  Schmidt,  K.,  Gillessen-
kaesbach,  G.,  and Horsthemke,  B.  (1992)  Molecular  diagnosis  of the  Prader-Willi
and  Angelman  Syndromes  by  detection  of  parent-of-origin  specific  DNA  methy-
lation  in  15qll-13.  Hum  Genet.  90,313-315.
5.  Dittrich,  B.,  Buiting,  K.,  Gross,  S.,  and  Horsthemke,  B.  (1993)  Characterization
of a methylation  lmprmt  in  the  Prader-Willi  Syndrome  chromosome  region.  Hum.
Mol.  Genet.  2,  1995-1999.
6.  Ozceltk,  T.,  Leff,  S.,  Robinson,  W.,  Donlon,  T  ,  Lalande,  M.,  Sanjines,  E.,
Schmzel,  A.,  and  Francke,  U.  (1992)  Small  nuclear  ribonucleoprotem  polypep-
tide  N  (SNRPN),  an expressed gene  m  the  Prader-Willi  syndrome  critical  region.
Nature  Genet.  2,265-269
7.  Butting,  K.,  Dittrtch,  B.,  Robinson,  W.  P.,  Guitart,  M.,  Abeliovich,  D.,  Lerer,  I.,
and  Horsthemke,  B.  (1994)  Detection  of  aberrant  DNA  methylation  in  unique
Prader-Willi  syndrome  pattents  and its  dragnosttc  implrcations.  Hum.  Mol.  Genet
3,893-895.
8.  Muttrangura,  A.,  Kuwano,  A.,  Ledbetter,  S  A.,  Chinault,  A  C  , and Ledbetter,  D. H.
(1992)  Dinucleotide  repeat  polymorphtsm  at the  D15S11  locus  m  the  Angelman/
Prader-Willi  region  (ASIPWS)  of chromosome  15. Hum  Mol  Genet.  1,  139.
9.  Malcolm,  S. and Donlon,  T.  A.  (1994)  Report  of the second international  workshop
on  human  chromosome  15 mapping  1994  Cytogenet  Cell  Gene&  67,2-22
10.  Muttrangura,  A.,  Ledbetter,  S. A.,  Kuwano,  A.,  Chinault,  A.  C.,  and  Ledbetter,
D.  H.  (1992)  Dinucleotide  repeat  polymorphism  at  the  GABAa  receptor  beta3
(GABRB3)  locus  m  the Angelman/Prader-Willi  region  (AS/PWS)  of  chromosome
15. Hum.  Mol  Genet.  l(l),  67
Noninvasive  Prenatal  Diagnosis
Using  Fetal  Cells  in  Maternal  Blood
Y. M.  Dennis  Lo
1. Introduction
It has been a long-sought  goal of  human genetics to develop  safe and reliable
prenatal  diagnostic  procedures  that constitute  no risk to the fetus. At  present,
the  safety of  available  methods is limited  by  the need to  obtam  fetal  tissues
through  invasive  means, such as chorlomc  villus  sampling  (CVS)  and amnio-
centesis,  which  constitute  a  risk  to  the  fetus.  One  potential  noninvasive
approach  for  prenatal  diagnosis  is  to  use fetal  cells  that  have  entered  into
maternal  circulation  during  pregnancy as a source of fetal material  for  analysis.
There  are several  reports  suggesting the existence of  fetal  cells in maternal
blood  during  pregnancy  (reviewed  in  refs.  1 and  2),  but  the  first  molecular
evidence  that  fetal  genetic  materials  can be detected in  maternal  circulation
had to await  the development  of  the polymerase  chain reaction  (PCR)  (3).  In
1989, Lo  et al. (4) used a nested PCR system to detect a Y repeat from  periph-
eral  blood  DNA  from  19 pregnant  women.  All  12 pregnant  women  whose
samples gave  rise to a positive  Y  signal later gave  birth  to boys, whereas all  7
whose samples were negative  gave birth  to girls. This provided  the first  molec-
ular  proof  that fetal  nucleated cells do indeed  circulate  m maternal  blood  and
that  genetic  information  regarding  the  fetus  can be obtained  from  analyzing
maternal  peripheral  blood.  Since then a number  of groups have confirmed  these
observations  using  a number  of Y-specific  sequences as targets for  amplifica-
tion  (56)  (for  review,  see ref.  1).
Following  the success using Y-specific  PCR, investigators  then turned  their
attention  to the possibility  of  diagnosing  autosomal  disorders  using  a similar
approach.  Since the fetal  cells in maternal  circulation  are surrounded  by a great
excess of maternal  cells, the use of the PCR for  autosomal fetal  gene detection
From  Methods  m  Molecular  Med&e.  Molecular  Dlagnosrs  of  Genetic  Diseases
Edlted  by  R  Elles  Humana  Press  Inc.,  Totowa,  NJ
237
238  Lo
1s limited  to  the  detection  of  fetal-derived,  paternally  inherited  sequences.
Because of  the limits  in the specificity  of  the PCR (for  review,  see ref.  7), the
most successful systems to date are from  clinical  scenarios where there exists a
unique  paternally  inherited  DNA  sequence, which  is possessed by the fetus but
not by the mother.
The  first  example  is the  detection  of  a paternally  inherited  hemoglobin
Lepore-Boston  gene  from  maternal  peripheral  blood  (8).  The  Lepore-Boston
gene is caused by the fusion  of  the 5’ half  of the S-globin  gene and the 3’ half  of
the P-globin  gene, together with  a 7-kb deletion  between these two fusion  part-
ners. This  constitutes a good target for  PCR amplification.
The second example is the detection of fetal-derived  rhesus D gene from  the
peripheral  blood  of  rhesus D  negative  pregnant  women  (9, IO).  This  approach
IS possible because the rhesus negative  mother  does not possess the rhesus D
gene (Il,I2),  and thus, the system is directly  analogous  to that of  the Y  chro-
mosome system. The  noninvasive  prenatal  determination  of  fetal rhesus D  sta-
tus  has  potential  clinical  implications  in  the  management  of  previously
sensitized rhesus negative  women with  a partner  heterozygous for  the rhesus D
gene. Hence, if  the fetus can be shown to be rhesus D negative,  then no further
prenatal  diagnostic  and therapeutic  procedure  is necessary.
The  further  extension  of  this  noninvasive  approach  to  detect  paternally
inherited  DNA  polymorphisms  that differ  from  those of  the mother  by  one or
several  nucleotides  is much  more  demanding  on  the  specificity  of  the PCR.
This  can, however,  be implemented  by the use of  systems based on the ampli-
fication  refractory  mutation  system (ARMS)  (13).  ARMS  enables the PCR to
be discriminatory  down  to a single-nucleotide  level.  It is based on the principle
that the specificity  of  the PCR is conferred  by the 3’ end of  the primers.  Thus,
if  there  is a 3’-terminal  mismatch between  a PCR primer  and the DNA  target,
then the amplification  efficiency  will  be greatly  reduced. When  using  ARMS
to  detect  paternally  inherited  polymorphisms  of  the  fetus  from  maternal
peripheral  blood,  ARMS  primers  are  designed  such that  the last base of  the
primer matches the paternal allele, but has a 3’-terminal mismatch with the mater-
nal alleles. It  is important  to realize that ARMS  only  confers  relative  selectiv-
ity for  the detection of  fetal-specific  sequence. In other words, the mismatched
allele  will  also be amplified,  although  with  reduced efficiency  compared  with
the matched one. Hence, one is faced with  a dilemma  when applying  ARMS  to
the  detection  of  an  extremely  small  amount  of  fetal  genetic  materials  from
maternal  blood:  The small quantities of  fetal material  require  the use of  a large
number  of  PCR  cycles; however,  this high  degree of  cycling  means that  the
extent to which  this mismatched reaction will  take place is also increased. With
further  development  in ARMS  technology,  such as the double ARMS  (14), one
is able to achieve  the goal of  detecting a minority  DNA  population  at a level  of
Noninvasive  Prenatal  Diagnosis  239
1 m  IO5 or  below.  Using  double  ARMS,  it  has recently  been  shown  that  a
paternally  inherited  polymorphism  in the  p  -globin  locus can be detected from
maternal  blood  (1.5). This  latter system may potentially  be used for  the diagno-
sis of  /3-thalassemia.
It  can be seen that the PCR has been instrumental  in proving  that fetal  cells
do indeed circulate  in maternal blood  during  pregnancy  and that certain  prena-
tal genetic analysis may be possible using PCR alone. However,  the precision
of noninvasive  prenatal  diagnosis using this approach has not reached the level
sufficient  for  clmical  use. This  has prompted  a number  of  investigators  to pur-
sue approaches for  enriching  for  circulating  fetal cells prior  to genetic analysis.
At  present, three populations  of  fetal  cells are thought  to be candidates for
enrichment  from  maternal  blood,  namely  nucleated red  blood  cells  (NRBC),
trophoblasts, and lymphocytes  (1,2).  Current  data suggest that NRBCs  are the
most  promising  candidate  cell  type.  This  approach  was  first  pioneered  by
Bianchi  et al. (16),  who used the fluorescence-activated  cell sorter (FACS)  and
antitransferrin  receptor  antibody  to  enrich  NRBCs  prior  to  genetic  analysis
using the PCR. Since then, variations  of  this theme have  been adopted by many
investigators  using other markers or combmations  of markers  (17,18),  or other
enrichment  techniques,  such as the  magnetic  activated  cell  sorter  (MACS)
(29,20).  Using  these  techniques  encouraging  data  on  fetal  sex diagnosis
(16,17),  diagnosis  of  chromosomal  aneuploidies  (‘17,21,22)  and detection  of
fetal-derived  autosomal  sequences (23)  have  been reported.  Further  develop-
ments in fetal cell enrichment techniques will  be expected to complement  tech-
niques based on  the PCR and in  situ  hybridrzation  to Improve  the diagnostic
accuracy of  this approach.
In  the following  sections, the use of  the PCR to  detect fetal-derived  DNA
sequences using  a Y-specific  sequence and the rhesus D  gene as examples is
outlined.  Technical  problems  are then discussed. Similar  methodological  con-
siderations  can be applied  to the use of  the PCR for  detectmg  other  minority
nucleic  acid populatrons.
2.  Materials
1.  A thermal cycler is necessary for  the PCR. The author uses either a Biometra
(Gdttingen, Germany)  TRIO  thermoblock  or  a Perkin-Elmer  Cetus  DNA  Ther-
mal  Cycler.
2.  Reagents for the PCR, including the Thermus  aquaticus  (Taq)  DNA polymerase,
deoxynucleotides  (dNTPs),  Ampliwax  for  Hot  Start  PCR  (24),  and  PCR  buffer
are obtained from a GeneAmp DNA  Amplification  Reagent Kit  (Perkin-Elmer,
Emeryville,  CA)
3.  Oligonucleotide primers for the PCR were obtained from Genosys (Cambridge,
UK).  Two  PCR  systems  are described  as examples,  namely  the  amplification  of
the DYS  14 locus (a Y-specific  sequence)  (25)  and the  amplification  of the  rhesus
240  Lo
t—–b Y1.8  Y1.6
Fig.  1.  Schematic  diagram  showing  the  location  of  the  primers  for  the  DYS14
amplification  system.
Rhesus  positive
D  gene
RD.A3  RD-5  RD-2  RD.A3  RD.5  RD.2
Rhesus  negative
RD.A3  RD-5  RD-2
Fig.  2.  Schematic  representation  showing  the  difference  in  the  structure  of  the
rhesus  locus  in  RhD-positive  and  RhD-negative  individuals.  Primer  locations  are
marked  in  the  diagram.
D  gene  (12).  Primer  sequences  are listed  here,  and  primer  locations  are shown  in
Figs.  1  and  2.  The  primer  combinations  Y1.5N1.6  (product  size  239  bp)  and
Y 1.7N1.8  (product  size  198 bp)  are nested  with  respect to  one another,  being  the
external  and  internal  pair,  respectively.  The  primer  combinations  RD-A3/RD2
(product  size  29 1 bp)  and RD-5/RD-2  (product  size 262  bp)  are both  specific  for
the  RhD  gene  and are heminested  with  respect to each other,  with  the  latter  primer
combination  being  the  internal  set.
Primer  sequences:
Y 1.5:  S’CTA  GAC  CGC  AGA  GGC  GCC  AT3’
Y 1.6:  S’TAG  TAC  CCA  CGC  CTG  CTC  CGG3’
Y 1.7:  SCAT  CCA  GAG  CGT  CCC  TGG  CTT3’
Y 1.8:  S’CTT  TCC  ACA  GCC  ACA  TTT  GTC3’
RD-A3:  S’GGA  TTT  TAA  GCA  AAA  GCA  TCC  AAG  AA3’
RD-2:  S’ACT  GGA  TGA  CCA  CCA  TCA  TAT3’
RD-5:  S’CAA  GGC  CTG  TTC  AAA  AAC  AAG3’
Noninvasive  Prenatal  Diagnosis  241
3. Methods
1.  Collect  peripheral  blood  samples  from  pregnant  women  either  mto  EDTA  or
lithium  heparin  tubes.  Perform  DNA  extractlon  by  the  standard  proteinase  K,
phenol-chloroform  method  (see  Note  1)  (26).  Carry  all  extraction,  and  set  up
procedures  in  a laminar  flow  cabmet  (see Notes  2-8)
2.  Set  up  PCR  in  lOO+L  reaction  volumes  with  5 U  of  Taq  DNA-polymerase  m
each  tube.  MgClz  concentration  for  the  DYS14  and  RhD  systems  has  been
optimized  at  1.5  mM.  Use  l-5  pg  of  genomic  DNA  extracted  from  pregnant
women/reaction  (see  Note  9).  For  Y-specific  PCR  using  primer  combinations
Y 1.5/Y  1.6 and  Y 1.7N1.8,  first-round  PCR  consists  of 40  cycles  of  94°C  1 min,
.55’C  1 min,  and  72°C  1 min  using  the primer  pair  Y 1 5 and  Y 1.6.  Transfer  2 PL
of  the  first-round  PCR  product  into  fresh reagents,  and  reamplify  for  25  cycles
using  the  same  thermal  profile  with  the  internal  primer  pair  Y 1.7 and  Y 1 8.  For
RhD  amplification  from  maternal  peripheral  blood,  50  cycles  of  Ampliwax-
mediated  Hot  Start  PCR  (see Note  10)  are  carried  out  using  RD-A3  and  RD-2.
Reamplify  2  PL  of this  first-round  reaction  using  RD-5  and  RD-2  for  a further  IO
cycles  using  the  same  cycling  parameters
3.  Electrophorese  10  pL  of  PCR  products  using  a  1 5%  ethldium  bromide-stained
agarose  gel.  Visualize  PCR  products  under  UV  transllluminatlon
4.  Notes
1.  Great  care  should  be  taken  during  DNA  extraction,  since  the  labor-intensive
nature  of  conventional  DNA  extraction  protocols  provides  many  opportumties
for  the  introduction  of  contaminants  We  have  tested  a  number  of  commer-
cially  available  DNA  extraction  kits  and  have  found  the  Nucleon  system  from
Scotlabs  (Strathclyde,  Scotland)  to  be  fast,  efficient,  and  to  involve  a smaller
number  of  steps than  the  conventional  proteinase  K/phenol-chloroform  extrac-
tion  method.
2.  The  main  strength  of  the  PCR,  namely  its  sensitivity,  is  also  its  chief  weakness,
since  it  is  extremely  prone  to  false-positive  results  owing  to  contamination
(27,28).  This  disadvantage  is  especially  obvious  in  applications  requiring  the
highest  sensitivity,  such as in  the  detection  of  fetal  cells  in  maternal  blood.  Thus,
for  the  performance  of  noninvasive  prenatal  diagnosis  using  PCR,  a lot  of  effort
should  be directed  toward  avoiding  and  detecting  contamination.
3.  Negative  controls  should  be  included  in  every  PCR  experiment.  In  many  situa-
tions,  multiple  controls  are  preferred.  Negative  controls  should  include  water
blanks  to  test  for  reagent  contamination  as well  as appropriate  genomic  DNA
controls,  e.g.,  female  cord blood  DNA  for the DYS14  system  and rhesus negative
male  DNA  for  the  RhD  system.
4.  Physical  separation  of  the pre-  and  post-PCR  areas should  be instituted.  The  use
of a laminar  flow  cabinet  is recommended  for  setting  up  the  PCR.
5.  All  PCR  reagents  should  be  aliquoted,  and  reagents  that  could  be  autoclaved
should  be  so treated.
6.  Gloves,  face, and  head  masks  are recommended.
242  Lo
7  Separate  pipet  sets should  be allocated  to  the DNA  extractron  phase,  PCR  setting
up  phase,  and  post-PCR  phase.  Pipet  tips  with  filters  should  be used.
8.  When  multiple  reactions  are  needed,  a master  mix  should  be  set up  to  reduce  the
number  of  maneuvers  and  thus  reduce  the  chance  of  posstble  contamination.  One
method  that  has been  found  to  be  useful  for  destroying  contaminating  sequence is
restrtcnon  enzyme  treatment.  Restriction  enzymes  that  cleave  within  the  target  se-
quence  for  PCR  may  be  used  to  restrict  any  contammating  sequence  prior  to  the
addition  ofthe  target (4). Followmg  decontammation,  the enzyme should  be destroyed
by thermal  denaturation  (e.g., 94“C  for  10 min)  before addition  of the template  DNA.
9.  The  amount  of DNA  used  for  PCR  is important,  since this  quantity  is a reflection
of the  number  of maternal  cells  (and  hence  the volume  of maternal  blood)  among
which  one  is searching  for the minority  fetal  cells.  Thus,  tf the  amount  of DNA  is
reduced,  then  one 1s effecttvely  reducing  the  chance of finding  the  rare fetal  ceils.
Since  1  yg  of  genomtc  DNA  corresponds  to  approx  150,000  diploid  cells,  at
single  molecule  sensitivity,  this  corresponds  to  a sensitivity  of  1 in  150,000.  This
consideration,  however, has to be balanced  against the fact that  increasing  the amount
of  DNA  will  lead  to the  increase m  the  number  of nonspecific  amphfication  bands
and  to  the  increase  in  PCR  inhibition  owing  to  mhibttors  existing  m  genomic
DNA.  As  a guide,  maternal  DNA  from  l-5  pg provides  satisfactory  results.
10.  An  alternative  to  the  nested PCR  strategy  is the  use of  hot  start  PCR  (24).  In  this
technique,  the  PCR  reagents  are separated  by  a plug  of wax that  melts  in  the”PCR
block  at  an  elevated  temperature,  preventing  the  formatton  of  nonspecific  PCR
products  This  enables  the  achievement  of  single  molecule  sensitivity  m  the  RhD
system  following  just  one  round  of  50  PCR  cycles.  Note  that  although  a second
round  of hemi-nested  PCR  is also  used m  the  RhD  system,  this  second  amplifica-
tion  reaction  is  only  used  for  confirmatory  purposes,  to  prove  that  the  signal
obtamed  after  the  first-round  PCR  is  indeed  owmg  to  the  amplification  of  the
RhD  gene.  The  use of hot  start PCR  for  prenatal  sex determination  has also  been
described  (29).  In  general,  hot  start  PCR  can be  regarded  as equivalent  in  sensi-
tivity  and  specificity  to  nested  PCR,  except  that  the  former  is more  sensitive  to
slight  change  in  amplification  condttions.  Thus,  a hot  start  system  may  take  more
time  to  optimize  than  the  more  tolerant  nested  system.
Acknowledgment
The  author is  supported by  a Career Development  Fellowship  by  the
Wellcome Trust.
References
1.  Lo,  Y.  M.  D.  (1994)  Nonmvasive  prenatal  diagnosis  usmg  fetal  cells  m  maternal
blood.  J.  Clm.  Pathol.  47,  1060-1065.
2.  Simpson,  J.  L.  and  Elias,  S.  (1993)  Isolating  fetal  cells  from  maternal  blood:
advances in prenatal  diagnosis  through  molecular  technology.  JAMA  270,2357-236  1,
3.  Saiki,  R.  K.,  Gelfand,  D.  H.,  Stoffel,  S.,  Scharf,  S. J., Higuchi,  R.,  Horn,  G.  T.,  et
al.  (1988)  Primer-directed  enzymatic  amplification  of  DNA  with  a thermostable
DNA  polymerase.  Sczence 239,487-491.
Noninvasive  Prenatal  Diagnosis  243
4.  Lo,  Y.  M.  D.,  Patel,  P.,  Wainscoat,  J.  S.,  Sampietro,  M.,  Gillmer,  M.  D.  G.,  and
Flemmg,  K.  A.  (1989)  Prenatal  sex  determination  by  DNA  amplification  from
maternal  peripheral  blood.  Lancet  2,  1363-1365.
5.  Kao,  S. M.,  Tang,  G  C.,  Hsieh,  T.  T.,  Young,  K.  C.,  Wang,  H.  C.,  and  Pao,  C.  C.
(1992)  Analysis  of  peripheral  blood  of pregnant  women  for  the  presence  of  fetal
Y  chromosome-specific  ZFY  gene  deoxyribonucleic  acid  sequences  Am  J.
Obstet.  Gynecol.  166,  1013-10  19.
6.  Hamada,  H.,  Arinami,  T.,  Kubo,  T.,  Hamaguchi,  H.,  and  Iwasaki,  H.  (1993)  Fetal
nucleated  cells  in  maternal  peripheral  blood:  frequency  and  relationship  to  gesta-
tional  age. Hum.  Genet.  91,427-432.
7.  Lo,  Y.  M.  D.  (1994)  Detection  of  minority  nucleic  acid  populations  by  PCR-a
review.  J.  Pathol.  174,  l-6.
8.  Camaschella,  C.,  Alfarano,  A.,  Gottardi,  E.,  Travi,  M.,  Primignani,  P.,  Caligaris,
C.  F.,  and  Saglio,  G.  (I  990)  Prenatal  diagnosis  of  fetal  hemoglobin  Lepore-Bos-
ton  disease  on  maternal  peripheral  blood.  Blood  75,2102-2106.
9.  Lo,  Y.  M  D.,  Bowel&  P.  J.,  Selinger,  M.,  MacKenzie,  I.  Z.,  Chamberlain,  P.,
Gillmer,  et  al.  (1993)  Prenatal  determination  of  fetal  RhD  status  by  analysis  of
peripheral  blood  of  rhesus negative  mothers.  Lancet  341,  1147,1148.
10.  Lo,  Y.  M.  D.,  Noakes,  L.,  Bowell,  P.  J.,  Fleming,  K.  A.,  and  Wamscoat,  J.  S.
(1994)  Detection  of  fetal  RhD  sequence  from  peripheral  blood  of  sensitised  RhD-
negative  pregnant  women.  Br.  J.  Haematol.  87,658-660.
11  Colin,  Y.,  Cherif-Zahar,  B.,  Le  Van  Kim,  C.,  Raynal,  V.,  van  Huffel,  V.,  and
Cartron,  J.-P.  (1991)  Genetic  basis  of  the  RhD-positive  and  RhD-negative
blood  group  polymorphism  as  determined  by  Southern  analysis.  Blood  78,
2747-2752.
12  Le  Van  Kim,  C.,  Mouro,  I.,  Cherif-Zahar,  B.,  Raynal,  V.,  Cherrier,  C.,  Cartron,
J.-P.,  and Cohn,  Y.  (I  992)  Molecular  cloning  and primary  structure  of the  human
blood  group  RhD  polypeptide.  Proc.  Natl  Acad.  Sci.  USA  89,  10,925-10,929.
13.  Newton,  C.  R.,  Graham,  A.,  Heptinstall,  L.  E.,  Powell,  S.  J  ,  Summers,  C.,
Kalsheker,  N.,  et  al.  (1989)  Analysis  of  any point  mutation  in  DNA.  The  ampli-
fication  refractory  mutation  system  (ARMS).  Nuclezc  Aczds Res.  17,2503-25  16.
14.  Lo,  Y.  M.  D.,  Patel,  P.,  Newton,  C.  R.,  Markham,  A.  F.,  Fleming,  K.  A.,  and
Wainscoat,  J.  S.  (1991)  Direct  haplotype  determination  by  double  ARMS:
specificity,  sensitivity  and  genetic  applications.  Nucleic  Acids  Res.  19,
3561-3567.
15.  Lo,  Y.  M.  D.,  Fleming,  K.  A.,  and Wainscoat,  J. S. (1994)  Strategies  for  the  detec-
tion  of  autosomal  fetal  DNA  sequence  from  maternal  peripheral  blood.  Ann.  NY
Acad.  Sci.  731,204-213.
16.  Bianchr,  D.  W.,  Flmt,  A.  F.,  Pizzimenti,  M.  F., Knoll,  J. H.,  and  Latt,  S. A.  (1990)
Isolation  of fetal  DNA  from  nucleated  erythrocytes  in  maternal  blood.  Proc.  Natl.
Acad.  Sci.  USA  87,  3279-3283.
17.  Price,  J. O.,  Elias,  S., Wachtel,  S. S., Klinger,  K.,  Dockter,  M.,  Tharapel,  A.,  et al.
(1991)  Prenatal  diagnosis  with  fetal  cells  isolated  from  maternal  blood  by  multi-
parameter  flow  cytometry.  Am  J  Obstet.  Gynecol.  165,  173 1-1737.
244  10
18.  Bianchi,D.  W.,  Zickwolf,  G. K.,  Yih,  M.  C.,  Flint,  A. F.,  Geifman,  0.  H.,  Erikson,
M.  S., and Williams,  J  M  (1993)  Erythroid-specific  antibodies  enhance  detection
of  fetal  nucleated  erythrocytes  m  maternal  blood.  Prenat  Dzagn.  13,293-300.
19.  Ganshnt-Ahlert,  D.,  Borjesson-Stall,  R.,  Burschyk,  M.,  Dohr,  A.,  Garritsen,  H.  S. P.,
Helmer,  E.,  et  al.  (1993)  Detection  of  fetal  tnsomres  21  and  18  from  maternal
blood  using  triple  gradient  and  magnetic  cell  sorting.  AJRI  30,  193-200.
20.  Zheng,  Y.  L.,  Carter,  N  P  , Price,  C. M.,  Colman,  S. M  , Milton,  P.  J., Hackett,  G.
A.,  et  al.  (1993)  Prenatal  diagnosis  from  maternal  blood:  simultaneous  mununo-
phenotyping  and  FISH  of  fetal  nucleated  erythrocytes  isolated  by  negative  mag-
netic  cell  sorting.  J.  A4ed  Genet.  30,  1051-1056.
21  Bianchi,  D  W.,  Mahr,  A,  Zmkwolf,  G.  K  ,  Houseal,  T  W  ,  Flint,  A.  F.,  and
Klmger,  K.  W.  (1992)  Detection  of  fetal  cells  with  47,XY,+21  karyotype  m
maternal  peripheral  blood.  Hum  Genet.  90,368-370
22.  Ebas,  S.,  Price,  J.,  Dockter,  M.,  Wachtel,  S.,  Tharapel,  A.,  and  Simpson,  J  L
(1992)  First  trimester  prenatal  diagnosis  of trrsomy  2 1 m  fetal  cells  from  maternal
blood.  Lancet  340,  1033.
23.  Geifman-Holtzman,  O.,  Holtzman,  E. J.,  Vadnais,  T  J.,  Phillips,  V.  E  , Capeless,
E.  L  , and  Bianchi,  D.  W.  (1995)  Detection  of fetal  HLA-DQ-alpha  sequences  in
maternal  blood-a  gender-independent  technique  of  fetal  cell  identification
Prenat  Dzagn.  15,261-268.
24.  Chou,  Q  , Russell,  M  , Birch,  D.  E.,  Raymond,  J.,  and  Bloch,  W.  (1992)  Preven-
tion  of  pre-PCR  mis-priming  and  primer  dimerization  improves  low-copy-num-
ber  amplifications.  Nucleic  Aczds  Res  20,  17 17-l  723
25.  Arnemann,  J.,  Epplen,  J.  T.,  Cooke,  H.  J.,  Sauermann,  U.,  Engel,  W.,  and
Schmidtke,  J. (1987)  A  human  Y-chromosomal  DNA  sequence  expressed  m  tes-
ticular  tissue.  Nuclerc  Aczds  Res  15,87  13-8724
26.  Mamatis,  T.,  Fritsch,  E. F.,  and  Sambrook,  J. (1982)  Molecular  Clonzng*  A  Labo-
ratory  Manual.  Cold  Spring  Harbor  Laboratory,  Cold  Sprmg  Harbor,  NY.
27.  Lo,  Y.  M.  D.,  Mehal,  W.  Z.,  and  Fleming,  K  A.  (1988)  False-positive  results  and
the  polymerase  chain  reaction.  Lancet  2,679.
28.  Kwok,  S. and  Higuchi,  R.  (1989)  Avoiding  false  positives  with  PCR.  Nature  339,
237,238.
29.  Lo,  Y  M.  D  ,  Schmidtke,  J.,  Wainscoat,  J.  S.,  and  Fleming,  K.  A.  (1994)  An
improved  PCR-based  system  for  prenatal  sex  determination  from  maternal
peripheral  blood.  Ann.  NYAcad  Sci.  731,214-216.
PCR from  Single  Cells
for  Preimplantation  Diagnosis
Pierre  F.  Ray  and  Alan  H.  Handyside
1,  Introduction
The  detection of genetic defects in human embryos following  in vitro  fertili-
zation (IVF)  or preimplantation  genetic  diagnosis  (PGD)  allows  the selection
and transfer  of  unaffected  embryos in couples known  to be at risk  of  transmit-
ting  an inherited  disorder.  This  avoids  the need to termmate an affected  preg-
nancy,  following  prenatal  diagnosis  at later  stages (I).  Diagnosis  of  a single
gene  defect  is usually  performed  on  one  or  two  single  cells  (blastomeres)
biopsied  from  8-  to  IO-cell  embryos  on  the  3rd  d postinsemination  using
nested  polymerase  chain  reaction  (PCR)  to  amplify  informative  fragments.
Nested  PCR  allows  amplification  from  a limited  number  of  target  sequences
(2), and under  carefully  optimized  conditions,  amplification  of  as few  as one or
two  target copies present in  a single  haploid  or  diploid  cell  is possible  (3-5).
PGD  was  first  achieved  for  X-linked  diseases by  determining  the sex of  the
embryos  using  a Y  chromosome-specific  repetitive  sequence and  selective
transfer  of  only female  embryos (6). More  recently, specific diagnosis has been
achieved  for  cystic fibrosis  (CF), by amplifying  across the cystic fibrosis  trans-
membrane  regulator  (CFTR)  gene AF508  locus (7) and for  Lesch-Nyhan  syn-
drome  by  amplifying  across a familial  base substitution  nullifying  a natural
XhoI  restriction  site in  the hypoxanthine  phophoribosyl  transferase  (HPRT)
gene (8).  In  both  instances, nested PCR  strategies were  chosen to amplify  the
mutated  sequence allowing  sufficient  amplification  for  detection  on ethidium
bromide-stained  gels. The  limited  cycling  with  the outer  primers  (20  cycles)
reduces nonspecific  amplification,  and only  specific fragments  that contain  the
complementary  sequence to the internal  primers  are amplified  to  a detectable
level  in  the second round  of  PCR.  Although  extra  handling  is involved,  any
From.  Methods  m  Molecular  Med&e*  Molecular  Dlagnosrs  of  Genetrc  Diseases
Edited  by  R  Elles  Humana  Press  Inc.,  Totowa,  NJ
245
246  Ray  and  Handyside
genomic  contaminant  introduced  after  the first  round  of  amplification  would
not  be  amplified  to  a detectable  level  by  the  inner  primers  alone.  The  effi-
ciency of  the second amplification  is improved  because the denaturation  of  the
first  amplification  product  (amplicon)  is easier. Also, the great excess of  these
amplicons  compared  with  nonspecific  sequences  eliminates  competition,
thereby  enhancing  specificity  and yield.
Lesch-Nyhan  syndrome is caused by heterogeneous mutations  in the HPRT
gene  on  the  X-chromosome.  In  one  family,  sequencing  revealed  a basepair
substitution  m exon 3 of  the HPRT  gene, which  deleted a natural XhoI  restric-
tion  site (Hughes,  personal  commumcation).  After  nested  amplification  of
a 158-bp  fragment  surrounding  the mutation  and restriction  with XhoI,  a diag-
nests could  be made by analyzing  the pattern  of  digestron. Fully  digested and
undigested products corresponded, respectively,  to homozygous unaffected  and
affected  (male),  whereas partial  digestion  was characteristic  of  heterozygous
female  cells. The  test was applied  successfully, and PGD resulted  in  the birth
of  a healthy  unaffected  baby girl  (8,). The described primers  could  be used for
other mutations  located in exon  3 of  the HPRT  gene that are encompassed by
the inner  primers.  In  that  case, only  the  detection  system would  have  to be
modified,  and single-stranded  conformational  polymorphism  (SSCP) could be
used for  mutations  that do not affect  restriction  sites.
To  date, we  have  performed  PGD  for  12 couples  in  which  both  partners
carry the AF508 mutation  m a total of  18 cycles. This  resulted in rive  singleton
births  confirmed  to be homozygous normal  (9).  Single  blastomeres from  dis-
aggregated embryos that had not been transferred  were analyzed to confirm  the
original  diagnosis and assess reliability  in clinical  practice. Ampltfication  effi-
ciency  and accuracy were  high  with  blastomeres from  embryos  diagnosed  as
homozygous normal  or affected,  In a proportion  of blastomeres from  presumed
carrier  embryos,  one  of  the  parental  alleles  failed  to  amplify,  apparently  at
random  (allele  dropout  [ADO]),  despite preliminary  results with  single-cell
analysis of  the AF508  locus, which  indicated  high  efficiency  and  100% accu-
racy  (10).  Further  investigation  of  single  lymphocytes  confirmed  the  occur-
rence  of  ADO,  and  showed  that  it  can be reduced  using  stringent  cell  lysls
conditrons  and by  increasing  the denaturation  temperature  to 96°C  during  the
first  few  cycles of  amplification  (II),  This  stresses the  importance  of  control
experiments  on  heterozygous cells and  optimization  with  individual  thermo-
cyclers, especially  if  single-cell  dragnosis is to be applied  to dominant  disor-
ders since this kind of  error  could  lead to serious misdiagnosis. Although  good
amplification  rates were  obtained, with  both thermal  and chemical lysis proto-
cols on blastomeres and lymphocytes, the use of lysis buffer  appeared to reduce
the occurrence  of  ADO.  We therefore  recommend  its use, especially  for  clini-
cal applications  of  single-cell  PCR.
Preimplantation  Diagnosis  247
For  diseases caused by  heterogeneous  mutations,  analysis of  several  loci
would  be an advantage. However,  multiplex  PCR has not proven  reliable  at the
single-cell  level  because of  the difficulties  involved  in optimizing  the reaction
conditions  for  more than one pair  of primers. Zhang  and colleagues  (12), using
random  15 mers in a modified  PCR reaction, primer  extension preamplification
(PEP), demonstrated that at least 30 copies of any specific DNA  fragment  from
>78%  of  the genome  can be produced  from  a single cell.  Small  aliquots  from
the PEP reaction  can then be reamplified  with  specific  primers,  thus allowing
analysis, for  example,  of  two  independent  mutations  or flanking  linked  infor-
mative  markers.  The  latter  would  be  particularly  useful  for  patients  with
uncharacterized  mutations,  but  with  an informative  pedigree.  Closely  linked
markers,  such as variable  copy  number  tandem  repeats (VNTR)  (13,14)  are
multiallelic  polymorphisms  with  a polymorphic  information  content  (PIC)
often  >0.7, which  make them  ideal  candidates for  linkage  analysis. Unfortu-
nately, their ampliticatton  and the identification  of the different  alleles are often
difficult  because of amplification  of extra bands (stutter bands) possibly gener-
ated by the slippage of the Tuq polymerase while  copying the repeats. We ampli-
fied  two  CA  repeats located at the 3’ and 5’ ends of  the dystrophin  gene, as an
approach  to  the  diagnosis  of  Duchenne  muscular  dystrophy  (DMD)  (15).
Although  good  amplification  efficiency  could  be obtained  after  PEP, separa-
tion of  the alleles could not be achieved  reliably.  By contrast, Kristjansson  and
colleagues (I 6) amplified  five  commonly  deleted exons in the dystrophin  gene
as well  as the X/Y-linked  genes, ZFXand  ZFY, to provide  a test informative  for
most of  the DMD  carriers.  In  conclusion,  although  the use of  VNTRs  is very
promising,  the amplification  of such repeated sequences (and especially that of
dinucleotide  repeats) from  a single cell is technically  very  difficult.  When  pos-
sible,  it might  be safer to perform  a direct  analysis (such as those described
for  CF or Lesch-Nyhan)  or to use a combination  of  less informative,  but more
reliable  longer repeats or restriction  fragment  length polymorphisms  (RFLPs).
The use of  a more  sensitive detection system, like DNA  fluorescent  analysis
using  labeled primers,  could be of  great advantage  for  single-cell  PCR. It  pre-
cludes the need for  nesting, and the reduced number  of  cycles could  allow  for
reliable  multiplex  PCR even from  a single cell. Findlay  et al. (Z7,18)  suggested
its use for  DNA  tingerprinting  as a control  for  contamination,  and described a
single-cell  protocol  for  the detection of  AF508  and the determination  of  sex.
At  present, only  14 centers have  attempted PGD,  and clinical  experience  is
therefore  limited  (19).  Overall,  197 PGD  cycles have  resulted  in  50  (25%)
clinical  pregnancies.  Most  of  these were  for  X-linked  diseases, and involved
identification  of  sex either by PCR or fluorescent  in situ hybridization  (FISH).
Among  these, one  misdiagnosrs  resulted  from  amplification  failure  of  the
Y-repeat.  Subsequently,  this  has been  avoided  using  other  protocols  that
248  Ray  and  Handyside
simultaneously  amplify  X  and Y  sequences. Two  misdiagnoses  of  CF  have
also been reported.  In  these cases, only one partner  carried the AF508 deletion;
the other partner  carried  a different  mutation.  The  reason for  these errors is not
clear, but may have  included  ADO  or contamination  possibly by sperm DNA.
Any  attempt to detect compound heterozygotes should therefore  be extensively
tested on appropriate  single cells.
2. Materials
2.1.  Single-Cell  Preparation
2. I.  1. Lymphocyte  Preparation
1.  Ficoll-Paque  (Pharmacta,  St.  Albans,  Hertsfordshne,  UK).
2.  Phosphate-buffered  saline  (PBS)  (Gibco  BRL,  Glasgow,  UK).
3.  Crystallized  bovine  serum  albumin  (BSA)  (ICN  Immuno  Biologrcals,  Thame,
Oxfordshire,  UK).
2.1.2.  Blastomere  Preparation  and  Biopsy
1.  Silicone  fluid  (Dow  Coming  299/50  cs, BDH  Chemicals  Ltd,  Poole,  Dorset,  UK)
2.  Acid  Tyrode’s  solution:  2  g  NaCl,  0.05  g  KCI,  0.06  g  CaCl,  * 2H20,  0.025  g
MgC12  * 6H20,  0.25  g glucose  (all  from  BDH  Chemicals,  Poole,  Dorset,  UK),  and
1 g polyvinylpyrrohdone  (PVP;  Calbiochem,  Nottingham,  UK),  dialyzed  against
PBS  and  lyophilized  m  <250  mL  of H20.  Note  that  the  PVP  should  be sprinkled
and  allowed  to  dissolve.  Adjust  to  pH  2.2  by  adding  a very  small  amount  of  5M
HCl  and make  up  the volume  to 250  mL  by  adding  more  Hz0  (high-quality  water;
FL  (manufacturing)  Ltd  , Fresentus  Health  Care  Group,  Basmgstoke,  UK)  The
solution  should  be  ahquoted  and  stored  at -20°C.
2.2.  PCR
“In-house”  buffers  and water  are filtered  using a 0.22+m  filter  (Millipore,
Molsheim,  France)  and  autoclaved.  All  of  the  followmg  are  aliquoted  and
stored at -20°C:
1.  Ampli-Taq  DNA-polymerase  5  U/uL  (Applied  Brosystems,  Warrmgton,
Cheshire,  UK).
2.  10X  PCR  buffer  II:  500 mMKC1,  100 &Tns  HCl,  pH  8.3 (Apphed  Biosystems)
3.  25  mM  MgCl,  (Applied  Biosystems)
4.  Lysis  buffer  (LB):  200  mM  KOH,  50 mM  dithiothreitol  (DTT)  (20).
5.  Neutralizing  buffer (NB):  900 mMTris  HCI,  pH  8.3,300  mMKC1,200  mMHCl(20).
6.  1 OX  PCR  [K+]  free:  25 nnI4  MgCl,,  gelatine  1 mg/mL,  100 mMTris  HCl,  pH  8.3
(Z2),  used  in  conjunction  with  LB  and  NB.
7.  dNTP  Mixture  (Pharmacia):  10 mM  stock  (loo-fold  dilution).
8.  Mineral  oil  (Applied  Biosystems).
9.  Thin-wall  PCR  tubes  (Sorenson  Bioscience,  Inc.,  Salt  Lake  Crty,  UT).
10.  Oligonucleotide  primers  were  synthesized  by  Pharmacta.  The  nucleotide
sequence  of the  different  primer  sets is shown  in  Table  1. They  were diluted  and
stored  at a concentration  of  40  fl.
Table  1
Nucleotide  Sequence  and  Cycling  Conditions  of  the  Different  Primer  Sets=
Expected
Primer  Sequence,  Y-k3  size,  bp
Cycling
conditions
No.  of
cycles
Amelogenin”
Outer  CTG  ATG  GTT  GGC  CTC  AAG  CCT  GTG  X  Band:  927
TAA  AGA  GAT  TCA  TTA  ACT  TGA  CTG  Y  Ban&  738
94T  for  30  s
58“C  for  60  s
72’C  for  60  s
94°C  for  30  s
68°C  for  90  s
72°C  for  30  s
28
Inner  TGA  CCA  GCT  TGG  TTC  TA(A/T)  CCC
CA(AlG)  ATG  AG(A/G)  AAA  CCA  GGG  TTC  CA
X  Band:  290
Y  Band:  105  35
“All  the cyclmg  parameters imbcated in the table for the d&rent  primer  sets were  preceded by an imhd  3-s denaturation step at 94°C and
mcluded a linal extension  step of 5 s at 72T
%escribed  m ref  7
The  outer primers were  descrbed  m ref  21, and the mner primers were  a g&  from Roger Mountford  (St. Mary’s  Hospital, Manchester, UK).
CF  AF508b
Outer
Inner
HPRT  exon  3
Outer
Inner
GAC  TTC  ACT  TCT  AAT  GAT  GAT
CTC  TIC  TAG  TTG  GCA  TGC
TGG  GAG  AAC  TGGAGC  CTT
GCT  TTG  ATG  ACG  CTT  CTG  TAT
GCA  GGC  ATG  GGG  TCT  CAC
GCC  CCC  CTT  GAG  CAC  ACA
TTG  CCC  AGG  TTG  GTG  TGG  AA
AGG  GCT  ACA  ATG  TGA  TGG  CC
193
154/151
199
158
96”/94”C  for  45  s
40°C  for  45  s
72OC  for  90  s
94°C  for  45  s
50°C  for  45  s
72°C  for  90  s
94°C  for  30  s
52°C  for  45  s
72°C  for  90  s
93°C  for  30  s
52°C  for  45  s
72°C  for  90  s
10 then  12
30
20
30
250  Ray  and  Handyside
11.  Random  15 mers  for  whole  genome  amplification  by PEP  were synthesized  using
a Cyclon  Milligene  synthesizer.  Because  the  syntheses reaction  is mttiated  by  one
specific  nucleotide  bound  to  the  column,  and  no  column  coated  with  all  four
nucleotides  1s available,  the  last  nucleotlde  at  the  3’  end  of  the  oligonucleotide
could  not  be  random.  Therefore,  for  all  15 nucleotldes  to  be completely  random,
where N  IS any nucleottde,  the  following  four  ohgonucleotides,  [N]i4-A,  [N]i4-C
[N],,-T,  and  [N]t4-G  were mixed  in  equimolar  amounts  to  obtain  a 400  flstock
12.  Temperature  cyclmg  was performed  on  a  Perkm  Elmer/Cetus  DNA  Thermal
cycler  model.
2.3.  Gel  Electrophoresis
2.3.1.  Polyacrylamide  Gel  Electrophoresis
1.  Acrylamide+bls-acrylamtde  29: 1  (v/v)  (Bio-Rad,  Hemel  Hempstead,  Hert-
fordshue,  UK).
2.  NJ&V’&‘-tetramethylethylenediamme  (TEMED)  (Sigma,  UK),  store at  4°C.
3.  10%  (w/v)  Ammomum  persulfate  (Sigma),  store  at 4°C  for  no  more  than  1 wk.
4.  10X  TBE  (Tris  base, boric  acid,  EDTA  from  Sigma),  store at room  temperature
5  Loading  buffer:  0.25%  (w/v)  bromophenol  blue,  0 25%  (w/v)  xylene  cyanole,
40%  (w/v)  sucrose (Sigma).
2.3.2.  Heteroduplex  Formation  for  A F508
Preamplified  DNA  from  homozygous  normal  and  AF508  cells,  premixed
with  loading  buffer.
2.4.  Restriction  Digestion  (Lesch-Nyhan  Syndrome)
XhoI  enzyme  and  10X  buffer  (Promega,  Southampton,  UK).
3.  Methods
3.1.  Single-Cell  Preparation
3.1.7.  Genera/  Code  of  Practice  for  Single-Cell  Preparation
Single  cells  or  blastomeres  are  handled  in  a clean  laboratory  (overshoes  and
gown  are  worn  at  all  times)  with  restricted  access,  and  no  DNA  work  is  per-
formed  in  this  room  (see  Notes  1 and  2).
3.1.2.  Blastomere  Preparation
Blastomeres  are  either  obtained  by  micromanipulation  of  cleavage-stage
embryos  (22)  or  for  research  purposes  by  disaggregating  the  whole  embryo
under  a  binocular  microscope  with  a  mouth  tube  and  pulled  Pasteur  plpet  as
follows:
1  Remove  the  zona  pellucida  from  cleavage-stage  embryos  with  acid  Tyrode’s
solution,  pH  2.2,  for  IO-30  s at room  temperature,  and return  the  embryo  imme-
diately  to  an excess of  HEPES-buffered  embryo  culture  medium.
Preimplantation  Diagnosis  251
2.  Separate  the  blastomeres  by  gentle  pipetmg  using  a pulled,  flamed  polished  glass
capillary.
3.  Rinse  the  plpet  thoroughly  by  pipeting  PBS  in  and  out.
4.  Introduce  the  blastomeres  into  individual  microcentrifuge  tubes  containing  5 pL
of  lysis  buffer  with  minimal  medium.  Rinse  the  pipet  as before  between  each
blastomere  manipulation.
5.  After  tubing  blastomeres  from  mdividual  embryos,  prepare  one  or  two  control
blanks  by  introducing  a small  volume  of the  medium  that  had  contained  the  blas-
tomeres  into  the  control  tubes.
6.  Add  50  pL  of  mineral  oil,  and  complete  the  lysis  by  heating  the  samples  for
10 min  at  65°C.
7.  If  not  used  immediately,  cells  may  be  kept  at -2O’C  for  up  to  3 mo.
8.  Alternatively,  the  lymphocytes  are placed  m  10 pL  of  ddH,O;  50  pL  of  mineral
oil  are  added  and the  samples  are denatured  at 95°C  for  5 min  (see Note  3).
3.1.3.  Lymphocyte  Isolation
1.  Separate  lymphocytes  from  unclotted  blood  collected  in  EDTA-treated  tubes  by
centrikgation  through  Ficoll-Paque*  Layer  4  mL  of  a  1’ 1 dilution  of  blood  and
PBS  onto  3 mL  of  Ficoll-Paque.  Centrifuge  for  30  mm  at  1600  rpm,  remove  the
supematant,  and  rmse  three  times  with  an excess of PBS  (see Note  3).
2.  Dilute  the  lymphocytes  in  filtered  PBS  containing  10 mg/mL  of BSA.
3.  Under  visual  control,  using  a binocular  microscope  and a mouth-controlled,  finely
pulled  glass pipet,  distribute  two to  five  lymphocytes  into  microdrops  (volume  of
about  1 pL)  of  the  same  medium  under  silicone  011.
4.  Transfer  single  lymphocytes  into  0.5~mL  thin-wall  mlcrocentrlfuge  tubes  con-
taining  10 I.LL ddH,O  or  5 JJL of lysis  buffer.
5.  Transfer  a sample  of  medium  from  each  drop  (every  two  to  five  lymphocytes)
into  control  blank  tubes
6.  Add  50 &  of mineral  oil,  and for the cells in water, heat the tubes to 95°C  for 5 min,  or
to 65°C  for  10 min  for cells in  lysis buffer,  to assure complete  cell  lysis (see Note  4).
7.  If  not  used  immediately,  cells  may  be kept  at -20°C  for  up  to  3 mo.
8.  Alternatively,  the  lymphocytes  are placed  in  10 yL  of  ddH20;  50  pL  of  mineral
oil  are added  and  the  samples  are denatured  at  95°C  for  5 mm  (see Note  3).
3.2.  PCR
3.2.1.  PCR  Setup
1.  Prepare  PCR  reaction  mixtures  for the  number  of tubes to be analyzed  plus  one  to
allow  for  inaccuracy  of  pipetmg  (Tables  2 and  3).  Both  outer  and  inner  amplifi-
cation  mix  can be prepared  at the  same time  and  the  inner  mix  kept  at 4°C  during
the  outer  amplification.
2.  Dispense the outer mix  into  the sample tubes, and perform  the frst  PCR  amplification.
3.  In  a  separate  laboratory  with  different  pipetor,  transfer  2-pL  aliquots  of  each
sample  into  a fresh  tube  containing  all  the  reagents  for  the  inner  amplification.
Table  2
Concentration  of  the  PCR  Reagents  for  Diagnosis  of  Lesch-Nyhan  Syndrome  and  AF508 Deletion
for  the  Diagnosis  of  CF  Using  the  AF508  Deletion
Outer  amplification  Inner  amplification
Lysis  buffer  protocol  Vol,  ILL  Lysis  with  ddI$O  Vol,  l.lL  Reagents  Vol,  pL
LB-contaming  cell  5  Hz0  with  cell  10  Amplified  product  2
NB  5  Mm2  (25  w  3  MgClz  3
10X  [K+]-free  5  10 X  (buffer  II)  5  10X  (buffer  II)  5
Nucleotides  (10  mA4)  0.5  Nucleotides  0.5  Nucleotides  05
Forward  primer  (40  @4)  1  Forward  primer  1  Forward  primer  1
Reverse  primer  (40  CrM)  1  Reverse  primer  1  Reverse  primer  1
AmpliTffq  (5 U/uL)  0.2  Taq polymerase  0.2  Tuq polymerase  1
ddH,O  32.3  ddH20  29.3  ddHzO  36.5
Total  50  Total  50  Total  50
Preimplanta  tion  Diagnosis  253
Table  3
Concentration  of  the  PCR  Reagents  for  the  Determination  of  Sex
Using  the  Amelogenin  Primers
Outer  amplification  Inner  amplification
Reagents  Vol,  uL  Reagents  Vol,  uL
ddH,O  containing  cell
M&l,  (25  W
10X  (buffer  II)
Nucleotides  (10  mM)
Forward  primer  (40  clM>
Reverse  primer  (40  clM>
AmpliTaq  (5 U/uL)
ddH,O
Total
10
3
5
0.5
1
1
0.2
29  3
50
Amplified  product  of
the  first  reaction
MgC1,
10X  (buffer  II)
Nucleotides
Forward  primer
Reverse  primer
AmpliTaq
ddH,O
Total
2
18
3
0.3
0.6
0.6
0.2
21  5
30
5’  QCCCCCCTTGAWACACA  3’
HPRT  GENE
5’  GCAGGCATGQi3QTCTCAC  3’
20 Cycles  5’  AGGQCTACAATGTQA~Q~C  3
I,  .d—  .d—
—–..-
5  (3CCCAGGrTQGrCIrGG;  3’
30 Cycles
and Xhol  dlgestion
113  bp  45  bp
Fig.  1. Schematic  representation  of the nested PCR  protocol  for Lesch-Nyhan  diagnosis.
Refer to Note  1 for  contamination  containment precautions during  the setup.
A  diagram  of  the nested protocol  for  amplification  of  part of the HPRT  gene IS
shown in  Fig.  1.
3.2.2.  PEP
1.  The  PEP  protocol  is almost  identical  to  the  original  protocol  described  in  ref.  12.
The  reaction  volume  is  50  yL  instead  of the  described  60  uL.  Each  reaction  tube
contains  5 uL  of LB,  NB,  and  10X  [IV]-free  buffer,  5 PL  of random  primers,  1 PL
of  dNTPs  and  Taq polymerase,  and  28  uL  of ddHzO.
254  Ray and  Handyside
2.  Perform  50  of the  following  cycles:  1 min  at 92°C  2 mm  at 37T,  a ramping  step
of  lO”/s  to  55°C  and  a 4-min  incubation  at 55°C.
3  Aliquot  3-5  l.tL of the PEP  product  for subsequent amplification  with  specific primers.
3.3.  Electrophoresis  and  Mutation  Detection
All  the  detection  techniques  described  here  were  chosen  (at  least  in  part)  for
their  speed and simplicity  (see Note  5).
3.3.1.  Polyacrylamide  Gel Electrophoresis
1.  Mix  8 pL  of the  amplified  product  with  2 ~.LL of loading  buffer.
2.  Load  the  samples  onto  a  10% polyacrylamide  minigel  (10  x 8  x 0.1  cm),  and  run
for  30  mm  at 200  V  in  a Bio-Rad  Mini  Protean  II  mmigel  apparatus
3.  After  electrophorests,  stain  the  gel  for  10 mm  m  0  5  pg/mL  ethidium  bromide
solution,  view,  and  photograph  under  UV  illumination
3.3.2.  Heteroduplex  Formation  for DF508
1.  Since  there  is  only  a  3-bp  size  difference  between  the  normal  and  the  affected
allele,  \etr  roduplex  formation  is used to  obtain  a fast, unambiguous  diagnosis  by
conventional  gel  electrophoresis.
2.  After  completion  of amplification,  dispense  two 5-PL  ahquots  of  each amphfica-
tion  product  into  two  fresh microcentrifuge  tubes.
3.  Add  5 PL  of previously  amplified  DNA  product  from  a homozygous  unaffected
and  affected  individual  to the  ahquots  of  test  DNA.
4.  Heat  the  mixtures  of DNA  to  95°C  for 2 mm  to  separate all  the DNA  strands,  and
cool  to  room  temperature  to  allow  the  random  reannealmg  of the  single-stranded
DNA  fragments.
5.  Run  the  mixed  products  on  a polyacrylamide  gel.
6.  Diagnosis  is  obtained  from  the  pattern  of  heteroduplex  formation  given  by  the
two  mixtures  (Fig.  2).  Heteroduplex  bands,  i.e.,  hybrid  double-stranded  DNA
made  from  the  hybridization  of the  amplification  product  of  one  normal  and  one
AF508  allele  are retarded  on the  gel  compared  to  homoduplex  bands  made  of  the
perfect  match  of  either  two  normal  or  AF508  alleles.  For  homozygous  samples,
one  band  (homoduplex)  is  visible  when  adding  DNA  of  the  same  genotype,
whereas there  are  two  bands  (homo-  and  heteroduplex)  when  adding  DNA  of  a
different  genotype.  With  amplified  product,  homo-  and  heteroduplex  bands  are
detected  in  both  mixtures.  In  the  case of  amplification  failure,  there  are no  het-
eroduplex  bands  in  either  of  the two  tracks.  Polyacrylamide  gel  showing  the  am-
plification  of  single  blastomeres  of  different  genotypes  is  shown  in  Fig.  2.
3.3.3.  Restriction  Digestion  (Lesch-Nyhan  Syndrome)
The  pattern  of  digestion  after  the XhoI  digest is indicative  of  the cell  geno-
type.  Fully  digested  samples  with  two  shorter  fragments  are  characteristic  of
homozygous  unaffected  cells;  undigested  samples with  only  one  full-length
Preimplan  ta tion  Diagnosis  255
Fig.  2.  AF508  PCR  amplification  from  single  blastomeres.
fragment  indicate  a homozygous  affected  (male)  cell.  A  partial  digest  with  three
DNA  fragments  indicates  a  heterozygous  carrier  (female)  cell.
1.  Incubate  17  pL  of  PCR  product  with  10 U  of  enzyme  (J&I)  and  2  uL  of  the
supplied  10X  buffer  for  1 h at  37°C.
2.  As  a control  for  complete  digestion,  an  aliquot  of  amplified  homozygous  unaf-
fected  product  should  be  digested  with  each batch  of  samples.
3.3.4.  Sexing  With  the  Amelogenin  Primers
Direct  visualization  of  the  X  band  only  (290  bp)  or  of  both  X  and  Y  (105  bp)
bands  allows  easy  sex  determination  after  gel  electrophoresis  (see  Note  6).
4.  Notes
1.  The  handling  of  all  the  reagents  and the  preparation  of the  PCR  mix  are carried
out  in  a laminar  downflow  cabinet  with  the  worker  wearing  a clean  gown  and
gloves.  No  extracted  DNA  or  amplified  PCR  product  is  ever  brought  into  this
protected  environment.  Dedicated  Gilson  pipets  and  sterile  filtered  tips  are used
to  prevent  contamination.  All  of the  reagents  are filtered  (0.22~urn  Millipore  fil-
ters)  and  aliquoted  into  sterile  tubes.  Numerous  control  blanks  containing  only
an aliquot  of  the  cell  containing  media  are also  prepared.
2.  As  previously  emphasized,  extreme  caution  should  be  exercised  to  avoid  con-
tamination.  Despite  stringent  precautions,  we  occasionally  observe  false  posi-
tives  in  O-10%  of  our  control  blanks.  This  level  of  contamination  may  be
acceptable  if  the  amplification  efficiency  is high  and transfer  of  heterozygotes  is
avoided,  since it  is only  the combination  of amplification  failure  and contamination
that  potentially  leads to the  most  serious risk  of misdiagnosis  (i.e.,  misdiagnosis  of
an affected  embryo  as unaffected).  Contamination  seems to build  up  after periods
256  Ray  and  Handyside
of  extensive  use  of  one  set of  primers  m  the  lab.  This  suggest  that  contamina-
tion  from  prevrous  PCR  IS the  most  prevalent  source,  despite  the  measures  for
containment  taken  during  the  different  steps  of  the  PCR.  Amplified  PCR
products  must  accumulate  either  m  the  laminar  flow  cabinet  despite  UV  decon-
tamination  or  in  the  room  where  single-cell  tubing  is performed.  This  stresses
the  need  for  regular  quality  control  with  numerous  control  blanks  (at  least  50)  to
test the  reagents,  and  the  procedures  involved  in  blastomere  handling  and  PCR
preparation.
3.  There  are  three  crittcal  steps to  achieve  a clean  separation  devoid  of  red  cells,
which  could  be  confused  with  lymphocytes  during  the  selection,  and  excessive
impurities.
a.  Be  very  gentle  when  layering  the  diluted  blood  onto  the  Ficoll,  so as not  to
mtx  the  two  phases.
b.  Start  the  first  centrtfugatron  as slowly  as  possrble,  and  Increase  the  speed
very  slowly  up  to  1600  rpm.
c.  The  rinses  are Important  to  remove  cell  debris  and  platelets  that  might  later
introduce  contamination
4.  A  freezing  step  might  be  mcorporated  to  assure  complete  cell  lys~s. Although
not  necessary  with  the use of  lysis  buffer,  freezing  seems  to  improve  amphfica-
tion  efficiency  sltghtly.
5.  Presently,  because  of  IVF  tmperattves,  it  is  preferable  that  embryos  are  trans-
ferred  on  d  3  postmsemmation,  the  same  day  as  embryo  btopsy.  Hence  the
genetic  analysts  has  to  be  rapid,  if  possible  no  more  than  8  h  to  avoid  late
transfers.  For  the  CF  and  Lesch-Nyhan  tests  described  here,  the  outer  amplifi-
cation  takes  about  2  h,  the  mner  about  3  h,  and  the  gel  loading,  running,  and
staining  about  1 h.  Allowing  for  some  breathing  space,  the  whole  procedure
takes  about  7  h, when  testmg  a typical  number  of  samples  and  controls.
6.  We  have  used the  amelogenin  primers  both  directly  on  single  cells  and  on  PEP
product  Amplification  rate  is relatively  low  (-75%)  Also  on  a number  of  oc-
casions,  we observed  a failure  of  amplification  of  either  the  X  or  the  Y  frag-
ment,  i.e.,  ADO  (11).  The  amelogenm  primers  are  not  used  for  clmical  cases.
Sexing  by  FISH  is  more  informative,  allowing  the  detection  of  aneuplotdy  or
abnormal  numbers  of  sex chromosomes  and  also  is not  susceptible  to  contamt-
nation  (23).  Other  sexing  primers  amplifying  sequences  common  to  the  X  and
the  Y  chromosome  have  been  described  for  smgle-cell  amphtication,  including
hemi-nested  primers  amplifying  the  steroid  sulfatase  gene  on  the  X  chromo-
some  and pseudogene  on the  Y  (12).  We  obtained  good  amplification  with  them,
but  found  the  ratio  of X  and  Y  specific  primers  to  be crttical  to  obtammg  good
amplification  of  both  chromosomes  when  amplifying  male  cells.  Primers  have
also  been  described  that  amplify  the  ZFX  and  ZFY  sequences  with  high  effi-
ciency  and  accuracy  (24).  Their  mam  advantage  is that  the  amplified  sequences
on  the  X  and  the  Y  chromosomes  are  of  equal  size,  but  are distinguishable  by
restriction  digestton  because  of  an  additional  site  in  the  Y  fragment.  This  fea-
ture  therefore  decreases the  risks  of  preferential  amplification.
Preimplantation  Diagnosis  257
References
1.  Handyside,  A.  H  (1993)  Diagnosis  of  inherited  disease  before  implantation
Reprod.  Med  Rev  2,5  l-6  1
2  Mullis,  K  and  Faloona,  F.  (1987)  Specific  synthesis  of  DNA  in  vitro  vta  a poly-
merase-catalysed  chain  reaction  Methods  Enzymol  155,  335-350.
3  Li,  A.,  Gyllenstein,  U.  B.,  Cut,  X.,  Saiki,  R.  K.,  Erhch,  H.  A  ,  and  Arnhetm,  N
(1988)  Amplification  and  analysis  of  DNA  sequences  m  single  human  sperm  and
diploid  cells.  Nature  335,414-419.
4.  Cui,  X.  F.,  Li,  H  H  , Goradia,  T.  M  , Lange,  K.,  Kazaztan,  H.  H  J , Galas,  D.,  and
Amheim,  N  (1989)  Smgle-sperm  typing:  determination  of genetic  distance  between
the  G  gamma-globm  and parathyrotd  hormone  loci  by  using  the polymerase  cham
reaction  and  allele-specific  ohgomers  Proc  Natl  Acad  Scz  USA  86,9389-9393
5  Coutelle,  C.,  Williams,  C  , Handyside,  A.,  Hardy,  K.,  Winston,  R.,  and  Wtlham-
son, R  (1989)  Genetic  analysis  of DNA  from  single  human  oocytes  a model  for
preimplantation  diagnosis  of  cystic  fibrosis  Br  Med.  J  299,  22-24.
6.  Handyside,  A  H.,  Kontogianm,  E.  H.,  Hardy,  K  ,  and  Wmston,  R.  M  (1990)
Pregnancies  from  biopsied  human  pretmplantation  embryos  sexed  by  Y-specific
DNA  amplification  Nature  344,768-770.
7  Handyside,  A.  H.,  Lesko,  J. G  , Tarin,  J  J.,  Winston,  R.  M.,  and  Hughes,  M.  R.
(1992)  Birth  of  a normal  girl  after  in  vitro  fertilization  and  preimplantatron  diag-
nostic  testing  for  cystic  fibrosis.  N  Engl  J.  Med  327,  905-909
8.  Ray,  P  F  , Winston,  R  M.  L  , and  Handyside,  A.  H.  (1994)  Single  cell  analysis
for  diagnosis  of  cystic  fibrosis  and  Lesch-Nyhan  syndrome  m  human  embryos
before  implantation.  Miami  Bro/Technol  $46  (abstract)
9.  Ao,  A.,  Ray,  P  ,  Lesko,  J , Harper,  J  C  , Handyside,  A.  H  , Hughes,  M.  R.,  and
Wmston,  R.  M  L  (1996)  Clmical  experience  with  preimplantation  diagnosis  of
the  AF508  deletion  causing  cystic  fibrosis.  Prenat  Dzagn  (m  press)
IO.  Lesko,  J.,  Snabes, M  , Handyside,  A  H.,  and  Hughes,  M.  (199 1) Amphficatton  of
the  cystic  fibrosis  A F508  mutation  from  smgle  cells:  applmations  toward  genetic
diagnosis  of the preimplantation  embryo.  Am.  J  Hum  Genet  49(4),  223  (abstract)
11.  Ray,  P  F.  (1996)  Increasing  the  denaturation  temperature  during  the  first  cycles
of  nested  amplification  reduces  allele  dropout  from  single  cells  for  preimplanta-
tion  genetic  diagnosis.  Mol.  Hum.  Reprod  (m  press).
12.  Zhang,  L  , Cui,  X.,  Schmitt,  K.,  Hubert,  R  , Navidt,  W.,  and  Amheim,  N.  (1992)
Whole  genome  amplification  from  a single  cell:  implications  for  genetic  analysis.
Proc  Nat1  Acad  Scz  USA  89,5847-5851.
13.  Jeffreys,  A  J.,  Wilson,  V  , and  Thein,  S. L  (1985)  Hypervariable  “mimsatellite”
regions  in  human  DNA.  Nature  314,67-73.
14.  Nakamura,  Y.,  Leppert,  M.,  O’Connell,  P.,  Wolff,  R  , Holm,  T.,  Culver,  M.,  et al.
(1987)  Vanable  number  of tandem  repeat  (VNTR)  markers  for  human  gene  map-
pmg  Science  235,  1616-l  622.
15.  Ray,  P.  F.,  Harper,  J ,  Mountford,  R  ,  Elles,  R.,  and  Handystde,  A.  H.  (1992)
Analysis  of  simple  tandem  repeats  following  whole  genome  amphflcation  from
258  Ray  and  Hanciyside
single  cells  for  preimplantatlon  diagnosis  of  Duchenne  muscular  dystrophy  J
Reprod  Fert  Abstr.  Series  No.  lo,52
16  Knstjansson,  K  , Chong,  S  S , Van  den  Veyver,  I  B  , Subramanian,  S  , Snabes,
M  C.,  and Hughes,  M.  R  (1994)  Prelmplantatlon  single  cell  analyses of dystrophin
gene  deletions  usmg  whole  genome  amphficatlon  Nature  Genet  6,  19-23.
17  Fmdlay,  I.,  Ray,  P.,  Qmrque,  P  ,  Rutherford,  A.,  and  Lllford,  R.  (1995)  Allelic
drop-out  and  preferenttal  ampllficatlon  m  single  cells  and  human  blastomeres:
lmpllcatlons  for  prelmplantatlon  dlagnosls  of  sex  and  cystic  fibrosis  Hum.
Reprod  10,  1609-1618.
18  Fmdlay,  I  , Urquart,  A.,  Qulrque,  P.,  Sullivan,  K  M.,  Rutherford,  A  , and  Lllford,
R  (1995)  Simultaneous  DNA  “fingerprinting”,  diagnosis  of  sex and  single-gene
defect  status  from  a single  cell  Hum  Reprod  10,  1005-1013.
19.  Harper,  J  C.  (1996)  Prelmplantatlon  diagnosis  of inherited  disease.  An  update  of
world  figures  J  Assoc  Reprod  Genet  (in  press).
20.  Ll,  H  , Cm,  X.,  and Amhelm,  N.  (1991)  A  Companton  to Methods  zn Enzymology,
Academic,  New  York.
2 1  Nakahon,  Y  , Hamanao,  K.,  Iwaya,  M.,  and  Nakagome,  Y.  (199 1) Sex ldentifica-
tlon  by  polymerase  chain  reaction  using  X-Y  homologous  primer.  Am  J  Med
Genet  39,472,473
22  Handyside,  A.  H  ,  Pattinson,  J. K  , Penketh,  R.  J., Delhanty,  J. D.,  Winston,  R  M  ,
and  Tuddenham,  E  G.  (1989)  BIOPSY  of  human  prelmplantation  embryos  and
sexing  by  DNA  ampltficatlon.  Lancet  1,347-349.
23  Delhanty,  J. D.  A.,  Griffin,  D.  K  , Handyside,  A.  H.,  Harper,  J , Atkinson,  G.  H.  G.,
Pleters,  M  H  E  C.,  and  Winston,  R.  M.  L.  (1993)  Detection  of  aneuploidy  and
chromosomal  mosalcism  m  human  embryos  during  preimplantatlon  sex  deter-
mmatlon  by  fluorescent  m  situ  hybrldlzation  (FISH).  Hum  Mol  Genet  2(8),
1183-1185.
24.  Chong,  S.  S.,  KrlstJansson,  K.,  Cota,  J.,  Handyside,  A  H.,  and  Hughes,  M.  R.
(1993)  Prelmplantation  diagnosis  of  X-linked  disease:  reliable  and  rapid  sex
determination  of single  human  cells  by  restriction  site  analysis  of  simultaneously
amphfied  ZFX  and  ZFY  sequences  Hum  Mol  Genet  8,  1187-l  19 1
15
FISH  in  Preimplantation  Diagnosis
Joyce  C. Harper  and  Joy  D. A.  Delhanty
1. Introduction
Analysis  of  chromosomes  in  human  embryonic  nuclei  would  ideally  be
achieved  by karyotypmg.  Several  studies have  used this technique to examme
human  embryonic  chromosomes  (l–4),  but  mformation  is limited,  since it  is
difficult  to  obtain  bandable  metaphase spreads. For  pretmplantatlon  genetic
diagnosis (PGD)  where  only one or maybe two cells are available,  karyotypmg
is not  a viable  option  because of  its low  success rate  per  single  cell.  How-
ever,  in  certain  cases, fluorescent  in  situ  hybrtdizatlon  (FISH)  can be used,
for  instance,  for  sexing  embryos  for  couples  at risk  of  passing  on  X-lmked
disorders for  which  there ts, as yet, no specific molecular  diagnoses. In  addition
FISH  is useful  for  couples who  are subfertile  owing  to chromosomal  disorders
(translocatrons  or  gonadal  mosaiclsm).  Smce these are among  the most com-
mon  reasons for  requesting  PGD,  a laboratory  contemplatmg  providmg  this
service  should include  FISH  in  its repertoire
Although  it  is now  possible to  amplify  simultaneously  X  and Y  sequences
for  sexing embryos using the polymerase cham reaction  (PCR)  (5,6),  there are
several  drawbacks  that apply when  amplifying  DNA  from  single blastomeres,
and FISH  is preferable.  The  first  is the risk  of  selective  amplification  failure.
The second is the risk of  amplifying  contammating  material;  this applies to any
reaction  involving  PCR. The  third  is that  the presence of  an amplified  band
only  indicates that an X  or Y  chromosome 1s present and gives  no mformation
on  copy  number.  Because we  have  accumulated  data  from  pretmplantatton
diagnosis  cases by  FISH  analysis,  the  importance  of  the  copy  number  has
become apparent.  It  is our  experience that m about one-third  of  embryos, the
biopsied  cell  contains  an abnormal  number  of  X  signals making  the embryo
unsmtable for  transfer  despite the absence of a Y-specific  signal (7, Harper  and
From  Methods  m  Molecular  Medmne  Molecular  Dlagnosa  of  Genebc  Diseases
Edlted  by  R  Elles  Humana  Press  Inc  ,  Totowa,  NJ
259
260  Harper  and  Delhanty
Delhanty,  unpublished  observations).  From apparently  normal  embryos, blas-
tomere nuclei  with  a single X  chromosome  and those with  three, four,  or more
signals  are  frequently  observed  (8-10).  The  former  is  potentially  the  most
disastrous when  the aim  is to avoid  X-lmked  disease from  the carrier  mother,
since in  the majority  of  fully  X-monosomic  embryos,  it  is  the  paternal  sex
chromosome that is lacking. Since 45,X  conceptuses are considered to occur with
a frequency approaching  l%,  such a finding  will  not be rare  when  carrying  out
PGD and has been reported  (7)
Information  on  chromosome  copy  number  has  enabled  us  to  avoid  the
transfer  of  abnormal  or  chromosomally  mosaic  embryos.  This  facility  is
enhanced by the use of  an autosomal  probe  in  addition  to probes  for  the sex
chromosomes, since this gives extra information  and allows  a more exact analy-
sis. We routmely  perform  PGD of  sex using triple-color  FISH  with  probes for
chromosomes X,  Y, and  1 (Fig.  1).
Smce we first  reported  the use of FISH  for  PGD  (1 I),  several improvements
to the technique  have  been made. The initial  method  used to spread mterphase
human  blastomeres  was  a modification  of  Tarkowski  (22),  which  used  3:l
methanol  acetrc acid  as the  fixative  (II).  For  spreading  single  human  blas-
tomeres, this method  is problematic  since a large amount  of  cytoplasm cannot
be effectively  removed  and the blastomeres are easily lost during the procedure.
More  recently,  we  have  used  a  spreading  method  developed  in  mouse
embryos  (13),  which  can be successfully applied  to human blastomeres (9)  or
whole  embryos (20,14,15).  The  spreading solution  used is HCl  and Tween-20,
which  dissolves  the cell membrane  and allows  direct visualization  of  the blas-
tomere,  so that  the  cytoplasm  can  be totally  washed  away  leaving  a  clear
nucleus.  Second, the original  method  described  used a long  RNase and  pro-
teinase  K  digestion  to  make  the  nuclei  accessible to  the  probes.  With  the
improved  spreading method,  we have  been able to reduce this digestion  to 20
min  using  pepsin.  Finally,  using  DNA  probes  labeled  with  biotin  or  digoxy-
genin  requires  long  detection procedures  We now  use probes directly  labeled
with  the fluorochromes,  which  greatly  reduces the overall  procedure  time. Our
original  FISH  method  took  approx  7 h, but  with  the  improvements  outlined
here, the whole  procedure  now  takes just  2 h  (9). Since the biopsy,  diagnosis,
and transfer  all  take place on the same day (d 3 postinsemmation),  the diagno-
sis ts completed  at an earher  time, allowing  the embryo  transfer  to  take  place
within  normal  working  hours.
There  have to date been no misdiagnoses following  the identification  of  sex
by  FISH,  and the number  of  deliveries  per cycle is slightly  higher  with  FISH
than  with  PCR  (16,17).  However,  interestingly,  an excess of  male-to-female
embryos has been observed  when  performmg  sexing for  X-linked  disease (18,
Harper  and Delhanty,  unpublished  observations).  The  use of  cosmid and YAC
Fig.  1.  Triple-color  FISH  in  human  embryonic  nuclei:  X  probe  labeled  green,  Y  probe
labeled  red,  and  chromosome  1 probe  labeled  orange.  (A)  Normal  male,  XY  11; (B)  normal
female,  XX1  1;  (C)  haploid,  Xl  ;  (D)  tetraploid,  XXXXl  111;  (E)  aneuploid,  XXY  11;  (F)
X  11.  All  images  were  captured  on  a  cooled  CCD  camera  using  Smart  Capture  Software
(software  from  Digital  Scientific,  Cambridge,  UK).
262  Harper  and  Delhanty
DNA  probes carrying  large inserts has been successfully applied  to  embryonic
nuclei  and could  be used in specific  cases. However,  FISH  for  the diagnosis of
chromosomal  disorders  (translocatlons  or  gonadal  mosalcism)  1s still  m  the
research stage (Harper  and Delhanty,  unpublished  observations).  Therefore,  in
this  chapter,  we  concentrate  on the  use of  FISH  using  a-satellite  probes  for
sexmg human  embryos.
2.  Materials
2.1.  Nick  Translation  of  DNA  Probes
2.1.1.  DNA  Probes
The  DNA  probes used for  sexing human  embryos are’
1.  X  chromosome:  pBam  X5  (19).
2  Y  chromosome:  cY98  (Wolfe,  personal  communication).
3  1 chromosome:  pUCl  77  (20)
2.1.2.  Nick  Translation
1  1 pg  DNA  probe.
2  10X  Nick  translation  buffer:  0 5MTris-HCl,  pH  7 5,O. 1Mmagnesnun  sulfate,  1 mA4
dlthlothreltol  (DTT,  Sigma  [St.  Louis,  MO],  D0632).  Store  stock  at -20°C.
3.  O.lMDTT.
4  Nucleotide  mix  conslstmg  of
a.  0.5  mM  2’deoxyguanosine  S-triphosphate  (100  n&?,  pH  7.5,  Pharmacia
[Uppsala,  Sweden],  27-2070-01).
b  0.5  mM  2’deoxyadenosme  5’-triphosphate  (100  mM,  pH  7 5,  Pharmacia,
27-2050-01).
c  0  5  mM  2’deoxycytidme  5’-tnphosphate  (100  mM,  pH  7.5,  Pharmacla,
27-2060-01).
d.  0.1  mM  2’deoxythymldme  5’-triphosphate  (100  mM,  pH  7.5,  Pharmacia,
27-2080-01).
5.  1 mM  Label:  either  FITC-12-dUTP  (Boehrmger  Mannhelm  [Mannheim,  Ger-
many],  1373242)  or  Fluorored  (Amersham  [Amersham,  UK],  RPN  2122).
6.  DNA  polymerase  I  (Promega  [Madison,  WI],  3642302).
7.  DNase  I  (Boehringer  Mannheim,  104159),  from  bovine  pancrease, grade  II.  Make
1 mg/mL  stock  m  20  rnA4 Tns-HCl,  pH  7.6,  50  mM  NaCl,  1 mM  DTT,  50%
glycerol.  Store  at -20°C.  When  required,  dilute  1 in  1,000  with  distilled  water,
store  on  ice,  and  discard  when nick  translation  is  complete
8  0.5MEDTA,  dlsodium  salt  (BDH  [Poole,  UK],  10093)
9.  Herring  sperm  DNA  (Sigma,  D-7290)
10.  3M  Sodium  acetate.
11.  TE  (10  mA4 Tns-HCl,  1 mM  EDTA,  pH  7.6).
12.  Hybridization  buffer  2X  SSC,  60%  deionized  formamide  (BDH,  product
103264R).
FISH  263
2.2.  Preparation  of  Cells
2.2.1.  Spreading  Single  Blastomeres
1  Poly-L-lysme  coated  slides  stored  at 4°C  (Poly-L-lysine,  Sigma,  P8920).
2.  Spreading  solution.  O.OlMHCl,  0.1%  Tween-20.  Stocks are made  of  I%  Tween-20
and  1M  HCI,  and  the  final  solution  made  fresh  on  day  of  use
2.2.2.  Preparation  of  Control  Lymphocyte  Slides
Standard cytogenetlc preparations  of male control  lymphocytes are stored in
3: 1 methanol:acetic  acid at -2OOC.
2.3.  FISH
1  100  pg/mL  Pepsin  (Sigma,  P6887)  in  O.OlMHCl.  Pepsin  IS stored  as 10 mg/mL
stock  (500-pL  ahquots)  and  is  stable  at -20°C  for  up  to  2 mo.  Do  not  refreeze.
2.  1% Paraformaldehyde in  phosphate-buffered saline (PBS, 0 OlM  phosphate
buffer,  0.0027Mpotassmm  chloride,  and  0.137Msodium  chloride,  pH  7.4).
3.  2X  SSC  stored  as stock  of  20X  SSC  (3M  sodium  chloride,  0 3M  trisodmm  clt-
rate,  pH  7.2).
4.  60%  Deionized  formamide  m  2X  SSC
5  4X  SSC, 0 05% Tween-20
6.  Mounting  medium:  1 mL  Vectarshield  (Vectar Laboratones,  Burlmgame,  CA)  mixed
with  6 pL  0.2  mg/mL  4’,6-diaminidino-2-phenyolindole  (DAPI)  stored  at 4°C  in
the  dark
3.  Methods
3.1.  Nick  Translation  of  DNA  Probes
The  method  described here is shghtly  modified  from  Rigby  et al, (21)  (see
Note  1).
1.  On  ice,  mix:  5  pL  10X  nick  translation  buffer,  5  pL  0  IMDTT,  4  pL  nucleotlde
mix,  2  yL  1 mM  label,  xx  pL  probe  DNA  (1  pg),  xx  pL  filtered  bldlstllled
water,  2  FL  DNA  polymerase  I,  5 yL  DNase  I.  The  volume  of the probe  required
for  1 pg  will  depend  on  the  stock,  and  the  volume  of  filtered  bldlstllled  water
should  be adjusted  to  give  a final  volume  of  50  pL.
2  Incubate  at  15°C  for  1 h,  and  add  an  additional  5 pL  of  DNase  I.
3.  Incubate  for  a further  hour.
4.  Stop  the  reaction  by  adding  5  pL  of  0.5M  EDTA,  and  keep  on  ice.
5.  Ethanol-precipitate  the  DNA  by  adding  5  pL  herring  sperm  DNA,  l/10  vol  3M
sodium  acetate  (6  pL)  and  I  pL  Ice-cold  ethanol.  Invert  several  times,  and  leave
for  1 h  at -70°C  or  overmght  at -20°C
6.  Spin  on  a  mlcrocentrlfuge  at  top  speed  for  15 mm,  remove  ethanol,  and  allow
pellet  to  dry  Resuspend  probe  m  either  TE  (store  at -20°C  )  or  hybrldlzatlon
buffer  (store at 4°C)  m  the dark.
Harper  and  Delhan  ty 264
3.2.  Preparation  of  Cells
3.2.  I.  Spreading  Single  Blastomeres
Single  embryonic  cells are obtained  from  embryo  biopsy  or by dlsaggrega-
tion  of  whole  embryos  as detailed  m Chapter  14. For  blastomere  handling,  a
fine,  flame-polished  glass capillary  tube is used. A video  of  this procedure  has
been produced  (22).
1.  Make  a ctrcle  on  the  understde  of a poly+lysme  shde  usmg  a diamond  marker
2  Under  a dissectmg  microscope,  wash the  cell  in  PBS  to  remove  serum  protems,
and  other  contaminating  material
3  Prime  the capillary  with  spreading  solution,  and transfer  the blastomere  to a small
drop  of  spreading  solution  within  the  circle,  ensuring  mmimum  transfer  of  PBS.
4  Under  an inverted  microscope,  gently  remove  and replace  the  spreading  solution.
The  shape  of  the  blastomere  may  distort  and  form  “buds.”  At  this  stage,  the
nucleus  should  be visible.
5.  With  constant  observation,  keep  removing  and  replacmg  the  solution  until  the
cell  membrane  lyses and the cytoplasm  washes away from  the nucleus  (see Note  2)
6.  Once the  nucleus  is clear,  leave the slide  to  air-dry,  and  incubate  m  PBS  for  5 mm.
7.  Dehydrate  the  slides  for  5 mm  m  70,  90,  and  100%  ethanol,  and  store  for  up
to  2  wk  at room  temperature  (see Note  3)
3.2.2.  Preparation  of  Control  lymphocyte  Slides
1  Centrifuge  the  fixed  cell  suspension  at  400g  for  5  mm,  and  resuspend  cells  m
fresh fixative  (3  1 methanol.acetic  acid)
2  Drop  the  suspension  onto  a clean  slide,  leave  to  air-dry
3.  Flood  with  fixative  for  10 s, and  leave  to  an-dry
4  Flood  the  slide  with  70%  acetic  acid  for  10  s, leave  to  an-dry,  and  dehydrate
through  a 70,  90,  and  100%  ethanol  series.
3.3.  FISH
Incubate  the  slides  for  20  mm  at  37°C  m  100  pg/mL  pepsin  m  0 OlM  HCl  to
remove  any remaining  protein,  and  make  the  nuclei  accessible  to  the  probes
Briefly  wash the  slides  m  bidistilled  water  and  PBS,  and  incubate  for  10 min  at
4°C  m  1% paraformaldehyde  in  PBS  to  refix  the  nuclei
Briefly  wash  m  PBS  and  a  further  two  washes  m  water,  and  dehydrate  slides
through  a 70,90,  and  100%  ethanol  series. The  nuclei  are now ready  for denatur-
ation  and  hybridization  to  the  probes  The  probes  are used  m  a concentration  of
5-10  ng/pL  of  hybridization  mix  (60%  formamide,  2X  SSC,  10%  dextran  sul-
fate)  For  triple-color  FISH,  we use  the  X  probe  labeled  with  FITC,  the  Y  with
rhodamme,  and  the probe  for  chromosome  1 m  a 50:50  mix  of FITC:rhodamme,
which  will  give  an orange  fluorescence  (23,24).
Add  the  probes  to  the  nuclei  under  a coverslip  (see Note  4),  and  denature  the
probe  and  nuclear  DNA  simultaneously  at 75°C  for  3 mm.
FlSH  265
5.  Leave  to  hybridize  m  a moist  chamber  at  37°C  for  45  min.
6.  To  remove  unbound  probe,  wash the slides  for  5 mm  at 42°C  m  60%  formamtde,
2X  SSC,  5 min  at 42°C  m  2X  SSC,  and two  5-min  washes at room  temperature  in
4X  SSC/O.OS%  Tween-20.  All  posthybridization  washes  should  be performed
in  the  dark.
7.  Dehydrate  the  slides  through  a  70,  90,  and  100%  ethanol  series,  mount  in
Vectarshield  mounting  medium  containing  DAPI,  and  analyze  (see Note  5).
8.  Slides  should  be  stored  in  the  dark  at 4“C.
3.3.1.  Interpretation  and  Artifacts
FISH  signals are analyzed according  to Hopman  et al. (25).  For two  signals
lying  close  together  to  be  considered  as  separate  signals,  they  must  be  more
than one signal  diameter  apart. Since the DNA  of  interphase nuclei  is decon-
densed  compared  to  chromosomes  in  metaphase,  there  is a much  greater  likeli-
hood of the signals from  homologous  chromosomes overlying  one another with
the result  that only  one signal  is scored. For this reason, it IS advantageous  to
have  two  independently  biopsied  cells, so that if  a reduced  signal  number  is
seen  for  one  chromosome  pair  in  one  nucleus  only  and  the  other  is  normal
female,  the  embryo  can still  be considered  for  transfer.  In  this  situation,  the
additional  information  provided  by  an  autosomal  probe  provides  valuable
reassurance. Diagnosis  of  a normal  female  embryo  is only  made when  two  X
signals  are  present  in  the  absence  of  a Y  signal,  with  two  autosomal  signals.
3.3.2.  Mosaicism
Mosaicism in a basically normal diploid  embryo is of  four  types: diploidihap-
loid  (Fig.  lC),  diploid/tetraploid  (Fig.  lD),  diploid/aneuploid  (owing  to mitotic
nondisjunction)  (Fig.  1 E,F),  and  completely  chaotic  division.  Diploid/haploid
mosaicism is common, and has important  implications  for  the diagnosis of  both
dominant  single  gene disorders  and chromosomal  trisomies,  should  a haploid
cell be biopsied  (10,16).
It  is important  not to disregard  abnormal  signal numbers, particularly  when
only  a single  cell is available  for  analysis. In  our experience, it is indicative  of
a full  or  mosaic abnormality  in  the remainder  of  an embryo  in  9 of  10 cases
(Harper  and  Delhanty,  unpublished  observations).  Human  cleavage-stage
embryos  seem to  constitute  a special case with  regard  to  genetic  instability,
both  at the chromosomal  and DNA  levels,  and the criteria  are not the same as
when  dealing  with  cells from  somatic sources (26).
4.  Notes
1.  a-Satellite  probes  can be obtained  as plasmids  or already  transformed  into  bacte-
ria,  which  can  be  grown  up  and  the  DNA  purified  to  give  large  quantities  of
unlabeled  probe.  The  probes  can be directly  labeled  by mck  translation  using  first
266  Harper  and  Delhanty
principle  methods  or  using  commercial  kits  for  biotin  or  digoxygenin  labeling.
Some  methods  purify  the  labeled  probe  through  Sephadex  columns,  but  we have
experienced  loss  of  our  directly  labeled  probes  using  these  columns.  We  have
found  that  an ethanol  precipitation  is  sufficient  and the  probe  can then  be  stored
m  either  TE  or  hybridization  buffer  (60%  formamide,  2X  SSC).  Directly  labeled
a-satellite  probes  can also be obtained  commercially.  The  reliabtltty  of any probe
used must  be  confirmed  on male  control  lymphocytes,  ensuring  that  the  majority
of  the  nuclei  show the  expected  number  of  signals.
2.  It  is  important  to  observe  constantly  the  cell/nucleus  throughout  the  procedure.
The  spreading  solution  must  not  be allowed  to dry  out before  the  cell  lyses. Nuclei
can be obscured  by the  addition  of too  much  spreading  solution  and  lost  owing  to
inconsistent  observation,  especially  after  cell  lysis.  If  too  much  cytoplasm  is left
around  the  nucleus  during  spreading,  the  nucleus  may  be  lost  from  the  slide  dur-
ing  the pepsin  digestion.  It  should  take  no  longer  than  5 mm  to  spread  a nucleus.
3.  For  easy  location  of  the  nucleus  after  spreading,  coordinates  can  be  recorded
either  from  the  microscope  stage  or using  an England  finder.
4.  Since  each slide  only  contains  one nucleus,  we use 5 yL  of the  final  hybridization
mix  under  a  13-mm  coverslip.  The  hybridization  time  is  only  45  min,  so sealing
the  coverslips  with  glue  is not  required.
5.  Using  triple-color  FISH,  it  is best to  use a double  band  pass filter,  which  detects
FITC  and  rhodamine,  allowmg  the  three  colors  to  be  detected  simultaneously.
References
1.  Angell,  R  R.,  Templeton,  A.  A.,  and  Messmis,  I.  E  (1986)  Consequences  of
polyspermy  in  man  Cytogenet.  Cell  Genet  42,  l-7
2.  Plachot,  M.,  Mandelbaum,  J.,  Junta,  A.-M.,  Grouchy,  J.,  de Salat-Baroux,  J.,  and
Cohen,  J. (1989)  Cytogenetic  analysis  and  developmental  capacity  of normal  and
abnormal  embryos  after  IVF.  Hum.  Reprod.  4,99-103
3.  Zenzes,  M.  T.  and  Casper,  R.  F.  (1992)  Cytogenetics  of  human  oocytes,  zygotes
and  embryos  after  in  vitro  fertilisation.  Hum  Genet.  88,367-375.
4.  Jamieson,  M.  E., Coutts, J. R.  T.,  and Connor,  J. M.  (1994)  The  chromosome  constitn-
tion  of human  prelmplantation  embryos  fertilised  in  vitro.  Hum.  Reprod  9,70%7  15.
5.  Chong,  S.  S.,  Kristjansson,  K.,  Cota,  J.,  Handyside,  A.  H.,  and  Hughes,  M.  R.
(1993)  Preimplantation  prevention  of  X-lmked  disease:  reliable  and  rapid  sex
determination  of  single  human  cells  by  restriction  analysis  of  simultaneously
amplified  ZFX  and  ZFY  sequences. Hum.  Mol.  Genet  2,  1187-l  19 1.
6.  Liu,  J.,  Lissens,  W.,  Devroy,  P.,  Van  Steirteghem,  A.,  and  Liebers,  I.  (1994)
Amplification  of  X-  and  Y-specific  regions  from  single  human  blastomeres  by
polymerase  chain  reaction  for  sexing  of  preimplantation  embryos.  Hum.  Reprod.
9,716-729.
7.  Delhanty,  J. D.  A.,  Griffin,  D.  K.,  Handyside,  A.  H.,  Harper,  J., Atkmson,  G.  H.  G.,
Pieters,  M.  H.  E.  C.,  and  Winston,  R.  M.  L.  (1993)  Detection  of  aneuploidy  and
chromosomal  mosaicism  in  human  embryos  during  preimplantation  sex determi-
nation  by  fluorescent  m-situ  hybridisation.  Hum.  Mol.  Genet  2,  1183-l  185.
FISH  267
8.  Munne,  S., Lee,  A.,  Rosenwaks,  Z.,  Grifo,  J.,  and  Cohen,  J.  (1993)  Diagnosis  of
maJor  chromosome  aneuploidies  in  human  preimplantation  embryos.  Hum.
Reprod.  8,2  185-2  19 1.
9.  Harper,  J.  C.,  Coonen,  E.,  Ramaekers,  F. C.  S.,  Delhanty,  J. D.  A  , Handyside,
A.  H.,  Winston,  R.  M  L.,  and  Hopman,  A.  H.  N.  (1994)  Identification  of the  sex
of  human  preimplantation  embryos,  in  two  hours  using  an  improved  spreading
method  and  fluorescent  in  situ  hybridisation  using  directly  labelled  probes.  Hum
Reprod.  9,72  l-724.
10.  Harper,  J. C., Coonen,  E.,  Handyside,  A. H.,  Winston,  R.  M.  L.,  Hopman,  A.  H.  N.,
and  Delhanty,  J. D.  A.  (1995)  Mosatcism  of  autosomes  and  sex chromosomes  m
morphologically  normal,  monospermic,  preimplantation  human  embryos.  Prenat.
Dzagn.  15,41-49.
11.  Griffin,  D.  K.,  Wilton,  L.  J., Handyside,  A.  H.,  Winston,  R.  M.  L.,  and  Delhanty,
J. D.  A.  (1992)  Dual  fluorescent  in-situ  hybrtdisatton  for  the  simultaneous  detec-
tion  of X  and Y  chromosome  specific  probes  for  the  sexing  of  human  pretmplan-
tation  embryonic  nuclei.  Hum.  Genet.  89,  18-22.
12.  Tarkowski,  A.  K.  (1990)  An  air  drying  method  for  chromosome  preparations  from
mouse  eggs.  Cytogenetics  5,394-400.
13.  Coonen,  E.,  Dumoulm,  J.  C.  M.,  Ramaekers,  F.  C.  S.,  and  Hopman,  A.  H.  N.
(1994)  Optimal  preparation  of preimplantation  embryo  interphase  nuclei  by  fluo-
rescent  in  situ  hybridisation.  Hum  Reprod.  9,533-537
14.  Harper,  J. C.,  Robinson,  F., Duffy,  S., Griffin,  D.  K.,  Handyside,  A  .H.,  Delhanty,
J.  D.  A.,  and  Winston,  R.  M.  L.  (1994)  Detection  of  fertilisation  m  embryos  with
accelerated  cleavage  by  fluorescent  in  situ  hybridisation  (FISH).  Hum.  Reprod  9,
1733-1737.
15.  Coonen,  E.,  Harper,  J. C., Ramaekers,  F. C. S., Delhanty,  J. D.  A.,  Hopman,  A.  H.
N.,  Garaedts,  J.  P.  M  ,  and  Handyside,  A.  H  (1994)  Presence  of  chromosomal
mosaicism  in  abnormal  preimplantation  embryos  detected  by  fluorescent  in  situ
hybridisation.  Hum.  Genet.  54,609-6  15.
16.  Delhanty,  J. D.  A.  ( 1994) Preimplantation  diagnosis.  Prenat.  Diagn.  14,  12 17-l  227.
17.  Harper,  J. C.  and  Handyside,  A.  H.  (1994)  The  current  status of  preimplantation
diagnosis.  Curr.  Obstet.  Gynaecol.  4,  143-149.
18.  Griffin,  D.  K.,  Handyside,  A.  H.,  Harper,  J.  C., Wilton,  L.  J., Atkinson,  G.  H.  G.,
Soussts, I.,  et al.  (1994)  Clmical  experience  with  preimplantation  diagnosis  of  sex
by  dual  fluorescent  in-situ  hybridisation.  J.  Asszst. Reprod.  Genet.  11,  132-143.
19.  Willard,  H.  F.,  Smith,  K.  D.,  and  Sutherland,  J.  (1983)  Isolation  and  char-
acterisation  of  a  maJor  tandem  repeat  family  from  the  human  X  chromosome.
Nucleic  Acids  Res  19,3237-3241.
20.  Cooke,  H.  J.  and  Hindley,  J.  (1979)  Cloning  of  the  human  satellite  III  DNA:
different  components  are  on  different  chromosomes.  Nuclezc  Aczds  Res.  6,
s3  177-s3  179.
2 1.  Rigby,  P.  W.  J., Dieckmann,  M.,  Rhodes,  C.,  and  Berg,  P. (1977)  Labelling  deox-
yribonucleic  acid  to  high  specific  activity  in  vitro  by  nick  translation  with  DNA
polymerase  I.  J  Mel  Biol.  113,237-241.
268  Harper  and  Delhanty
22.  Harper,  J.  C  and  Delhanty,  J  D.  A.  (1995)  Spreading  single  human  blastomeres
and  multicolour  fluorescent  in  situ  hybridisation  (FISH).  Hum.  Reprod.  Update.
CD-ROM,  1, No  6, item  28,  video.
23.  Dauwerse,  J.  G.,  Wiegant,  J.,  Raap,  A.  K.,  Breuning,  M.  H.,  and  van  Ommen,
G.  J  B.  (1992)  Multiple  colors  by  fluorescence  in  situ  hybridisatlon  using  ratlo-
labellmg  DNA  probes  create  a  molecular  karyotype.  Hum.  Mel  Genet.  l(8),
593-598.
24.  Reid,  T.,  Baldml,  A.,  Rand,  T.,  and  Ward,  D.  C.  (1992)  Simultaneous  visualiza-
tion  of  seven different  DNA  probes  by  in  situ  hybridization  using  combmational
fluorescence  and  digital  imaging  microscopy.  Proc.  Nat1  Acad.  Sci  USA  89,
1388-1392.
25.  Hopman,  A.  H.  N.,  Ramaekers,  F. C  S., Raap,  A  K.,  Beck,  J. L.  M.,  Devllee,  P  ,
Ploeg  van der,  M.,  and Vooljis,  G  P.  (1988)  In  sztu hybndisation  as a tool  to  study
numerlcal  chromosome  aberrations  m  sohd  bladder  tumours.  Histochemutry  89,
307-3  16.
26.  Delhanty,  J.  D.  A.  and  Handyside,  A.  H.  (1995)  The  origin  of  genetlc  defects  m
man  and  their  detection  m  the  preimplantatlon  embryo.  Hum  Reprod  Update  1,
201-215
Microtiter  Array  Diagonal  Gel  Electrophoresis
(MADGE)  for  Population  Scale  Genotype  Analyses
Ian  N.  M.  Day,  Manjeet  Bolla,  Lema  Haddad,  Sandra  O’Dell,
end  Steve  E. Humphries
1. Introduction
Human  populations  display  enormous genetic variation,  evident  both  at the
phenotypic  level  and  at the DNA  level.  These variations  include  both  single
“mutations”  causative of profound  disease and variations  that contribute  to sus-
ceptibility  to particular  “polygenic”  diseases. To  date, genetic diagnostics have
been applied  mainly  in the context of  isolated diagnoses for  individuals  or fami-
lies  for  single  gene  disorders.  Population  screening, for  example,  for  carrier
status for  recessive  disorders  such as cystic  fibrosis,  has not  yet  advanced
beyond  feasibility  studies. Such studies require  satisfaction  of  the criteria  of
Wilson  and  Jungner  (I),  in  that there  must be  the knowledge  and resources
(counseling,  treatment,  and so on)  to confer  benefit,  and that there must be a
viable  and  affordable  means  to  undertake  screening.  For  research  into  the
genetic epidemiology  of common disorders, such as cardiovascular  disease and
cancers, some of  the feasibility  shortfalls  correspond with  those for  population
screening  for  single  gene mutations.  First, tests for  genetic  variation  are still
very  expensive,  both in staff  time and in reagents. Second, the combination  of
informed  consent, collection  of  appropriate  clinical  detail,  and  collection  of
samples is expensive  on a population  scale. For  these reasons, many associa-
tions, such as those between apolipoprotein  E (APOE)  genotype, hypercholes-
terolaemia  and premature  vascular  disease (2), APOE  genotype and late-onset
Alzheimer  disease (3),  and angiotensinogen-converting  enzyme (ACE)  geno-
type and cardiovascular  disease (4), have mainly  been researched on groups of
a few  hundred  individuals.  However,  larger  studies of  more  genetic  markers
From  Methods  in  Molecular  Medicine  Molecular  Diagnoses  of  Genet/c  Diseases
Edited  by  R  Elles  Humana  Press  Inc  , Totowa,  NJ
269
270  Day  et al.
would  demonstrate more convincing  confidence  intervals,  with  respect to can-
didate genes tested, and to look at the effects of multiple  genes in combination.
By contrast, traditional  epidemiological  studies of biochemical  phenotype  have
involved  tens or hundreds of  thousands of  individuals  (5) and the biochemical
risk  factors identified  have  led on to functional  studies and therapeutic  strate-
gies. By  analogy,  it  should be possible eventually  to achieve  similar  goals in
genetic  epidemiology.  Not  all  gene variations  can be  identified  from  a bio-
chemical  phenotype,  for  example  where  the biochemical  phenotype  is a con-
tinuous trait,  where  the biochemical  assays are more  difficult  than the genetic
assays, or where the biochemical  phenotype varies so much with  time that there
is  essentially  no  intermediate  trait  that  can be  measured  usefully.  In  these
instances at a minimum,  and in  all  epidemiological  studies at a maximum,  it
would  be valuable  to examine genotypic  markers and variations  m genes that
could  conceivably  be involved  in the intermediate  traits or overt  climcal  phe-
notypes under  study. These research arguments pertain  equally  to population
screening for  single  gene disorders.
One goal in molecular  genetics at present is to establish screening programs
for  whole  populations.  For  example,  for  cystic fibrosis,  knowledge  of  carrier
status would  be helpful  to identify  at-risk couples. Unfortunately,  this demands
testing  for  one of  a large  number  of  point  mutations  known  to  cause cystic
fibrosis  (6).  Invariably,  the  first  step is  polymerase  chain  reaction  (PCR)
amplification  of  the regions  of  interest; the second step often  is either  a cap-
ture-binding  assay (in  which  labeled  allele-specific  oligonucleotides  [ASOs]
are used in high  stringency binding  assays to test for  the presence of  particular
mutations);  or  an electrophoretic  assay (with  the  PCR  arranged  to  generate
fragments  of  a particular  size according  to presence/absence of  a particular
mutation.  Capture-binding  assays are similar  in principle  to two  site immuno-
metric  assays (7),  but  instead use a capturable  group  such as biotin  incorpo-
rated into  one PCR primer  and a detectable label  such as a fluorescent  group
attached to the ASO. (The  configuration  can be reversed  and some liquid  phase
automation  is  possible.)  Analytical  electrophoresis  is  widely  recognized  as
being  manual and time-consuming  and therefore  also expensive. It would  seem
obvious,  therefore,  to  aim  to avoid  electrophoresis  for  all  mutation  analysis.
Unfortunately,  many  variations  and  mutations  involve  changes in  length  of
sequence rather  than composition  of  sequence. This  is true for  the many small
deletions and insertions that occur (a),  in variable  number  dmucleotide  (9) and
tetranuceotide  repeats that are very  useful  for  linkage  analysis, and in the trip-
let  repeat  slippage  disorders.  Among  the  latter,  population  screening  for
premutation  expansion of repeat number  is being  considered as a possibility  to
identify  carrier  mothers  for  risk of  fragile  X  mutation  (20).  The determination
of  size of  PCR products  is almost unavoidable  in these situations.
Population  Scale  Genotype Analyses  271
There  are several  categories of  analysis for  which  it would  be advantageous
to have  systems for  high  throughput  electrophoresis, but in which  the eventual
pattern  recognition  commonly  will  hinge  on mobility  differences  greater than
5%. These include  PCR checking gels, sizing of  PCR products, and analysis of
restriction  digests of  PCR products.  In  addition,  digests of  PCR  products  for
direct  haplotyping  (haplotyping  of  an  individual  without  recourse  to  family
studies), would  often  be useful.  In  this  case two  markers  on the  same strand
must be analyzed in conjunction.  This is impossible using ASOs, which  do not
allow  determination  of  the phase between markers.
Many  procedures  in  research  and  diagnostic  laboratories  are  undertaken
using 96-well  microtiter  plates as devised by Dynatech 30 yr ago. The rigid  8 x  12
arrays  (rows  A-H  and  columns  1-12,  with  9-mm  center-to-center  spacing
between adjacent wells),  have  been established for  a wide  range of  disposable
plastic  plates  that  may  be  suitable  for  biological  cultures,  as a solid-phase
coated plastic, for reading  in spectrophotometric and fluorescence plate readers,
or  for  PCR.  For  example,  we  have  devised  a very  rapid  DNA  preparation
method  from  blood,  suitable  for  many  PCRs, which  manipulates  the samples
entirely  in  the 96-well  array  in  which  they  are originally  placed  (II).  Subse-
quent PCRs are set up from  pre-PCR  dried  DNA  template 96-well  replicas that
are stored  at room  temperature  and  can be posted to  other  laboratories  (12).
The  configuration  offers  several  advantages:
1.  Information  storage is on a “master grid”  and there is no need for any labeling of
tubes and storage of tubes in racks.
2.  A wide range of purpose-made manual and automated multichannel pipetmg and
other devices are available for  subsequent replications or other manipulations.
For example, it  becomes very  easy to  set up several different  PCRs from  the
same set of samples.
3.  The compact nature of  the arrays is convenient for  storage in large numbers in
standard laboratories.
History  and the test of  time have  established the 96-well  plate as an indus-
try  standard  for  the  foreseeable  future.  However,  electrophoresis  still  is
inconvenient  because slots for  loading  gels  traditionally  are  placed  closely
adjacent  in  row(s)  for  ready  alignment  of  bands. These are not  conveniently
compatible with  96-well  arrays (i.e., sample redistribution  and recoding becomes
necessary, and most arrangements  preclude  the use of  multichannel  devices).
In  addition,  polyacrylamide  is  a better  resolving  matrix  for  PCR  products
and  digests  of  PCR  products  than  agarose.  However,  acrylamide  does not
polymerize  in  the presence of  air,  so most laboratories  prepare  polyacryla-
mide  gels between  two  glass plates, with  a “well-former”  inserted at one end.
This  has three  consequences:
272  Day  et al.
1.  Inconvenient setup;
2  Inability  to “access” the whole area of the gel in the way that is commonly used
to prepare multiple rows of wells m horizontal agarose gels, and
3.  An obligatton to load the gel wtth the glass plates vertical so that the samples do
not leak out of the wells.
In  this  chapter,  we  describe  a very  simple  device  and method  to prepare
and manipulate horizontal polyacrylamide gels (13,14). In addition, the open-faced
horizontal  arrangement  enables loading  of  arrays of  wells.  Therefore,  we have
designed a device which preserves the exact configuration  of the 8 x  12 array, and
enables electrophoresis along a 7 1.6” diagonal line-of-sight between wells (MADGE,
microtiter  array diagonal gel electrophoresrs), usmg either acrylamrde or agarose.
This  eliminates almost all  of  the staff  time taken in  set up,  loading,  and record
keeping and offers  high resolution for  genotyping pattern recognition. The  nature
and size of  the gels allows direct stacking of  gels in one tank, so that a tank used
typically to analyze 30-60 samples can be used readily to analyze 1000-2000 samples
with no increase in operator time. This system opens a wide variety of possibilities
for  diagnostic and research genotyping centered around existing microtiter  plate
technology, and is in essence an electrophoretic counterpart to the microtiter plate.
Our interests have been in the development of  tools suitable for  research into the
genetic epidemiology  of cardiovascular disease on a population scale, but the util-
ity  for  genotyping  markers  in the diagnostic  context  should  be apparent.
2.  Materials
The  approach  described  here  reflects  the  initial  development  of  the  tech-
nique  and will  be  superceded by the  commercial  availability  of  ready  made
gels, gel formers,  and a range  of  anctllary  apparatus.
2.1.  Preparation  of  Prototype  Devices  for  Making  Horizontal
Polyacrylamide  Gels  (H-PAGE)  and  MADGE
Perspex blocks, 200  x  100 x 8 mm were machined away at one face using a
computer  controlled  CNC  machining  center (Mazak, Worcester, UK)  to leave
either  conventtonal  rows  of  teeth (for  H-PAGE)  or  teeth in  a mrcrotiter  array
format,  I.e., 8 columns,  12 rows, 9-mm  center to center between adjacent teeth.
For MADGE  format,  the teeth were cut at an angle of 7 1.6’ to the row  axis of the
array but perpendicular  to the long edge of  the perspex.
Various teeth were tried and 2 x 2 x 2 mm was selected as the “standard”  size.
This  type of  tooth enables loading  of  5-7  microliter  samples, the wells  are open
enough to take account of the imprecision  of alignment  of  standard tips on stan-
dard multichannel  devices, and the gel is of  a convenient thickness. A plan view
of  the resultant  gel is shown  in  Fig.  1. Approaches to making  gel  formers  are
described in Note  1. Other possible formats of gel are considered in Notes 4 and
5. Precast gels are available  commercially  (see Note  8).
Population  Scale  Genotype Analyses
cathode
Al
q
D r-l
HI2
anode
273
Fig.  1.  Plan and gel former  (two dimensional “comb”)  for  MADGE.  Schematic
plan view  of the wells of a MADGE  gel in which the electrophoretic line-of-sight  1s
diagonally  across a 2 x 4 rectangle of wells. The distance between adjacent wells
is 9 mm, as standard for  96-well  microtiter plates. In the plan shown, the wells are
2 mm square, the angle between the direction of electrophoresis and the 12-well rows
of the array is 71.6”, and the track length per well  is 26.5 mm. Relative to standard
designation on 96-well plates (rows A-H,  columns l-12),  the orientation places well
Al  nearest the cathode.
2.2.  Reagents
Gamma-methacryloxypropyltrimethoxysilane  is  available  from  Sigma
(Poole,  Dorset,  UK),  Hydrolink  from  J. T.  Baker  (Swallowfield,  Nr  Reading,
Berkshire,  UK),  hydrophilic  electrophoresis  film  from  Sigma, and Plasticard
from  Slater’s  Plastikard (Matlock  Bath, Derbyshire,  UK).
274  Day et al.
3.  Methods
3.1. Preparing  an  H-PAGE  or  Polyacrylamide  MADGE  Gel
1.  Tape  around  the  edges of  the  H-PAGE  or  MADGE  comb,  leaving  approx  3 mm
of tape jutting  up  on  the stde where the  (2 mm)  teeth  are. Sequencing  gel  (Scotch
3MM  electrical)  tape  works  well.  The  tape  does not  need  removal  after polymer-
ization  and  rarely  needs to  be changed  at  all.
2.  Lay  the MADGE  comb  flat  on paper  towel  or  m  a tray,  wtth  the  teeth  and jutting
edge  of the  tape  facing  upward.
3.  Silamze  a suitably  sized  piece  (e.g.,  160  x  100  x  2 mm)  of  standard  soda  lime
float  glass  (new  or  reused,  see  Note  2)  with  0.5%  gamma-methacryloxy-
propyltrimethoxysilane,  0.5%  glacial  acetic  acid,  ethanol  (v/v).
4.  Prepare  a volume  of  acrylamide  gel  mix  (a few milliliters  more  than  necessary
to  fill  the  volume  bounded  by  the  tape  and  the  glass  plate  that  will  be  pressed
directly  onto  the  ends  of  the  teeth)  Polymerization  is  by  TEMED  and  ammo-
nium  persulfate  as for  any acrylamide  gel  (8,9).  A  volume  of  150 uL  of TEMED
and  150  pL  of  10%  ammonium  persulphate  are used  for  50  mL  of  gel  mix  (see
Note  6).
5.  Pour  the  gel  mix  onto  the  comb,  then  lay  the  glass  plate,  silanized  side  down,
onto  the  comb.  The  glass  plate  is  rested  in  the  gel  at  one  end,  then  the  other  end
smoothly  lowered  until  the  gel/au  front  is  driven  out  and  the  plate  contacts  all
the  teeth  A  250-g  weight  LS then  placed  on  the  plate  to  maintain  pressure
between  plate  and  teeth.  Note  that  it  is  crittcal  not  to  release  pressure  from  the
glass  plate  once  it  is  in  contact  with  the  teeth,  otherwise  some  an  bubbles  will
seep m  under  the  glass.
6.  Once  polymerized,  the  glass  plate  with  gel  attached  is  prized  off  the  comb  by
inserting  a broad  flat  spatula  at one end  and  rotating  firmly  until  the  glass  can be
grasped  and  lifted.  Robustness  of  gel  slots  is considered  in  Note  6.
Gels  on  glass  can be  stored  in  piles  of  5-10  in  buffer  at 4°C  for  many  weeks
(see Note  7).
3. I. 1. Variation  1. Hydrolink
Gels  were  set  up  as for  acrylamide.
3.1.2.  Variation  II.  Agarose
Hydrophilic  electrophoresis  film  can  be  used  to  form  wells  whose  bases  are
formed  by  the  plastic  support,  using  the  setup  principle  described  for  acryl-
amide.  A  rigid  surface  such  as a glass  plate  should  be  placed  above  the  electro-
phoresis  film  to  ensure  even  distribution  of  a  250-g  weight  used  to  press  the
film  firmly  against  the  teeth.  It  is  also  possible  to  prepare  polyacrylamide
MADGE  gels  on  such  a plastic,  rather  than  glass  support,  but  the  gel  does  not
adhere  as  strongly  as  it  does  to  glass  (see  Note  3)  and  also  must  be  removed
from  the  plastic  prior  to  viewing  on  a transilluminator.
Population  Scale  Genotype  Analyses  275
3.2.  Loading  and  Electrophoresis  of  Samples
on  H-PAGE  and  MADGE  Gels
1.  Immerse  the  gel  horizontally  in  the  electrophoresis  tank.  Polyacrylamide  or
Hydrolink  gels  are  anchored  on  their  glass  plate  and  the  bases of  the  wells  are
formed  by  the  glass.
2.  Prepare  samples  for  loading.  They  will  probably  have  come  from  a microtiter
plate  PCR,  or  some  subsequent  or  other  procedure  undertaken  in  a  microtiter
plate.  For  2-mm  cubic  wells,  5 PL  is an appropriate  volume  to  load.
3,  Load  using  a multichannel  pipet,  preferably  one designed  for pipeting  in  the  l-l  0 pL
range,  so that  thumb  travel  is  long  and  smooth  during  loading.  It  is  easy to  feel
the  glass  or  plastic  base  of  each  well  when  the  pipet  is  correctly  positioned.  A
reflective  white  surface such as plasticard  under  the  gel  and  a light  source (ideally
parallel  hght  from  a parabolic  reflector  or  a light  placed  approx  1 m  above  the
gel)  are very  helpful  to  facilitate  visualization  of wells.
4.  Electrophorese  at  l-10  V/cm.  As  for  any  other  type  of  gel,  if  power  supplied
exceeds  heat  drssipation,  then  temperature  and  hence  conductivity  inequalities
across the gel  will  lead  to “smiling.”  Indeed,  the general  properties  of these gels  are
no  different  from  standard  gels  for  which  detailed  reviews  are  available  (IS).
Optionally,  a glass plate  can be laid  on  top  of the  gel  to ensure symmetry  of condi-
tions  between  the  top  and  the  bottom  of the  gel.  An  important  corollary  to  this  is
that  a  set of  MADGE  gels  on  glass plates  can  be  stacked  directly  on  top  of  each
other  in  one  tank.  Thus,  the  same tanks  previously  used to  electrophorese  32  sam-
ples on a small  agarose gel on a special tray can be used to electrophorese  480 samples
on  five  horizontal  acrylamide  MADGE  gels  anchored  on 2-mm  float  glass plates
3.3.  DNA  Detection  on  MADGE  Gels:  Different  Methods
1.  Incorporate  ethidium  bromide  in  the  gel.  For  agarose,  remove  carefully  from  the
plastic  support  and view  on a transilluminator  as for  traditional  agarose  gels.  For
polyacrylamide  gels  anchored  on  glass,  little  UV  would  pass through  the  glass;
therefore,  place  the  gel  side  down  on  the  transilluminator  and  view  the  orange
fluorescence  through  the  glass.
2.  Stain  postelectrophoresis  with  ethidium  bromide.  For  a 2-mm  thick  polyacryla-
mide  gel  anchored  on glass,  this  takes  approx  30  min.
3.  Silver  staining  of polyacrylamide  gels.  For 2-mm  thick  gels  the 30-60  min  period
for  each  step  for  gel  on  glass  may  be  inconvenient.  However,  the  gel  can  be
detached  from  the  plate  (see step 4).
4.  Gels  can be  detached  from  the  plate  if  they  are  not  to  be  reused.  The  gel  can  be
cut  off  the  glass  by pushing  a 200  x  10 x 0.1 -mm  strip  of  overhead  transparency
film,  a long  straight-edged  razor  blade,  or a cheesewire  on  a handle  between  gel
and  glass.  If  the  thm  glass  plates  are  to  be  reused,  they  can  be  cleaned  using
household  liquid  detergent,  ethanol,  and water  (Acetone  or  lM  sodium  hydrox-
ide  are other  well  known  releasing/cleaning  agents for  silanized  plates.  However,
tanks  of  either  are  inconvenient  in  the  laboratory  and  the  former  can  introduce
background  fluorescence,  see Note  2.)
276  Day  et al.
5.  Detached  gels  can  be dried  down  after  silver  staining  or  for  autoradiography.
6  Detached  polyacrylanude  gels  would  be  amenable  to  other  procedures,  such  as
electroblotting,  and  so on.
3.4.  Record  Keeping
For  MADGE  gels,  the  most  cathodal  well  corresponds  in  our  arrangement
with  well  Al  of  a  microtiter  plate.  For  photography,  a  transparency  of  a
microtrter  grid  is  overlaid  on  the  gel  or  glass  plate,  with  its  letters  and  numbers
suitably  oriented  to  identify  sample  wells  or  bands  of  interest,  and  with  the
lines  of  the  grid  arranged  to  assist  interpretation  of  patterns.
3.5.  Examples
A  range  of  checking  gels,  resolving  gels  for  PCRs  informative  from  the  size
of  products,  and  resolving  gels  of  post-PCR  restriction  digests  are  shown  in
Figs.  2  and  3.  The  specific  genotypic  markers  are explained  in  the  figure  legends.
4. Notes
1.  Three  possible  ways to  obtam  the  gel  formers  described  are  first  to  glue  suitable
slot  formers  to a smooth-faced  piece  of plastic  (difficult  in  our experience);  second
to  machine  away  from  one  face of  a prece  of  plastic  to  leave  slot  formers,  using
specialist  computerized  cutters of limited  availability  (expensive  m  our experience);
or thn-d,  to  mold  plastics  (a commercral  process).  The  latter  eventually  should  be
the  simplest  and  cheapest  option  for  those  requiring  such  apparatus  and  has  the
advantage  that  associated  items  such  as suitable  transparent  photographic  grids,
glass plates,  and  other  reagents  and  equipment  will  be  simultaneously  available.
However,  “unique”  machining  runs will  be most  appropnate  for users with  special
needs,  for  example  slots greater  or  less than  2 mm  in  length  between  cathode  and
anode,  gels  of different  thickness,  different  diagonal  angles,  and  so on.
2.  We  have been  reusing  our  glass plates.  However,  if  the  glass were to be treated  as
a disposable  and the  gel  used once only,  the cost of the  glass per  sample  would  be
approx  0.0032  $US;  for  compartson,  we esttmate  the  cost  of one  (10  pL)  sample
PCR  to  be  0.026  $US.  The  simplest  way to  clean  the  glass  is to  “shave”  the  gel
off  the  plate  with  a long  strarght-edged  razor  blade,  then  to  clean  the  plate  with
Fairy  Lrqurd  Excel  (Proctor  and Gamble  Ltd,  Newcastle,  UK),  ethanol  then  water.
Several  reagents,  either  singly  or  in  combination  with  each  other  and  ethldium
bromide,  introduce  background  fluorescence  that  can  be problematic:  Traces  of
acetone  (which  is  well  known  to  remove  silane)  cause  smeared  and  speckled
orange  fluorescence;  Jeybrite  (Jeyes,  Bucks,  UK)  liquid  cleaner  causes heavily
smeared  orange  fluorescence;  and  excess residual  nonvolatile  component  of  the
silanizing  mix  also  induces  a heavy  background  fluorescence  with  ethrdium  bro-
mide.  The  latter  background  problem  never  occurs  with  the  first  use  of  glass
plates  and  presumably  reflects  combination  with  some  trace  from  cleaning  pro-
cedures;  however,  wiping  of the  (dried)  silanized  plate  with  tissue  and water pre-
vents  this  cause of  background.
Population  Scale  Genotype  Analyses  277
Fig.  2.  Examples  of  MADGE  gels  for  checking  of  PCR  products.  (A)  7.5%  poly-
acrylamide/lX  TBE  checking  gel  for  presence  of  PCR  products  from  a 96-well  plate
PCR.  The  bands  in  the  centers  of  the  grid  boxes  represent  the  PCR  product.  Their
wells  of origin  are (for  the wells  that  contain  an air  bubble)  visible  within  their  respec-
tive  grid  boxes.  In  some  cases high-mol-wt  DNA,  representing  an  excess of genomic
DNA  template  put  into  the  PCR  reaction,  is visible  at the  leading  edges of  some  wells.
Columns  7,  8,  and  9 contain  no  PCR  product,  but  the  unincorporated  oligonucleotide
is recognizable  as a smear  of high  mobility.  Primers  of higher  mobility  are visible.  (B)
7.5%  polyacrylamide/lX  TBE  checking  gel  of  a duplex  PCR.  The  174  and  202  bp
products  are clearly  resolved  after  a migration  of less than  1 cm.  The  leading  edges of
their  wells  of  origin  are  in  some  tracks  marked  by  genomic  DNA  PCR  template  that
cannot  migrate  a significant  distance  into  the  gel.
It  should  be  noted  that  the  mirror  images  of  the  array  codes  are  intentional  and
used  in  the  laboratory  as part  of  a  mnemonic  aid  system  when  gels  are  viewed
“upside-down”  relative  to  orientation  during  loading  and  electrophoresis:  This
ensures  that  only  one  set of  transparency  grids  are  in  circulation  in  the  laboratory,
which  must  themselves  be  inverted  if  the  gel  is  inverted.  If  there  were  two  orienta-
tions  of  transparency  grid  available  in  the  laboratory,  there  would  be  high  potential
for  use  of the  inappropriate  grid  (e.g.,  the  one  for  a detached  gel  in  usual  orientation
rather  than  gel  anchored  on  glass  and  viewed  inverted)  and  consequent  misidenti-
fication  of  all  positions  in  the  array.
278  Day  et al.
Fig.  3.  Examples  of MADGE  gels  for  genotyping  either  by  resolution  of size prod-
ucts  of  an  informative  PCR  or  resolution  of  fragments  from  a post-PCR  restriction
enzyme  digestion.  (A)  PCR  products  from  a three  oligonucleotide  PCR  designed  to
distinguish  an  Alu  insertion/deletion  polymorphism  in  intron  16  of  the  human  ACE
gene  (4).  Homozygotes  and  heterozygotes  are  distinguishable  on  the  size  of  the  PCR
products,  84 and  65 bp.  Heteroduplex  and/or  long  PCR  product  are also  observed  near
the wells  in  samples  generating  the  smaller  (65  bp)  fragment,  which  is arranged  (para-
doxically)  to  represent  thepresence  of the AZu insertion  sequence. Tracks  D2,  D3,  and
D4,  respectively,  represent  insertion  homozygote,  heterozygote,  and deletion  homozy-
gote.  (B)  PCR  of exon  13 of the  low  density  lipoprotein  receptor  gene was followed  by
drying  of PCR  product  (a simple  means  of DNA  concentration  for  large  scale studies),
then  AvuII  digestion  for  typing  of  a  restriction  fragment  length  polymorphism.  For
example,  tracks  6A,  6C,  and  6E  represent  a homozygote  lacking  the  restriction  site,  a
homozygote  for  the  presence  of  the  site,  and  a  heterozygote.  Although  drying  is  a
convenient  means  of  concentrating  arrays  of  DNA  so that  smaller  bands  of  low  yield
Population  Scale  Genotype Analyses  279
3.  Hydrophilic  GelBond  plastic  can  be  used  instead  of  glass  for  polyacrylamide  as
well  as agarose MADGE,  but  H-PAGE  is more  difficult  because the  closely  spaced
teeth  do not  permit  much  adherence  of gel  to plastic  in  the  critical  region  around
the  slots.  The  hydrophilic  nature  of  the  adherence  also  means  that  MADGEs  on
GelBond  (unlike  polyacrylamide  MADGEs  on glass) cannot  be stored  submerged
in  TBE  in  the refrigerator  long-term,  because  the gel  peels  off  the  backing.
4.  Other  formats  of MADGE  may  be useful  for  different  applications.  For  example,
if  it  is  necessary  to  visualize  faint  bands  of  small  fragments  from  digests,  then
slots  that  are  longer  (e.g.,  4 mm)  between  cathode  and  anode  would  be  helpful
with  less than  a  10%  compromrse  of the  total  track  length  possible.  If  gels  are to
be  dried,  for  example  for  autoradiography,  then  a thinner  gel  (e.g.,  1 mm  rather
than  2  mm)  will  give  sharper  resolution  and will  enable  the  drying  of  high  per-
centage  (e.g.,  20%)  polyacrylamide  gels.
5.  As  an  alternative  to  longer  slots,  more  sample  can be  loaded  by  concentration/
drying  prior  to  loading,  if  faint  bands  are to  be visualized.  When  there  is  signifi-
cant  salt  in  the  sample,  its  concentration  may  cause a salt  gradient  from  bottom
(salty  sample)  to  top  (TBE  buffer)  of the well.  This  will  cause tilted  bands,  DNA
at  the  base of  the  wells  migrating  more  slowly:  Prior  flushing  of  slots  with  high
salt buffer  should  minimize  this  effect.  However,  for PCR  amplifications  tending
toward  low  yield,  we prefer  to  increase  the  concentratron  of  Tag  polymeras+
economy  is  achieved  by mamtaining  the  total  PCR  volume  at the  mmimum  nec-
essary,  for  example  10 pL.
6.  We  prefer  our  gels  to  set rapidly  (2-5  min)  so that  the  device  can immedtately  be
reused  to  prepare  another  gel.  The  use  of  higher  concentrations  of  ammonium
persulfate  and TEMED,  as listed,  expedites  thts  and does not  cause any problems.
Fig.  3.  (continued)  PCR  products  can be visualized  on MADGE  (where,  unlike  verti-
cal  gels,  the  slots  cannot  be “overloaded”),  the  process tends  to  cause some  smearing.
For  high  throughput  applications,  it  is preferable  to  avoid  secondary  procedures  post-
PCR  if  possible,  and  to  optimize  PCR  conditions  for high  yield.  More  sensitive  detec-
tion  systems  will  also  be  advantageous.  (C)  PCR  of  the  APOE  gene  (2,3)  followed
directly  by  restriction  digestion  (addition  of  a master  mix  of  restriction  enzyme/salt
buffer  to  PCR  product)  The  digest  simultaneously  analyzes  two  restriction  sites  in
one  PCR  product,  distinguishing  three  alleles  (E2/3/4)  and  hence  six  genotypes.  The
various  patterns  observed  represent  different  combinations  of fragments  of 90  (present
for  E3  and  E2),  84  (present  for  E2  only),  72  (present  for  E4  only),  60  (constant),  48
(present  for  E3  and  E4),  36  (present  for  E3  and  E4)  bp,  and  some  very  small  frag-
ments  not  visible.  The  90-bp  fragment  has  been  electrophoresed  so that  it  is  level
with  the  anodal  edge  of  the  well  of  an  adjacent  track  and  it  can  be  noted  that  the
90/84  doublets  are  readily  recognized  in  E2/E3  and  E2/E2  samples  as  a  closely
spaced? but  clearly  resolved  doublet.  Thus  resolution  on  MADGE  of  6.7%  relative
mobility  is  readily  possible-ultimately,  the  resolution  posstble  with  MADGE  will
be  determined  by  the  gel  thickness,  the  imaging  system  used,  and  the  quality  of  the
gel  matrrx,  so considerable  improvements  will  be  possible.
280  Day  et  al.
7.  Polyacrylamide  gels  on  glass anchors  can readily  be  stored  piled  on  top  of each
other  in  electrophoresis  buffer  in  the  refrigerator.  The  convenience  of  storage,
robustness,  and  reuse has one drawback:  Ethidmm  bromide  incorporated  mto  the
gel  decays  in  TBE  buffer.  Gels  stored  for  a  few  weeks  are  best  stained  post-
electrophoresis,  or  soaked  in  intercalating  dye  (10  min  on  a shaker)  prior  to  elec-
trophoresis.  The  bands  m  2-mm  gels  appear  very  fine  and  sharp  compared  with
agarose  if  ethidium  bromide  is  mcorporated  m  the  gel.  The  sharpness  of  these
bands  means  that  even the hmited  diffusion  occurrmg  during  poststaining  gives  a
surprising  thickening  of the band  and  often  also  substantial  apparent  gain  in  quan-
tity  of  fluorescence  present  in  the band.
8.  Ready-made  gels  are now  available  from  genetlX,  (Wimborne,  Dorset,  UK)  and
extend  to  pattern  recognition  electrophoretic  analyses  all  of  the  conveniences
associated  with  the  use of  disposable  microtiter  plates.  Disposable  ready-made
gels  may  turn  out  to  be  the  most  convement  and  popular  option  for  many
laboratories,  in  view  of  the  safety  ObJective  to  avoid  handling  unpolymerized
acrylamide,  coupled  with  time  saving.  This  “use-and-dispose”  strategy  is  com-
mon  m  laboratories  using  microtiter  plates  to  achieve  high  throughput  and  save
staff  time,  usually  the  most  expensive  component  of  progress  in  the  laboratory.
Acknowledgments
I. N. M. Day, L. Haddad,  and S. E. Humphries  have  been supported, respec-
tively,  by Intermediate  Fellowship,  PhD studentship and Chair  Award  from  the
British  Heart  Foundation.  I.  N.  M.  Day  is currently  the recipient  of  a Lister
Institute  Research Fellowship.  Support for  M. Bolla  was kindly  provided  by L.
G.  Fine  and  S. O’Dell  was  supported,  respectively,  by  an  award  to  S. E.
Humphries  from  Merck  Sharpe and Dohme  MEDPED  program  and a ROPA
award  from  the MRC  to I. N.  M.  Day.  The  staff  of  genetiX  (Dorset,  UK)  are
thanked  for  assistance and loan of  equipment.
References
1.  Wilson,  J. M.  G.  and  Jungner,  G.  (1968)  Principles  and  Practzce  of Screening  for
Disease  (Public  Health  Paper  No.  34),  WHO,  Geneva.
2.  Davignon,  J.,  Gregg,  R.  E.,  and  Sing,  C.  F.  (1988)  Apolipoprotein  E  polymor-
phism  and  atherosclerosis.  Arterioscleroszs  8,  l-2  1.
3.  Corder,  E. H.,  Saunders, A. M.,  Strntmatter,  W.  J., Schmechel,  D. E.,  Gaskell,  P.  C.,
Small,  G.  W.,  et al.  (1993)  Gene  dose of apolipoprotein  E type  4 allele  and  the risk
of  Alzheimer’s  disease  in  late  onset  families.  Science  261,  921-923.
4.  Cambien,  F.,  Poirier,  O.,  Lecerf,  L.,  Evans,  A.,  Cambou,  J. P.,  Arvelier,  D.,  et  al.
(1992) Deletion polymorphism in the gene for  angiotensin-converting enzyme is
a potent  risk  factor  for  myocardial  infarction.  Nature  359,641-644.
5.  Kannel,  W.  B., Neaton,  J. D., Wentworth,  D., Thomas,  H.  E., Stamler,  J., Hulley,  S. B.,
et al.  (1986)  Overall  and  coronary  heart  disease mortality  rates m  relation  to  major
risk  factors  in  325,348  men  screened for  the  MRFIT.  Am.  Heart  J.  112,825–836.
Population  Scale  Genotype Analyses  281
6.  Gille,  C.,  Grade,  K.,  and  Coutelle,  C.  (1991)  A  poolmg  strategy  for heterozygote
screening  of  the  AF508  cysttc  fibrosis  mutation.  Hum.  Genet.  86,289-29  1.
7.  Hales,  C.  N.  and  Woodhead,  J.  S. (1980)  Labelled  antibodies  and  their  use in  the
immunoradiometric  assay  Meth.  Enzymol.  70,334-355.
8.  Cooper,  D.  N.  and  Krawczak,  M.  (1991)  Mechanisms  of  insertional  mutagenesis
in  human  genes causmg  genetlc  dtsease. Hum.  Genet.  87,409-415.
9.  Weissenbach,  J.,  Gyapay,  G.,  Dib,  C.,  Vignal,  A.,  Morissette,  J.,  Millasseau,  P.,
et  al.  (1992)  A  second-generation  linkage  map  of  the  human  genome  Nature
359,794-80  1.
10.  Snow,  K.,  Doud,  L  K.,  Hagerman,  R.,  Pergolizzi,  R.  G.,  Erster,  S.  H.,  and
Thibodeau,  S. N.  (1993)  Analysis  of a CGG  sequence  at the  FMR-  1 locus  m  frag-
ile  X  families  and  in  the  general  population.  Am.  J.  Hum.  Genet.  53,  1217-1228.
11,  O’Dell,  S.,  Humphries,  S.  E.,  and  Day,  I.  N.  M.  (1995)  A  rapid  approach  to
genotyping  of the  insertion/deletion  polymorphism  in  intron  16 of the  angiotensin
converting  enzyme  gene  using  simplified  DNA  preparation  and  microtitre  array
diagonal  gel  electrophoresis.  Br.  Heart  J.  73,368-37  1,
12.  Day,  I.  N.  M.,  Whittall,  R.,  Gudnason,  V.,  and  Humphnes,  S.  E.  (1995)  Dried
template  DNA,  dried  PCR  oligonucleotides  and  mailmg  in  96-well  plates:  LDL
receptor  gene mutation  screening.  BioTechniques  l&981-984.
13.  Day,  I.  N.  M.  and Humphries,  S. E. (1994)  Electrophoresis  for genotypmg:  devices
for  high  throughput  using  horizontal  acrylamide  gels  (H-PAGE)  and  microtitre
array  diagonal  gel  electrophoresis  (MADGE).  Nature  (product  review)  36,37.
14.  Day,  I.  N.  M.  and  Humphries,  S.  E.  (1994)  Electrophoresis  for  genotyping:
microtitre  array  diagonal  gel  electrophoresis  (MADGE)  on horizontal  polyacryla-
mide  (H-PAGE)  gels,  Hydrolink  or  agarose. Anal.  Blochem.  222,389-395.
15.  Rickwood,  D.  and  Hames,  B.  D.  (eds.)  (1982)  Gel  Electrophoresis  of  Nucleic
Acids:  A Practical  Approach  IRL  Press, Oxford,  UK.

17
Pulsed  Field  Gel  Electrophoresis
for  Detection  of  Gene  Rearrangements
in  Duchenne  Muscular  Dystrophy
David  J.  Cockburn  and  Anneke  Seller
1.  Introduction
In  diseases with  a high  new  mutation  rate,  such as Duchenne  and  Becker
muscular  dystrophy  (DMD,  BMD),  linkage  analysis  often  produces  highly
unsatisfactory  results for  carrier  diagnosis  compared  to  methods that rely  on
the direct  detection  of  the mutation.  The  size of  the dystrophin  gene  and the
nature of mutations  at this locus that give  rise to DMD/BMD  make pulsed field
gel electrophoresis  (PFGE)  an appropriate  and powerful  technique  for  detec-
tion  of  mutations  and hence accurate carrier  diagnosis in  these diseases.
The  basis of  PFGE  analysis  is to  digest  high-mol-wt  DNA  using  a rare-
cutting  restriction  enzyme, such as SiI,  and to analyze the sizes of  fragments
produced using an electrophoresis system capable of resolving  DNA  fragments
several hundred  kilobases in size. These restriction  fragments  may be detected
by standard Southern blotting  and probe  hybridization  procedures. A physical
map  of  the dystrophin  gene, including  $“I  sites is  illustrated  m Fig.  1. The
presence of  rearrangements  within  the 2300 kb  dystrophin  locus may result  in
the  production  of  abnormally  sized S’I  restriction  fragments  and  since the
majority  of  mutations  responsible  for  DMD/BMD  are large  scale deletions  or
duplications  (approx  60  and  7%,  respectively)  the  majority  of  DMD/BMD
mutations  are potentially  detectable by  PFGE analysis (2-7).  Once an abnor-
mally  sized fragment  has been detected, a qualitative  test is avallable  to female
relatives  for  the presence or absence of  the mutation.
In  order  to  extract  DNA  of  a size suitable  for  PFGE  analysis,  cells  are
immobilized  in  agarose blocks  and  all  subsequent steps of  DNA  extraction,
washing,  and  restriction  enzyme digestion  are performed  by  allowmg  diffu-
From.  Methods  m  Molecular  Medicme.  Molecular  Dfagnosls  of  Genetlc  Dtseases
Edtted  by*  R.  Elles  Humana  Press  Inc  ,  Totowa,  NJ
283
284  Cockburn  and  Seller
5’  3’
cDNA  I  9-l  ,  30-2  130-11  47-4  144.1,  p9  ,PIO,Pll-14,
SfiI  *  B
B  C  D  EE’  F  0  HI  J
map  T  p
0
t  t  w  T  P  ?T  t
140  310  390  230  1301  470  240  2GO  50  680
IO
deletion
hotspots
Fig.  1. Physical map surrounding the dystrophin locus, illustrating the positions of
SfiI  restriction sites (A-J)  and the sizes of  restriction fragments (in  kilobases; data
based on ref. I).  Unfilled  circles indicate sites which are partially digestible. The pres-
ence/absence of  site B’ is polymorphic in the normal population (present on approx
11% of  chromosomes; referred to as site S in ref.  1). The approximate positions of
exons to which cDNA probes hybridize IS indicated above the map and positions of
deletion hotspots is indicated below (corresponding to exons 3-19  and 44-55).
sion of  solutions  into  the  blocks. High-mol-wt  DNA  remains  trapped  within
the agarose matrix  and the blocks themselves  are loaded  into  the wells  of  the
gel.  Electrophoretic  separation  of  large  DNA  fragments  is  achieved  by  the
PFGE technique,  where  the basis for  resolution  is thought  to be the reorienta-
tion  in direction  of  migration  of the DNA  with  respect to the gel. The technical
challenge  of  producing  two  uniform  electric  fields  within  a smgle  tank  is
responsible  for  the unusual shapes and designs of  PFGE gel tanks.
The methods described here are those used in our laboratory  and employ  the
rotating  gel “Waltzer”  system, built  in a workshop  according  to the design of
Southern  et al.  (s).  Many  commercial  PFGE  systems are available  that  give
results of  similar  quality,  however  the conditions  for  optimal  resolution  vary
between  these systems. Since it would  be inappropriate  here only  to describe
the  conditions  used with  our  gel  system, we  have  indicated  the  factors  that
individual  operators should consider when selecting appropriate  conditions  for
use with  their  own  equipment.
Generally,  investigations  are performed  in two  types of  family,  first,  those
where  a mutation  has already been identified  (usually  a deletion)  and accurate
carrier  diagnosis  is requested, second, those where  no mutation  has yet been
identified,  either  because no  affected  male  is available  from  the  family  or
because of  the possibility  of  a duplication.  Although  duplications  are readily
detectable by PFGE analysis, they are not often  detected using  strategies cur-
rently  employed  in  the majority  of  diagnostic  laboratories.  In  the second type
of  investigation  a full  mutation  screen must be performed  using  probes  from
throughout  the dystrophin  locus. If  an abnormality  is identified,  it is often  pos-
sible  by  use  of  further  probes  to  characterize  the  mutation,  i.e.,  determine
Detection  of  Gene Rearrangements  in  DMD  285
whether  it is a deletion  or duplication,  its size, and approximate  location.  Such
information  is especially valuable  should  any member of  the family  request a
prenatal  diagnosis.
PFGE is just  one of  several  techniques  available  to diagnostic  laboratories
for  mutation  detection  and  carrier  identification  in  dystrophinopathies.  The
power  of  the technique  is demonstrated m its capacity for  unambiguous  carrier
diagnosis  and  detection  of  duplications  or  more  complex  rearrangements.
Therefore,  we believe  that the technique  deserves to be more widely  used and
that this would  improve  the overall  quality  of  service to patients.
2.  Materials
2.1.  Preparation  of  High-hlol-  Wt DNA  in  Agarose  Blocks
I.  Lysis buffer:  155 mMNH&  10 ~=IMKI-ICO,, 0.1 mMNa,-EDTA.  This solution
may be autoclaved and stored at 4°C.
2.  PBS: 0.8% NaCl, 0.23% Na,HPO,, 0.04% KH,PO,,  0.04% KCl. This solution
may be autoclaved and stored at 4°C.
3  Block  mold:  The  block  mold  should  produce  blocks  which  are  compatible  with
the  sizes  of  wells  in  the  pulsed  field  gel,  and  may  be  supplied  by  the  manufac-
turer  of  the  pulsed  field  gel  equipment.  We  use a  perspex  mold  that  produces
blocks  11 x 6  x  1.5 mm  in  size (approx  100 PL  in  volume;  these blocks  are later
cut  into  slices  of  approx  6  x  3.7  x  1.5  mm,  see  the following).  The  wells  are
formed  by  securing  a  strip  of  plastic  sticky  tape  to  one  side  of  the  block  mold.
Once  the  blocks  have  solidified,  the  tape  is  removed,  allowing  the  blocks  to  be
blown  out  of the  mold  using  a rubber  teat.  The  block  mold  must  be kept  clean  by
washing  in  a  solution  of  20%  ethanol,  1%  SDS  for  16  h  after  use,  rinsing  in
water,  and  thoroughly  drying.
4.  NDS:  30  g  NaOH,  186  g EDTA,  and  1.25  g  Tns  are dissolved  in  700  mL  HzO;
lauryl  sarcosine  (10  g  sodium  salt)  is  dissolved  in  50 mL  HzO;  the  solutions  are
mixed,  the  pH  1s adjusted  to  9.5 using  5MNaOH,  and  the  volume  is  made  up  to
1000  mL.  NDS  may  be stored  at 4°C  for  up  to  1 yr.
5.  A plastic  mesh  strainer,  marketed  as a tea strainer  and  obtainable  from  a domes-
tic  hardware  store,  is suitable  for  draining  wash soluttons  from  PFGE  blocks.
2.2.  Restriction  Enzyme  Digestion
1.  TE:  10 mMTrrs-HCl,  pH  8.0,l  rnUEDTA.  This  solution  may  be autoclaved  and
stored  at  4°C.
2.  SfiI  restriction  buffer:  50  mMNaC1,  10 mA4Tris-HCl,  pH  7.9,  10 mMMgCl,,
1 mMdithtothreito1,  and  100 ug/mL  bovine  serum  albumin,  This  solutton  is made
up  as a  10X  stock  and  stored  at -20°C.
2.3.  Gel  Electrophoresis
1.  We  use  a  “Waltzer”  apparatus  built  m  a  university  department  workshop,  as
described by Southern et al. (8). It is so called because the alternating electric
286  Cockburn  and  Seller
field  is  produced  by  rotating  the  gel  with  respect  to  the  apparatus  (the  angle  of
rotation  is  fixed  at  117’).  The  gel  tank  is  square  (260  x  260  mm)  and  the  elec-
trodes  are  straight,  but  the  gel  itself  is  circular  (diameter  220  mm)  to  ensure  a
uniform  electric  field.  This  equipment  produces  consistently  high  quality  DNA
resolution  in  straight  tracks.
2  0.5X  TAE:  0.24%  Tris,  0.057%  glacial  acetic  acid,  0.5  mM  EDTA.  A  50X  TAE
stock  solution  is stable  at room  temperature  for  up  to  6 mo.
2.4.  Southern  Slotting
1.  The  blotting  apparatus  consists  of  a glass  plate  supported  on  a platform  over  a
reservoir  of  alkali  blotting  solution  (approx  1000  mL)  with  four  sheets of  3MM
chromatography  paper  (Whatman,  Maidstone,  UK)  placed  over  the  glass  plate,
their  edges immersed  in  the  reservov.  The  gel  is placed  on top,  a sheet of transfer
membrane  (Hybond  N+;  Amersham,  Arlington  Heights,  IL)  is  laid  over  the  gel
followed  by two  sheets of 3MM  paper,  a 50-mm  stack of paper  towels,  and finally
a 500-g  weight.
2  Alkali  blotting  solution:  0.4M  NaOH  and  1.6M  NaCl.
3.  2X  SSC  1.75%  NaCl  and  0.88%  trisodium  citrate  . This  solution  is made  up  as a
20X  SSC  stock  which  is  stored  at  room  temperature  for  6  mo  and  is  diluted  as
required.
2.5.  Probe  Hybridization
1.  Hybridization  solution:  300  mL  20X  SSC  and  100 mL  50X  Denhardt’s  are mrxed
thoroughly  with  550  mL  HZ0  at  37°C.  Fifty  milhliters  10%  SDS  is  added  with
continuous  stirring  and the  hybridization  solution  IS aliquoted  and stored  at -20°C
for up  to  1 yr.  Before  use, dextran  sulfate  (sodium  salt)  is  dissolved  in  hybridiza-
tion  solutton  warmed  to  65°C  to  a  final  concentration  of  5%  50X  Denhardt’s
solution  IS prepared  by  dissolving  10  g ficoll,  10 g bovine  serum  albumin,  and
10  g polyvinyl  pyrollidone  in  900  mL  HZ0  The  solution  is  made  up  to  1 L  and
stored  at -20°C.
2.  cDNA  clones,  which  were kindly  provided  by  L.  Kunkel,  hybridize  to  the  fol-
lowing  dystrophin  exons:  9-7  (probe  0-2a)  to  exons  l-l  1; 30-2  (probe  2b-3a)  to
exons  1 l-20;  30-l  (probe  3b-5a)  to  exons  20-30;  47-4  (probe  5b-7)  to  exons
3 l-47;  44-l  (probe  8) to  exons 47-52  and 63-l  (probe  9-14)  to  exons  53-79  (9).
The  insert  of clone  63-l  may  be restricted  using  BumHI,  generating  three  smaller
probes.  Probe  9 hybridizes  to  exons  53-59,  probe  10 to  exons  59-66  and  probe
11-14  to  exons  66-79.  The  approximate  sites  of  hybridization  of  cDNA  probes
to  the  physical  @I  map  are illustrated  m  Fig  1.
3. Methods
3.1.  Preparation  of  High-MO/-  Wt DNA  in  Agarose  Blocks
The  standard tissue for  analysis is fresh blood, however,  cultured  cells (e.g.,
fibroblasts  and chorionic  villus  samples [CVS])  or frozen blood  are alternative
Detection  of Gene Rearrangements  in DMD  287
starting materials (see Notes 1 and 2). It  is not possible to obtain the clearest
results unless the blocks themselves are of  high  quality.  The DNA  must be of
high  molecular  weight  (not  degraded),  the  DNA  must be  evenly  dispersed
within  the blocks at the correct concentration, and the blocks themselves must
be firm  so that they do not disintegrate  during  subsequent manipulations.
The  DNA  concentration  within  blocks is determined  by counting  the white
cells and  adjusting  the number  of  blocks  made accordingly.  It  is imperative
that cells are evenly  dispersed within  the agarose block  since clumps  of  cells
produce  localized  high  DNA  concentrations  that migrate  more  slowly  in  the
gel,  resulting  in  a  smeared  hybridization  signal  on  the  autoradiograph.
Therefore,  if  cell  clumps  appear  during  the preparation  of  blocks  they must
be removed.
If  the DNA  from  any sample is found  not to have  fully  digested  when  the
gel  is run,  the  remaining  blocks  from  the  sample  may  be subjected  to  fur-
ther  pronase  treatment  followed  by NDS  washes (repeating  steps 8-12  that
follow).
1,  Mix 5-10  mL of blood gently with 30 mL lysis buffer  and stand on ice until the
red cells have lysed (approx 15-30 min), mrxing occasionally (see Notes 3 and 4).
2.  Centrifuge at 200g for  10 min and resuspend the pellet evenly in 30 mL PBS.
3.  Remove a sample and perform a white cell count (a Coulter counter or hemo-
cytometer may be used).
4.  Centrifuge at 200g for  10 mm and resuspend the cell pellet evenly in PBS giving
a cell concentration of 3 x lO’/mL.
5.  Warm the cell suspension briefly  at 37°C and mix with an equal volume of mol-
ten  1.2% low  melting  point  (LMP)  agarose (Ultrapure,  Life  Technologies,
Bethesda, MD) at 37’C in PBS giving a final cell concentration of  1.5 x 1 O’/mL.
6.  Dispense the cell suspension into wells of a block mold that has been precooled
on ice and leave to set for  10 min. Precooling the block mold ensures that the
agarose sets before white cells begin to settle.
7.  Blow the agarose blocks gently from the mold using a rubber teat into  10-20 mL
NDS containing 1 mg/mL pronase (Sigma, St. Louis, MO)  and incubate over-
night at 50°C. Ten milliliters of solution is used for up to 15 blocks and 20 mL for
16-30 blocks.
8.  Stand the tube on ice for 30 min to harden the blocks and drain the NDS/pronase
solution using the plastic mesh strainer.
9.  Replace with  IO-20  mL fresh NDS containing 1 mg/mL pronase and incubate
overnight at 50°C.
10.  Harden blocks by standing on we as described, dram NDS/pronase solution, and
replace with  1 O-20 mL fresh NDS (without pronase).
11.  Stand on ice for  30 min and replace NDS solution as described.
12.  After a further 30 min repeat step 11 so that three NDS washes are performed in
total. The blocks may be stored in the final NDS wash at 4°C indefinitely.
288  Cockburn  and  Seller
3.2.  Restricfion  Enzyme  Digestion
The  following  procedures  must be performed  on ice unless otherwise  indi-
cated to preserve  the integrity  of  agarose blocks.
1.
2
3
4.
5.
6.
7.
Transfer  PFGE  blocks  individually  to a glass microscope  slide  using  a glass scoop
(a glass Pasteurpipet  may  be modified  in  a flame  for thts purpose).  Cut  the  blocks
into  slices  corresponding  to  0  5 x  lo6  cells  using  a glass  coverslip  and  transfer
shces to  individual  2 mL  screwcapped polypropylene  tubes.  These tubes  are con-
venient  since  they  permit  rapid  addition  and  removal  of  wash solutions,  and  are
suitable  for  immersron  of the  block  slice  m  a minimum  volume  of enzyme  solu-
tion  (100  pL).
Add  1 mL  TE  to  each tube  and  incubate  for  30  min  (see Notes  5 and  6).
Remove  TE  wash  taking  care  not  to  damage  agarose  slice,  replace  with  1 mL
fresh  TE,  and  mcubate  for  a  further  30  mm.  A  disposable  plastic  Pasteur  pipet
has been  found  to  be  suitable  for  performmg  these  washes.
Repeat  step 3  so that  three  TE  washes are performed  in  total.
Remove  TE  wash as in  step 3 and replace  with  1 mL  S’I  restriction  buffer,  incu-
bating  for  30  min.
Remove  restriction  buffer  wash and  add  100 pL  SJI  restriction  buffer,  including
10 U  SfiI  (New  England  Biolabs,  Beverly,  MA).  Incubate  overnight  at  50°C  (see
Notes  7 and  8)
If  samples  are to  be  loaded  on  gels  within  24  h,  add  1 mL  gel-loading  buffer  to
each tube  and  equilibrate  for  at  least  15 mm.  Otherwise,  add  1 mL  NDS  to  each
tube  and  store  at 4°C  replacing  the  NDS  with  1 mL  gel-loading  buffer  within
24  h  of  loading  the  gel  (see Note  9).
3.3.  Gel  Electrophoresis
The  optimal  procedures  for  loading,  running,  and blottmg  pulsed field  gels
are particularly  dependent on the gel system being  used, therefore  we stress the
overriding  considerations that should be made. Conditions of electrophoresis that
may be varied  include  voltage,  agarose type and concentration,  buffer  type,
temperature,  and  reorrentation  angle.  Further  information  on  selection  of  suit-
able conditions  may be found  m the excellent  guide  of  Birren  and Lai  (IO).
The conditions  described here give  satisfactory resolution  of DNA  fragments
over  the range  of  1004000  kb using  our  equipment,  a size range appropriate
for  the majority  of  DMD  family  investtgattons.
1.  Cast  the  gel  on  a  horizontal  surface  (230  mL  of  1.5%  agarose,  Sigma  type  II,
medium  EEO;  in  0.5X  TAE)  and  leave  to  set.
2.  Fill  the  wells  with  0.5X  TAE  and  carefully  insert  the  agarose  block  slices.  The
slices  may  be manipulated  using  two  small  spatulas  (approx  4 mm  wide).  A Suc-
charomyces  cerevisiae  chromosome  size  marker  should  be  included  (commer-
cially  available  from  a variety  of  sources, e.g.,  New  England  Biolabs).  The  block
slices  are sealed  into  the  gel  by  covering  the  wells  with  molten  1% LMP  agarose
in  0.5X  TAE  at  37’C  that  is left  for  5 mm  to  solidify.
Detection  of Gene Rearrangements  in  DMD  289
3.  Ensure  the  gel  tank  is horizontal  using  a spirit  level,  wash out  the  heat  exchanger
with  70%  ethanol,  then  the whole  apparatus  with  distilled  water.  Refill  with  0.5X
TAE  electrophorests  buffer  and adjust  temperature  to  15°C  (see Note  10).
4.  Set the  switching  trme.  To  give  satisfactory  resolutron  over  a wide  size range,  we
increase  the  switch  time  during  electrophoresis.  Standard  conditions  are a  30-s
switch  time  for  16  h,  60  s for  8 h,  and  80  s for  16  h  (total  run  time  40  h).  A
constant  voltage  of  150  V  is  applied  (starting  current  250  mA).  Many  modern
appliances  employ  microprocessors  that  permit  the switch  time  to be ramped  con-
tinuously  during  electrophoresrs.
3.4. Southern  Blotting
There  is essentially no difference  in blotting  a pulsed field  gel from  blotting
a conventional  gel  apart  from  the  important  consideration  that  high-mol-wt
DNA  will  not transfer  efficiently  unless it is fragmented  prior  to blotting.  The
conditions  of  the  fragmentation  process are  critical  since if  treatment  is too
severe, a poor  hybridization  signal will  be obtained. It  is therefore  important  to
optimize this step and rigorously maintain conditions (see Note  11). The following
method  is for  alkali  transfer  of  DNA  to posttively  charged nylon  membranes.
1.  Remove  gel  from  tank  and  stain  in  2 pg/mL  ethidium  bromide  in  0.5X  TAE  for
15 min  with  gentle  shakmg.  Destain  in  0.5X  TAE  for  15  min  and  photograph
over  a UV  transilluminator,  taking  care to  expose  gel  to  UV  light  for  the  shortest
possible  time  to  mmimize  DNA  nicking.
2.  Depurinate  by  transferring  the  gel  to  700  mL  0.25M  HCl  and  gently  shaking  for
20  mm.  The  conditions  of  this  step are  critical  and  should  be calibrated  m  indi-
vidual  labor-atones  to give  maximum  hybrrdization  signal  (see Note  11).
3.  Transfer  the  gel  to  alkali  blotting  solution  and  leave  to  shake  gently  for  30  min.
4.  Southern  transfer  DNA  to  a Hybond  N+  membrane  (Amersham)  for  24  h using  a
reservoir  of  alkali  blotting  solution.
5.  Rinse  membrane  briefly  in  2X  SSC  and  air  dry.
3.5. Probe  Hybridization
1.  cDNA  or  genomic  probes  from  throughout  the  dystrophin  locus  are  labeled  by
the  random hexanucleotide priming method (multiprime kit, Amersham). Label
50  ng  of  cDNA  or  genomic  probe  to  a specific  activity  of  1 x  1 O7 dps/pg  with
a-32PdCTP  (Amersham).
2.  Prehybridize  membranes  for  30 min  in  sufficient  hybridization  solution  to  soak
them  plus  10  mL  excess per  bottle,  add  the  labeled  probe,  and  hybridize  at
65°C  overnight.
3.  Wash  membranes  to  a stringency  of approx  0.5X  SSC  (with  0.1%  SDS)  at 65”C,
air dry, and autoradiograph using X-ray  film  for  l-10  d at -7O’C.
4.  Before  reprobing  membranes,  the  old  probe  may  be  stripped  by  pourmg  boiling
0.1%  SDS  over  the  membrane  and  shaking  gently  for  10 min.  Membranes  are
often  reprobed  successfully  in  our  laboratory  up  to  five  times.
290  Cockburn  and  Seller
3.6.  Interpretation  of  Results
Accurate  interpretation  of  results from  pulsed field  gel investigations  of  the
dystrophin  locus  requires  care  and  skill.  It  is  essential to  recognize  normal
hybridization  signals that may be produced  by partial  DNA  digestion  or poly-
morphism  so that they are not confused with  abnormally  sized restriction  frag-
ments  resulting  from  mutations.  Careful  evaluation  of  results  is  therefore
essential and experience plays an important  part in this aspect of  PFGE analy-
sis. The approach to analysis in any family  depends on whether  any other  form
of  mutation  screen has already been performed  and on whether  a mutation  has
been identified  in such an analysis.
3.6.1.  Mutation  in  Family  Known
When the mutation  responsible  for  disease in a partrcular  family  has already
been identified  using  techniques other than PFGE analysis, it is generally  pos-
sible  to  predict  the approximate  size of  altered  SfiI  restriction  fragment  that
will  be produced  and  to  select probes  appropriate  for  its detection  (Fig.  1).
Sometimes, however,  this is not possible. The  breakpoint  positions  of  a dele-
tion/duplication  may not be precisely  known,  owing  to  incomplete  character-
ization or because the intron  in which  the breakpoint  lies is large. Alternatively,
it may be uncertain  whether  the deletion/duplication  includes  a particular  SfiI
site. Therefore,  it is important  to obtain a sample from  an affected  individual  or
known  carrier  and  analyze this alongside  the sample from  the individual  for
whom  carrier  diagnosis is required  whenever  possible.
cDNA  probes  are usually  suitable  for  detecting  an abnormal  S’I  fragment,
however,  they may produce a faint hybridization  signal from  the abnormal  frag-
ment if  this fragment  contains only  a small number  of  exons. In  these cucum-
stances, a genomic  probe  that  hybridizes  to  the  abnormal  fragment  may  be
used since this will  be expected to give  a stronger hybridization  signal.
Occasionally  an abnormal  &‘$I fragment  may be insufficiently  resolved  from
the normal  fragment  to permit  unambiguous  carrier  diagnosis.  It  is necessary
in  these cases to run  another  gel employing  conditions  that give  optimal  reso-
lution  m the required  size range.
3.6.2.  Mutation  in  Family  Unknown
3.6.2.1.  ANALYSIS OF BOYS IN  WHOM  No  DELETION  HAS BEEN  FOUND
If  no deletion  can be detected in  an affected  DMD/BMD  boy by multiplex
PCR  analysis,  there  is still  a chance that  a deletion  is present  that  does not
include  exons  tested by  this  approach  (II).  Such  deletions  are potentially
detectable  by  PFGE  analysis.  There  is a greater  chance, however,  that  the
mutation  responsible  for  the disease is a duplication.  Assuming  frequencies
Detection  of  Gene  Rearrangements  in  DMD  291
of  60,  7,  and  33%  for  deletions,  duplications,  and point  mutations,  respec-
tively,  one would  expect 7/40  (17.5%)  of  nondeleted  boys to  show  duplica-
tions.  In  our  laboratory  we  have  detected  duplications  in  7/25  (28%)
nondeleted  DMD  boys by  PFGE analysis,  suggesting  that  the frequency  of
duplications  may be higher  than  7%, and that screening  for  duplications  is a
worthwhile  test  when  no  deletion  has been  detected  (Cockburn  et  al.,  in
preparation).
The  distribution  of  duplications  causing DMD/BMD  is nonrandom  and dif-
fers from  that of  deletions.  The majority  of  duplications  occur in the proximal
region  of  the dystrophin  gene, close to the more proximal  of  the two  deletion
hotspots (2,7).  The  list of  probes recommended  for  a mutation  screen in  this
case therefore  includes  both  30-2  and  30-l  that are  from  this  region,  since
some duplications  may be detected using only  one of  these probes. The  recom-
mended  list of  probes used in a standard mutation  screen for  this type of inves-
tigation is: 9-7,3&2,30-l,  47-4,44-l,  probe 9, and probe  I 1-14.
An  altered  sized &“I  restriction  fragment  from  a DMD  boy  in  whom  no
deletion  had  been  found  is  illustrated  in  Fig.  2  (track  2).  An  explanation
consistent with  this result would  be the presence of a 170-kb duplication  within
the  700-kb  @?I fragment  BC  (Fig.  1). This  interpretation  could  be  tested by
dosage examination  of  an orthodox  Southern  blot  of  Hind111 digested  DNA
from  the patient  probed  with  cDNA  9-7  (exons  l-l  1).
3.6.2.2.  ANALYSIS  IN  FAMILIES WHERE  No  AFFECTED  MALE  Is  AVAILABLE
The detection of  a mutation  by PFGE analysis in a family  where  no affected
male  is available  for  any  type  of  molecular  genetic  analysis  has a dramatic
effect  on carrier  diagnosis. In such cases, carrier  diagnosis is transformed  from
a situation  relying  on linkage  analysis to one where  highly  accurate diagnosis
can be made.
There  is a very  good prospect of  identifying  a mutation  by PFGE analysis if
an  obligate  carrier  is  available  since most  deletions  and  duplications  are  as
straightforward  to identify  in a female  sample as in a male. When  no obligate
carrier  is available,  however,  the female  relative  who  is closest in relationship
to the affected  boy should be analyzed. If  an altered S’I  restriction  fragment  is
identified,  the presence or absence of  this fragment  may be used as the basis of
carrier  diagnosis in other  female  relatives.  If  no altered fragment  is identified,
then  this  result  reduces  the risk  that  a deletion  or  duplication  is present.  A
conservative  figure  of  50%  sensitivity  is  probably  appropriate  for  use  in
Baysian risk  calculations,  however  (see Chapter  S), this figure  depends on the
quality  of  results and the rigor  of  the investigation.  The  recommended  list  of
probes used in a standard mutation  screen for  this type of  investigation  is: 9-7,
30-2  or 30-1,47-4,44-l,  probe  9, and probe  11-14.
292  Cockburn  and  Seller
Fig.  2.  Hybridization  of  cDNA  clone  9-7  (exons  l-l  1)  to  Southern  blot  of  SfI
digested  DNA  resolved  on a pulsed  field  gel.  Fragment  sizes (in  kilobases)  that  repre-
sent  normal  results  are  shown  on  the  left  of  the  figure  and  the  sizes  of  abnormal
fragments  that  are  caused by  mutations  are  shown  on  the  right.  Tracks  1 and  3  show
individuals  with  normal  results.  The  sample  in  track  2 is from  an affected  boy  in  whom
no  deletion  had  been  identified  by  multiplex  PCR  analysis.  The  altered  870-kb  frag-
ment  may  represent  a 170-kb  duplication  within  the S’I  fragment  BC  (see Fig.  1). The
sample  in  track  4 is from  the  mother  of an affected  boy  who had  died  before  any  DNA
was stored.  An  abnormal  550-kb  fragment  is  present  both  in  this  sample  and  in  that
from  her  niece  (track  5).  Characterization  of  this  mutation  using  other  cDNA  and
genomic  probes  suggested  that  these individuals  are carriers  of a duplication  of  550 kb
that  includes  SfiI  site C. The  390-  and  3 lo-kb  fragments  additionally  present  in  track  4
are owing  to  the  presence  of the  partially  digestible  polymorphic  site  B’  on  the normal
chromosome  of  this  individual  (see Fig.  1). The  hybridization  signal  from  the  390-kb
fragment  is significantly  stronger than from  the 3 1 0-kb  fragment  since probe %7  hybridizes
to  exons  2-l  1 on  the  390-kb  fragment  but  only  to  exon  1 on  the  3 lo-kb  fragment.
An  altered  sized S’I  restriction  fragment  in female  relatives  of  a DMD  boy
who  died without  any DNA  sample being obtained is illustrated  in Fig. 2 (tracks
4  and  5).  Additional  PFGE  results  suggested that  the  mutation  is  a  550-kb
duplication  including  SfiI  site C.
Detection  of  Gene  Rearrangements  in  DMD  293
3.6.3.  Mutation  Characterization
The  identification  of  a deletion  in  a sample from  an affected  boy  is impor-
tant since it allows  accurate prenatal  diagnosis to be offered  to female relatives
on the basis of  a rapid  PCR test. Therefore  it is often  helpful  to characterize a
mutation  that has been identified  in a female  sample in case it  can be demon-
strated that the mutation  is a deletion  and some of  the exons involved  may be
identified.  It  is simplest when  characterizing  a mutation  to assume that it  is a
two-breakpoint  deletion  or  duplication  but to remember  to consider the possi-
bility  that  other  gross rearrangements  are  capable  of  generating  abnormally
sized @I  fragments  (translocations,  inversions,  complex  rearrangements,  and
so on).  Characteristic results from  PFGE analysis of deletions and duplications
are illustrated  in  Fig.  3 and Table  1. Information  relating  to the size of  abnor-
mal fragment,  the positions  of probes that detect or fail  to detect the abnormal
fragment,  and  the  relative  dosage of  hybridization  signal  from  normal  and
abnormal  fragments  helps to discriminate  between the possible mutation  types
and positions.
The  identification  of  a deletion  should  allow  accurate prenatal  diagnosis  to
be performed  if  required.  If  any doubt  remains  as to the nature  or  location  of
the mutation,  then linkage  analysis may also be performed.  Linkage  analysis is
probably  the course of  action chosen for  prenatal  diagnosis  should  a duplica-
tion  be identified.  The  accuracy of  linkage  analysis is improved  in these cases
once the duplication  has been identified  since markers closely surrounding  the
duplicated  segment can be analyzed, reducing  the chance of  a recombination.
It  is also possible  to perform  PFGE analysis on  cultured  CVS  cells, and this
would  be recommended if  there is any difficulty  in the interpretation  of  linkage
results,  for  instance if  the phase of  the mutation  cannot  be established,  if  a
recombination  is detected, or for  confirmation  of  linkage  results.
4.  Notes
1,  The normal hybridization signals obtained from SJI-digested DNA  from blood,
cultured flbroblasts, and cultured CVS cells have been found  to be identical,
indicating that any methylation differences between these tissues do not affect
S’I  digestion at the dystrophin locus. Therefore, results derived from these tis-
sues using SfiI  may be compared directly  on pulsed field  gels. The  method
described here for  harvesting fibroblast or CVS cultures and preparing PFGE
blocks gives the quantities required for each 25cm2 flask and should be scaled
up as required. A yield of approx 1.5 x 1 O6 cells is expected from each confluent
25 cm2 culture flask, sufficient for three tracks on a gel, however, it is technically
easier to prepare PFGE blocks from at least two to three times this quantity of cells.
Growth medium should be drained from  culture flasks and cells washed by
adding 10 mL PBS and leaving for 5 min. The PBS solution is discarded and the
cells are briefly  rinsed (for  approx 10 s) in 2 mL trypsin-EDTA  solution (0.25%
294  Co&burn  and  Seller
Normal
1. Deletion
B  C  D
t  700  ?  230  7
B  C  D
t  600  ,  t  230  7
/
–  100
2. Deletion
B  D
t  830  /  t /
–  100
B  C  D
3. Duplication  t  800,  ,  ,  t  230  7
/  /  /
+  100
B
4.  Duplication  ?  700
c  c  D
/?lopT  /  230  t
/  /  /
+  100
Fig.  3.  Schematic  effect  of deletions  and  duplications  on  the  sizes of S’I  restriction
fragments.  Restriction  sites  (B,  C,  and  D)  and  fragment  sizes (in  kilobases)  are  ~llus-
trated  above  the  maps.  Deletions  or  duphcations  are  indicated  below  the  maps  and
slashes  indicate  deletion  sites  or  boundaries  of  duplicated  segments.  The  numbered
mutation  types  (14)  correspond  to  those  in  Table  1
trypsin;  0.02%  EDTA),  which  is  then  also  discarded.  Fresh  trypsin-EDTA
solution  is  added  (2 mL)  and  cells  are incubated  at  37’C  for  approx  2 min.  The
culture  flask  should  be sharply  banged  on the palm  of one hand  two to three  times
to  promote  cell  dlssoclation,  which  may  be  assessed usmg  an  inverted  micro-
scope,  then  an equal  volume  of growth  medium  is added  to inhibit  further  trypsin
activity.  The  cell  suspension  is transferred  to  a fresh tube  and centrifuged  at 200g
for  10 min.  The  supernatant  is  discarded,  the  pellet  is resuspended  in  5 mL  PBS,
and  a cell  count  may  be  performed  using  a hemocytometer.  The  block  prepara-
tion  is  completed  by  proceeding  from  step 4  (see Section  3.1.)
Table  1
Characteristic  Results  of  PFGE  Analysis  of  Deletions  and  Duplications
Type  of  mutation=
Abnormal
fragment  sizeb
Detection  of  abnormal  Detection  of  abnormal
fragment  using  probe  fi-agment  using  probe
within  the  mutationC  not  within  the  mutaGonc
Results  using  probe  from
adjacent  SfiI  fragment
Deletion,  not  Always  smaller  –  +  Always  normal
including  an @I  site
Deletion,  May  be  smaller  –  +  May  show  same  abnormal
includmg  an SfI  site  or  larger  fiagmenr’
Duplication,  not  Always  larger  +e  +f  Always  normal
including  an Sfl  site
Duplication,  May  be  smaller  +h  –  May  show  same  abnormal
including  an SfiI  site  or  largefi  fragment
‘Tee  akro  Fig. 3.
%  relation to the normal fragment size detected by the same probe
=Presence (+) or absence (-)  of hybndizatlon to the abnormal fragment using probe from the same S’  fragment as another probe that detects the
abnormal fragment.
dLTnless probe 1s within the deleted segment.
el:2 dosage (normal*abnormal) 111 female tamers.
fl:  1 dosage (norm&abnormal) in female carriers.
4f  the duphcated segment contains only 1 SjI  site, the size of the altered fragment will  equal the size of the duplication.
hA normal sized fragment 1s additionally detected m males, 2.1 dosage (normal:abnormal) m female tamers
‘Unless probe 1s not withm the duplicated segment
296  Cockburn  and  Seller
2.  A method  for preparing  high-mol-wt  DNA  from  frozen  blood  has been  described
by  Nguyen  et al.  (12).  It  is not  recommended  as a routine  procedure  since  it  does
not  allow  the  white  cell  concentration  to  be measured  A  yield  of approx  4  x  lo7
whtte  cells  from  10 mL  of  blood  should  be assumed.  We  have  used  the  method
only  occasionally  but  have  achieved  satisfactory  results.  The  blood  (10  mL)  is
thawed  slowly  on  ice,  and  is mixed  gently  with  40  mL  ice-cold  TE.  The  tube  is
centrifuged  for 5 min  at 2000g  and the  supernatant  is dtscarded.  The  pellet,  which
is red  m  color,  is gently  resuspended  in  1.3 mL  TE  and the preparation  of agarose
blocks  is  completed  by  proceedmg  from  step 5 (see Section  3.1.).
3.  We  recommend  that  blood  samples  should  be  collected  in  EDTA  tubes  and
processed  promptly.  Although  satisfactory  results  are  often  obtained  from
samples  m  lithium  heparin  tubes,  we experienced  a large  number  of  failures  at
one  time  derived  from  a single  batch  of  lithium  heparin  tubes.  We  are  unsure
whether  this  was a defect  of  the  batch  of tubes  or  a general  problem  of  samples
collected  in  these  tubes.  Good  quality  blocks  are  often  prepared  from  blood
samples  several  days old,  however,  samples  that  are not  fresh appear  to  be  more
prone  to  producing  cell  clumps  durmg  block  preparation,  which  can be  a serious
problem.  We  always  try  to  obtain  blood  specimens  within  24  h  and  prepare
blocks  on  the  day  of  receipt.
4.  Red  cell  lysis  is  determined  by  observing  an  increase  in  translucency  of  the
sample.  Occasionally,  lysts  of some  samples  is slow,  especially  if  they  are fresh.
If  red  cell  lysis  has not  occurred  after  30  min,  the  tube  may  be  centrifuged,  the
supernatant  discarded,  and  the  pellet  resuspended  m  30  mL  fresh  lysts  buffer.
The  red  cells  generally  lyse  wtthin  a few minutes  and  agarose  block  preparation
can continue  from  step 2 (see Section  3  1 ). If  lysis  1s incomplete,  a number  of  red
cells  will  be present  in  the pellet  but  small  numbers  do not  seem to  interfere  with
the  quality  of  the  blocks.
5.  Many  protocols  for  restriction  enzyme  digestion  of  DNA  m  pulsed  field  blocks
recommend  treatment  with  phenylmethylsulfonylfluoride  (PMSF),  a  protease
inhibitor  that  is extremely  toxic.  We  have  found  that  PMSF  treatment  is unneces-
sary (at least  for @I  digestion)  providing  that  thorough  TE  washes are performed
PMSF  may  however  be  incorporated  in  the  first  TE  wash if  desired  at  a concen-
tration  of  0.1  mA4.  A  1M  stock  of  PMSF  dissolved  in  isopropanol  or  dimethyl
sulfoxide  (DMSO)  is  stable  at -20°C  for  up  to  5 yr.
6.  In  order  to  ensure  that  washes are thorough,  it  is  important  to  invert  tubes  before
removal  of wash solutions.  Residual  NDS  solution  adhering  to the  tube  cap might
otherwise  be  carried  over  and  inhibit  restriction  enzyme  digestion.
7.  The  volume  of  restriction  enzyme  solution  should  be  sufficient  to  completely
immerse  the  block  slice.  Ideally  this  volume  should  be  kept  to  a mimmum  and
will  be  determined  partly  by  the  shape  and  size  of  the  block  slice  as well  as the
shape of  the  tube.
8.  Covering  the  caps of  the  tubes  with  a layer  of  heat  insulation  during  restriction
enzyme  digestion  reduces  condensation  formation  inside  the  caps  and  helps  to
maintain  the  optimal  buffer  concentration.
Detection  of Gene  Rearrangements  in DMD  297
9.  Although  digested  DNA  is  stable  indeflmtely  when  stored  as  described,  low-
mol-wt  DNA  will  diffuse  out  of  the  agarose  shce  This  has  not  generally been
found  to  be a problem  m  our  experience,  however,  we have  observed  that  DNA
below  approx  50 kb  IS lost  when  digested  DNA  is  stored  for  several  weeks.
10  Washmg  with  70%  ethanol  is  a precaution  agamst  growth  of  algae  or  fungi  that
may  produce  nucleases  resulting  in  DNA  degradation  The  ethanol  is  saved  and
reused.  Alternatively,  glass heat  exchangers  may  periodically  be  autoclaved.
11.  An  alternative  fragmentation  process  to  acid  depurmation  IS  nicking  by  UV
radiation.  This  may  be performed  using  a UV  transillummator  or  UV  oven  As
with  acid  depurrnation,  the  conditions  of UV  treatment  must  be optimized  to give
maximum  hybridization  signal  and these conditions  must  then  be faithfully  mam-
tamed  The  output  from  UV  sources  decreases with  use, therefore  recalibration
will  become  necessary  m  time.  If  exhausted  UV  tubes  are  replaced  in  the
transilluminator,  then  the  newer  tubes  with  higher  output  may  cause an  uneven
exposure  to  DNA  in  the  gel.  Further  information  on  optimization  of  DNA  frag-
mentation  may  be  found  m  Bnren  and  La1 (10)
Acknowledgments
We thank Ruth  Charlton  for  critical  reading  of  the manuscript.
References
1.  Coffey,  A.  J ,  Roberts,  R  G  , Green,  E.  D.,  Cole,  C.  G  ,  Butler,  R  ,  Anand,  R.,
Giannelli,  F  , and  Bentley,  D  R.  (1992)  Construction  of  a 2  6-Mb  contig  m  yeast
arttfictal  chromosomes  spanning  the  human  dystrophm  gene  usmg  an  STS-based
approach  Genomlcs  12,4?4-484
2  den  Dunnen,  J. T  , Grootscholten,  P  M.,  Bakker,  E  , Blonden,  L  A  J., GmJaar,  H.
B  , Wapenaar,  M.  C , et al  (1989)  Topography  of the  Duchenne  muscular  dystro-
phy  (DMD)  gene*  FIGE  and  cDNA  analysis  of  194  cases reveals  115  deletions
and  13 duplications.  Am  J.  Hum  Genet  45,  835-847.
3.  Koenig,  M.,  Beggs,  A.  H.,  Moyer,  M.,  Scherpf,  S , Heindrich,  K  , Bettecken,  T  ,
et  al  (1989)  The  molecular  basis  for  Duchenne  versus  Becker  muscular  dystro-
phy:  correlation  of seventy  with  type  of deletion  Am  J  Hum  Genet  45,498-506.
4.  Hu,  X.,  Ray,  P.  N.,  Murphy,  E.  G.,  Thompson,  M.  W.,  and  Worton,  R.  G.  (1990)
Duplicational  mutation  at the Duchenne  muscular  dystrophy  locus:  its  frequency,
distribution,  origin,  and  phenotype-genotype  correlation  Am  J  Hum  Genet  46,
682-695.
5.  Boyce,  F.  M.,  Beggs,  A  H.,  Feener,  C.,  and  Kunkel,  L  M.  (1991)  Dystrophin  is
transcribed  in  brain  from  a distant  upstream  promoter.  Proc.  Natl.  Acad.  SCI.  USA
88,  1276-1280.
6.  Hiraishi,  Y.,  Kato,  S , Ishthara,  T.,  and  Takano,  T  (1992)  Quantitative  Southern
blot  analysis  in  the  dystrophin  gene of Japanese patients  with  Duchenne  or Becker
muscular  dystrophy*  a high  frequency  of duplications.  J. Med.  Genet  29,897-901.
7.  Galvagni,  F.,  Saad,  F  A.,  Danieli,  G.  A  , Miorm,  M.,  Vmello,  L  , Mostaccmolo,
M.  L.,  and  Angelmi,  C.  (1994)  A  study  on  duplications  of  the  dystrophm  gene
298  Cockburn  and  Seller
evidence  of a geographical  difference  in  the  drstributron  of breakpoints  by  intron.
Hum  Genet  9483437.
8  Southern,  E  M.,  Anand,  R  , Brown,  W.  R.  A.,  and Fletcher,  D.  S  (1987)  A  model
for  the  separation  of  large  DNA  molecules  by  crossed  field  gel  electrophoresrs
Nuclex  Acids  Res  15,  5925-5943
9.  Koenig,  M.,  Hoffman,  E  P.,  Bertelson,  C  J.,  Monaco,  A  P.,  Feener,  C.,  and
Kunkel,  L.  M.  (1987)  Complete  cloning  of  the  Duchenne  muscular  dystrophy
(DMD)  cDNA  and  preliminary  genomrc  organization  of the  DNA  gene  in  normal
and  affected  individuals.  Cell  50,  509-5  17.
10.  Bnren,  B  and Lar,  E. (1993)  Pulsed Field  Gel Electrophoresw * A  Practwal  Guide
Academic,  San  Diego,  CA
11  Abbs,  S  , Yau,  S.  C ,  Clark,  S.,  Mathew,  C.  G.,  and  Bobrow,  M.  (1991)  A  con-
venient  multiplex  PCR  system  for  the  detection  of  dystrophin  gene  deletions.  a
comparative  analysis  with  cDNA  analysis  shows mistypmgs  by  both  methods.  J,
Med  Genet  28,304-3  11
12  Nguyen,  C.,  Djabali,  M.,  Roux,  D  , and  Jordan,  B.  R.  (199 1) Very  high  molecular
weight  DNA  for  pulsed  field  gel  studies  can  be obtained  routmely  from  conven-
tional  frozen  blood  ahquots  Nuclerc  Acids Res  19,407.
18
Fluorescent  Sequencing  Protocols  in  Diagnosis
Colin  A.  Graham  and  Alison  J.  M.  Hill
1. Introduction
I.  I.  Direct  Fhorescen  t Sequencing
Direct  sequencing of  PCR products using the dideoxy  cham termination  pro-
cedure developed  by Sanger et al. (I)  is now  the most commonly  used method
for  defining  specific  mutatrons. The main benefits  of  this method  lie in its ease
of use, and this has been enhanced in recent years by the introduction  of  fluo-
rescent labels and automated detection systems that obviate  the need for  radio-
activity.  Although  the initial  purchase price  for  automated sequencers is high,
this  is compensated for  by  single  tube  reaction  chemistry  and rapid  analysis
and base calling.
1.2.  Instrumentation
At the present time only two  commercial  fluorescent  sequencers are in com-
mon usage throughout  the world;  the 373A/377  fluorescent  fragment  analyzers
(Perkin  Elmer,  Norwalk,  CT/Applied  Biosystems Dtvrsron,  Foster City,  CA)
and the ALF  DNA  sequencer (Pharmacia, Uppsala,  Sweden). The  373A  is the
most widely  used instrument  and benefits  from  the use of  multicolor  fluores-
cence  detection  that  enables  single  lane  sequencing,  and  the  company  has
developed  very  simple fluorescence dye-terminator  sequencing kits. The meth-
ods described  in  this chapter  are confined  to the use of  the 373A  sequencer.
The  ALF  instrument  has the advantage  of  faster run  times and  the raw  data
does not require  the mobility  shift corrections used to compensate for  differen-
tial  dye mobrlities  m the 373A.  However,  it  is restricted  to running  standard
four  lane sequencing and thus is more prone  to electrophoretic  irregularities.
From  Methods  m  Molecular  Me&me  Molecular  D/agnos/s  of  GenetIc  Dfseases
Edlted  by  R  Elles  Humana  Press  Inc  , Totowa,  NJ
299
Graham  and  Hill
The  373A  mstrument  contains  a chamber  for  vertical  polyacrylamide  gel
electrophoresis.  This  enables  single  base resolution  of  sequencing  products.
Fluorescently  labeled  fragments  pass through  a “read”  window,  24  cm  from
the loading  wells,  which  1s scanned by an argon  laser. The  fluorochromes  are
excited by the  laser emission and are detected with  filter  wheels  and a photo-
multiplier.  The  fluorescent  stgnals are passed to an Apple  Macmtosh computer
that analyzes then  position  and strength and produces a chromatogram  consist-
mg of  colored  peaks. The area under the peak represents the strength of  the srg-
nal and the peak color is specific for  the base at that position. The software  gives
a base call A, T,  C, or G at each position  or assigns N tf  the position  is unclear.
1.3.  Comparison  of  Sequencing  Protocols
The  methods  and  examples  given  in  this  chapter  concentrate  on  the  Taq
(Thermus  aquatzcus)  polymerase  dye  terminator  cycle  sequencing  system
Fig.  1, as this is now  becoming  the most widely  reported  fluorescence  sequenc-
ing  method  for  the  definmon  of  mutations  m  human  genes. An  alternative
method  IS  Taq  dye primer  sequencing, the prmciples  of  which  are outlined  m
Fig.  2. Some of the methodological  details to be considered before  setting up a
sequencing procedure  for  diagnostic  use are now  considered  bearing  m mmd
that the method  should be reliable,  consistent, give  good quality  results, and be
easy to use for  a wade range of  dtfferent  sequences.
1.3.1.  Sequencing  Methods  and  Enzymes
Cycle  sequencing using a thermostable  DNA  polymerase  such as Tag  is the
method  of  choice. The  benefits  of this method are: a large number  of  reactions
can be performed  simultaneously  using a thermal  cycler, only  a small  amount
(<l  pg)  of  template  DNA  is required  to give  good  quality  sequence, and the
cycling  nature  of  the reaction  gives  strong signal  profiles  and greatly  reduces
strand annealing  and random  priming  events that produce  background  noise.
The use of  Taq  polymerase enables sequencing to be carried  out at 60°C  and
this reduces secondary structure m  the template and gives  more  efficient  read
through  GC-rich  regions. One of  the disadvantages of  Taq  is that incorporation
efticrencies  for the fluorescent terminators are very  sequence dependent and this
leads to uneven  signal profiles.  This is illustrated  m Fig. 3 (shown  on page 3 17);
chromatograms  A  and B as the profile  of  the arrowed  base sequence CCACT
varies  dependent on the surrounding  sequence. These panels also demonstrate
how  reproducible  signal profiles  are for  a given  sequence. If  this is a problem
then  the  Sequenase (USB)  enzyme should be considered. A  separate set of  dye
terminators has been produced  by Perkin  Elmer,  Applied  Biosystems division,
for  use with  this enzyme. This enzyme gives more even dye terminator incorpora-
tion and thus more uruform  signal profiles, but it cannot be used at 60°C  and thus
secondary structure problems lead to a portion of most sequences betng unreadable.
Fluorescent  Sequencing  Protocols  in  Diagnosis  301
( 94  “C  )
primer
-T-Cl  fi
–  T  C-
n-5%)
ealinq
Denaturation
–  T  C  A  G-•j
Dideoxy  chain  termination
products
Fluorescent  terminators
Red  q  ddTTP
Blue  ddCTP
Green  •j  ddATP
Yellow  i8  ddGTP
Fig.  1.  Taq  dye terminator cycle  sequencing. Cycle  sequencing is like a linear PCR
reaction  using single- or  double-stranded DNA  template and priming  from  a single
sequencing primer. The dideoxy  chain terminators carry four  distinct fluorescent dyes,
thus all the termination products can be loaded in a single lane and size separated on a
polyacrylamide  gel.  The sequence is read as a color  code using a laser and fluores-
cence detection system.
1.3.2.  Dye  Primer  vs  Dye  Terminator
In  dye  primer  sequencing the  fluorescent  labels have  to  be attached to  the
sequencing primer  and four  separate reactions are required  matching  a specific
dye  labeled  primer  with  a specific  dideoxy  terminator.  The  products are then
pooled  and cleaned to remove  dye primers prior  to electrophoresis. With  dye-ter-
minator sequencing the dye labels are attached to the dideoxy terminator molecules
and thus sequencing can be accomplished in a single tube reaction. Technicali-
ties of  the different  sequencing chemistries are discussed by Hawkins  (2).
A  comparison  of  these two  sequencing chemistries  is shown  in  Fig.  3C,D.
This  illustrates  the  main  benefit  of  dye  primer  sequencing  in  that  signal
strengths are more  uniform  and A  and T  tract anomalies  (Fig.  4A)  and noise
problems  associated with  dye terminator  sequencing are greatly reduced. How-
302
Dve  Primer  Seauencma.
Graham  and  Hill
ANNEALING  EXTENSION  PRODUCTS
with  fluorescer~lly  labelled  prmer  Enzyme,  dNTPs  end  ddNTPs
-TCAGT
Pool  samples  and  clean
before  eleclrophoresis
\  =  Primer  wllh  fluorescent  label
1  ;:;:a :::;  1
Fig.  2. Dye  primer  sequencing  requires  the  sequencing  primer  to  be  fluorescently
labeled  with  four  distinct  fluors  Each  fluorescent  primer  is  then  matched  with  a spe-
cific  dideoxy  terminator  and  four  separate  sequencing  reactions  are  required.  The
extension  products  can then  be pooled,  cleaned,  and run  in  a single  lane  as with  the  dye
terminator  system
ever,  the cost and ease of use benefits of  the dye terminator  system make it the
method  of  choice  for  the  majority  of  PCR  product  sequencing  requirements.
If  sequencing  of  an  unknown  fragment  or  repeated  sequencing  of  the  same
region  1s required,  then  the  dye  primer  method  should  be  considered.
1.4.  Primer  Design  and  Synthesis
Primer  base composltlon,  secondary structure, stability,  and specificity  are
all  important  in  producing  clear  sequence  data.  The  primer  sequence  should  be
specific  to reduce binding  to secondary sites and a minimum  length of  20 bp is
recommended.  Primers  with  a  high  G/C  content  have  higher  annealing  tem-
peratures  and  will  be  more  stable  and  effective  m  cycle  sequencing.  The
Fig.  4.  (opposrte page)  Sequencing  anomalies  (A)  Some  of  the  artifacts  typically
seen  with  Tag dye  terminator  sequencing.  The  arrows  indicate  the  reduction  in  peak
height  observed  after  the  first  base in  A  and  T  tracts.  The  stars show the  reduction  in
intensity  observed  followmg  a G  base, this  is especially  pronounced  for C. (B)  A  simple
polymorphism  found  in  exon  10 of  the  CFTR  gene.  The  star indicates  the  polymorphic
base. (C)  Forward  (F) and  reverse (R)  sequence for  the  detection  of the  PKU  mutation
Fluorescent  Sequencing  Protocols  in Diagnosis  303
A  AGgCCAGCG  TTQ-&CTCCA  AACTATTTTTCAGQ
TGGTQ  A  AATQ  NTQ  A  A  A&Q  AT  Q  A
T  ACCTTQ  Q
F
Q  0  Q  0  0  Q  &,Q
l-l
~
QQQCCA  A&,
Fig,  4.  (continued)  R408W,  a C >  T  base change  in  exon  12 of  the PAH  gene.  The  top
panels  show the  normal  profile  and  the  bottom  panels  show a patient  homozygous  for
the  mutation.  A  patient  heterozygous  for  the  mutation  is  shown in  the  center  panel  and
the  mutant  base is indicated  with  a star. In  the  forward  sequence there  IS no  sign  of  the
mutant  T  base,  although  the  intensity  of  the  C peak  is reduced.  However,  the  mutant  A
base is seen readily  in  the  reverse direction  together  with  a reduced  intensity  G  signal.
304  Graham  and  Hill
presence of  a  CG  basepalr  at the  3’  end  of  a primer  can  help  to  stabilize  it
during  the  cycling  reaction.  Computer-packages,  such as Primer  Detective
(Clonetech,  Palo Alto,  CA),  can be used to identify  sultable primers  and will
show any self-  or cross-complementanty  m the selected primers. Primer  length,
CG  content, and product  melt  temperature  are also considered.  It  can still  be
difficult  to design reliable  primers  for  some regions,  mainly  because the DNA
sequence sun-oundmg the  area of  interest contains repeat  sequences or  is AT
rich.  Poor  quality  primers  can result  m relatively  good  peak signal  strengths
but high  background  noise or noisy slgnal with  no well-defined  peaks, this can
be due to random  priming  reactions if  the primer  is not  specific  or to  impure
primer.  Primer  synthesis for  sequencing  should  be  carefully  monitored  as
short-mers  and  impurities  may  interfere  with  the  sequencing  reaction.  For
optimal  results sequencing primers  should be HPLC  purified.  If  the primer,  or
template,  concentration  is  too  high,  then  reaction  components  can become
exhausted during  the cycle sequencmg reaction  with  considerable  reduction  m
signal  intensity  toward  the end of  longer  fragments.
2.  Materials
1.  Centricon-  100 concentrators  (Amicon  Inc.,  Danvers,  MA)
2  Sterile, deionized water (water for  injection, Antigen Pharmaceuticals, Roscrea,
Ireland).
3  Ultrapure  agarose (electrophoresls grade) (Glbco-BRL, Galthersburg, MI).
4  Nusleve  agarose  (genetic  technology  grade)  (FMC  Bloproducts,  Rockland,  ME)
5.  Taq  DyeDeoxy  Termmator  Cycle  sequencing  Kit  (Perkm  Elmer)
6  PRISM  (Ready  Reaction)  DyeDeoxy  Terminator  Cycle  Sequencing  Kit
(Perkm  Elmer).
7  Mmeral  011 (Sigma,  St.  Louis,  MO).
8.  Phenol:HzO  chloroform  (68.18.14  [v/v/v])  (Perkm  Elmer).
9  2.5M  Sodium  acetate  (Perkm  Elmer).
10.  Absolute  alcohol  (AR)  (Hayman  Ltd.,  Witham,  UK).
11  Alcmox  detergent  (Aldrich  Chemical,  Milwaukee,  WI).
12.  Sequagel-6  (premixed  6%  sequencing  gel,  19.1  acrylamlde.blsacrylamide  with
urea  and  TBE  buffer).
13  Ammornum  persulfate,  10% stock  solution  (BloRad  Laboratories,  Hercules,  CA)
14.  Trls  Borate EDTA  (TBE buffer  10X)  (Blowhlttaker, Walkersvllle, MD)
15.  Formamide  (deionized)  (Sigma).
16  EDTA:  50  mM  stock  solution  pH  8 0 (Normapur,  Prolabo,  Pans,  France).
3.  Methods
The  methods described are specifically  deslgned for  performing  fluorescent
sequence analysis on the Perkin Elmer, Applied  Biosystems Model  373A.  Use
of  the 373A  sequencer and the relevant  software  is described  m detail  m the
manufacturer’s  manual.
Fluorescent  Sequencing  Protocols  in  Diagnosis  305
3.1.  Template  Preparation
The  methods described m this chapter deal exclusively  with  template  DNA
produced  using  the polymerase  chain reaction  (PCR).  The  yield  and purity  of
the amplified  product are of critical  importance  for good quahty sequence. Thus
5 pL  of  the amplified  DNA  is run  out in 2% agarose gels to estimate concentra-
tion  and  purity.  If  nonspecific  product  is  seen, the  amplification  reaction
should be repeated under more stringent conditions, in the presence of dimethyl-
sulphoxide  (DMSO),  or  after  band-stab  gel  purification  as described  m  the
following  (3).
3.1.1.  Purification  of  PCR  Amplified  DNA  by  “Band-Stab”
This method of template purification  allows amphtication  of specific regions
of  DNA  without  any  nonspecific  contaminating  products,  occasionally  pro-
duced during  the PCR reaction.
1  Amplify  the section of DNA of interest by PCR and run out on a 2% agarose gel
contaming ethrdlum  bromide  (0 5  ,ug/mL)
2.  Visualize  the  gel  over  a UV  transillummator  and  insert  a sterile  needle  mto  the
correct  DNA  band  in  the  gel
3.  Redissolve  DNA  picked  up by  the  needle  m  50 PL  of  sterile  deionized  water  m  a
clean  microcentrifuge  tube
4.  Use  5  PL  of the  resulting  solution  as template  m  a second  PCR  reaction  with  the
same primers.
5  Check an aliquot of the second PCR product again for  concentration and purity
on  an agarose  gel.
3.1.2.  Purification  of  Template  DNA
The  PCR product  that is to be used as template  for  the sequencing reactions
has to be purified  in order  to remove  any residual  primers  or excess PCR reac-
tion  components that could  interfere  with  the sequencing reactions. The use of
ultrafiltration  spin columns Centricon  or Microcon  (Amicon)  has proved  to be
very  effective  (see Note  1).
3.1.2.1.  CENTRICON-1  00  PURIFICATION  COLUMNS
1.  Assemble  Centricon-  100  columns  as described  u-r the  manufacturer’s  manual.
2.  Add  2 mL  sterile,  deionized  water to  the  top  of  the  column.
3.  Gently  layer  the  template  DNA  (30-40  pL  of  PCR  product)  on  top  of  the  water.
4.  Attach  the  collection  tube  provided  to  the  top  of  the  assembled  column.
5.  Spin  at  1 OOOg for  30 min  and remove  lower  collection  chamber  and  discard  fluid
(a second  spin  with  a further  2 mL  of water  is  not  required).
6.  Invert  the column  and centrifuge  for 2 min  to collect  the purified  sample  (-50  nL)
7.  Transfer  the  sample  to  a clean,  sterile  microcentrifuge  tube  and  store -20°C.
306  Graham  and  Hill
3.2.  Dye  Termina  for  Cycle  Sequencing
of  Double-Stranded  PCR  Fragments
The  method described  here relates to the single tube sequencing of  double-
stranded DNA.  Sequencing 1s carried  out using the TuqDyeDeoxy  Terminator
Cycle  Sequencing  Kit  or  the reaction  ready  Prism  TaqDyeDeoxy  Terminator
Cycle  Sequencing  Kit.
3.2.7.  Cycle  Sequencing  Using
the  Taq  Dye Deoxy  Termlna  tor  Cycle  Sequencing  Kit
Each  of  the  DyeTerminator  sequencing  kits  contams  reagents  for  100
sequencing  reactions. Unmixed  reagents should be stored at -20°C.  Reaction
premixes  can be  made  up  according  to  the  manufacturer’s  mstructlons  and
stored at 4OC for  up to  1 mo. The  amount  of  mix  prepared  should be scaled to
average  usage  within  this  time.  Preparing  premixes  should  help  to  avoid
variability  between  reactions.  The  primers  used in  the  sequencing  reactions
may be the same used m the original  PCR reactions or they may be specifically
designed for  sequencing and internal  to the original  primers.  In either case they
should  be diluted  to a working  concentration  of  3.2 pmol/pL.
1  Set  up reaction mix  m  a  clean, sterile  mlcrocentrlfuge  tube.  Reaction  mix
N  x 9  5 pL  reaction  premix,  N  x  1 0  pL  sequencmg  primer,  N  x 2  5-4.5  pL  ster-
ile,  deionized  Hz0  (where N  =  no.  of  samples  +  1)
2.  Ahquot  13 pL  of  the  reaction  mix  into  mdlvldual  PCR  tubes  (0  6 mL)
3  Add  5-7  pL  template  DNA,  depending  on  gel  estimate  of  concentration
4  Overlay  reactions  with  one  drop  of  mmeral  011 and  place  on  the  thermal  cycler
preset with  the appropriate  cycle  sequencing  reaction  conditions  (see also  Note  2).
3.2  1  1.  TYPICAL CYCLE  SEQUENCING  REACTION
1.  Initial  denaturation.  94°C  for  2 min  and  94°C  for  30  s.
2  Twenty-five  cycles:  primer  T,  -5°C  for  15 s and  60°C  for  4 mm
3  Final  coolmg:  4°C  for  10 mm
3.3.  Purification  of  Sequencing  Reaction  Products
After  cycle sequencing the huge excess of  fluorescent  dye terminators  used
to  drive  the  reaction  must  be efficiently  removed  for  good  quality  electro-
phoretic  separation  of  the termmatlon  products  and effective  analysis  of  the
initial  50 bases after  the primer.  A variety  of  methods are available  to achieve
this, two  of  which  are described m the following.
3.3.1.  Phenol:Chloroform  Extraction  Method
1  Transfer  the  20  PL  of  sequence  reactlon  to  a clean  0 6-mL  mlcrocentrlfuge  tube
taking  care  not  to  transfer  any  of  the  mineral  oil  overlaymg  the  reaction.
2  Add  80  pL  sterile  delomzed  water  and  vortex  to  mix.
3  Add  100  pL  phenol:H20:chloroform  (68: 18: 14) and  vortex.
Fluorescent  Sequencing  Protocols  in D/agnos/s  307
4.  Centrifuge  briefly.  Remove  and discard  the  lower  organic  phase
5.  Repeat  the  organic  extraction  process and  centrifuge  for  1 min.
6.  Transfer  the  upper  aqueous  layer  to  a clean  tube  and  place  sample  on  Ice
7.  Precipitate  the  extension  products  with  20  pL  2 5M  sodium  acetate,  pH  4  5,  and
300  pL  of  100%  ethanol  stored  at -2O’C  (see Note  3).
8.  Place  samples  at -70°C  for  l&l  5 min  and  collect  the precipitate  by  centrifuga-
tion  at  room  temperature  for  15 min.
9.  Wash  the  pellet  gently  with  70%  ethanol.  Do  not  resuspend  Centrifuge  at  room
temperature  for  15 mm.
10.  Remove  ethanol  and  vacuum  dry  the  pellet.
3.4.  Polyacrylamide  Gel  Preparation  and  Electrophoresis
The  glass plates  used  for  fluorescent  sequencing  are  made  of  glass  that  does
not  contain  any  fluorescent  elements  and  are  obtained  from  Perkin  Elmer,
Applied  Biosystems division.  They  should  be free  of  dust and grease and are
cleaned  using  the  detergent  Alcmox.  After  washing,  the  plates  are  rinsed
extensively  in  tap water  and  100% ethanol  and allowed  to air  dry.  The  plates
are separated using 0.4~mm spacers and poured  horizontally  on a level  surface.
If  vertical  pouring  1s preferred  then the plates are taped along  the outer  edges.
3.4.7.  Gel  Casting
1  Mix  50  mL  of  Sequagel-6  (premlxed  6%  sequencmg  gel,  19.1  acrylamide:bis-
acrylamide  with  TBE  buffer)  (see  Note  4)  with  400  pL  fresh  ammonmm
persulfate  (10%  solution).
2.  Set the  plates  on  a level  surface  and  add  the  gel  mix  from  the  top  center  usmg  a
20-mL  syringe,  tapping  the  plates  occasionally  to  ensure  air  bubbles  are  not
trapped.  Small  air  bubbles  at the  edges  are not  a problem
3.  Insert and clamp the well-former  and clamp the  top  edges of the plates  with  “bull-
dog”  chps.
4.  Allow  the  gel  to  polymerize  for  l-2  h. If  storing  overnight  keep  the  gel  at 4°C.
5.  Check  the  plates  for  any  dust  or  spilled  acrylamlde  as described  in  the  user’s
manual.  If  necessary  clean  the  outside  of  the  plates.  Scratches  on  the  plate  or
irregularities  cast m  the  gel  can be lifted  above  the  scan wmdow  by  placing  card-
board  under  the  buffer  chamber.
6.  Carefully  remove  the well-former  and msert  the  shark’s  tooth  comb  with  the  teeth
of the comb  just  touching  the surface ofthe  gel  (24 and 36 well  combs  are available)
7.  Set  up  the  373A  DNA  sequencer  according  to  the  manufacturer’s  instructions
and prerun  the  gel  at 30  W  for up  to  1 h.
3.4.2.  Preparation  of Samples  for Gel Electrophoresis
Dried  pellets may be resuspended in loading buffer  and stored at 4°C  for  l-2  h.
1.  Prepare fresh loadmg buffer:  5 pL  formamlde and 1 PL  50  mM  EDTA  (pH  8.0)
per  sample.
2.  Dissolve  the  pellet  m  4-pL  loading  buffer  and  denature  the  samples  at 90°C  for
3  min  and place  on  Ice.
308  Graham  and  Hill
3  Wash  out  the  wells  with  1X  TBE  using  a syringe  with  spade tip  to  remove  urea,
and  load  samples into the odd-numbered wells only. Run samples into the gel for
10 mm Interrupt the run and load the even numbered samples. Staggered loading
allows  the  sequencer  software  to more  easily  identify  mdrvrdual  sample  lanes  for
tracking  purposes
4.  The electrophoresis settings are 25-30  W and 1500 V with the power limiting
5  Click  on  COLLECT  on  the  computer  screen to  ensure  data  collectron
3.5.  Analysis  of  Results
The  sequencing  software  analyzes a run  by  lookmg  for  a first  fluorescent
band, whtch  is followed  within  a given  time period  by a second band. On this
basis, the software  designates the first  band  as base “1.”  It  can, however,  be
confused  by  salt fronts  runmng  ahead of  the main  data or  by the presence of
unincorporated  termmators  that  give  high  signal  dye  “blobs”  and  result  m
mappropriate  base calling  and reduction  of the observed  signal strength in  the
true  sequence data. In  addttion,  the first  20 or  30 base calls can be difficult  to
read because of  high  signal  levels  and  it  is therefore  important  to be able  to
assign base “1”  accurately  and reanalyze that portion  of  the sequence giving
the best data. This  can be achieved  by the postrun  operator  controlled  removal
of  nonspecific  data before  and after  the usable sequence.
It  1s also important  for  the software  to recogmze each mdividual  lane and to
stay tracked within  the center of  the lane. Tracking  can be affected  adversely
by  uneven  polymerization  of  the gel  or  large  residual  amounts of  salt m the
samples. The  dye blobs  associated with  unincorporated  dye  termmators  can
also spill  fluorescence  into  adjacent lanes and confuse tracking.  It  is necessary
therefore  to check that the assigned tracks remain  m the center of  the lane for
the  length  of  the run  and if  not  then they should  be reassigned and  the lanes
reanalyzed.  This  type  of  operator  controlled  reanalysis  can  sigmficantly
improve  the data quality
3.5.1.  Signal  Strength
As  mentioned  previously  the  incorporation  efficiency  of  fluorescent  dye
terminators  by  Tag  polymerase  1s variable  and  the  C  termmator  is the  least
efficient.  Thus  the C  signal  level  is usually  the lowest  unless the sequence is
very  C rich.  If  C  is ~20  there  will  be  a lot  of  C  noise  m the  chromatogram
profile  as the C signal is amplified  to give  a reasonable profile.  Such sequence
profiles  are  best  disregarded  and  the  sequencing  repeated  with  an  increase  m
the  amount  of  template or reduction  m the annealing  temperature.
3.5.2.  Base  Spacing  and  Base  Calling
In  order  to accurately call  the bases in a sequence, the sequencing  software
needs to determme  average  peak  intensities and spacmgs over  a mmimum  of
approx  150  bp.  Fragments  shorter  than  that  mintmum  result  n-r the  software  not
Fluorescent  Sequencing  Protocols  in  Diagnosis  309
being  able to accurately  assign base spacing. When this happens the software
is more susceptible to effects of gel compresstons that are thought to be caused by
the presence of  hairpin  loop  structures at the ends of  fragments.  The  mobility
of  shorter fragments  1s more affected  by these secondary structures than longer
fragments  and thus they are more  likely  to  show  compression  effects.  These
manifest  themselves as uneven  spacing in the chromatogram  and, m the worst
instance, the computer  software  will  insert a base into  the gap that it  assumes
should  be filled.  If  the background  noise is high  in  the gap then the the soft-
ware might  call a base. In  many instances, however,  it wtll  make an equivocal
call  (N).  The  base spacmg can only be called If  the scans per base fall  between
9 and  15; this is determmed  by the rate of  electrophoresis  that can be adjusted
by altering  the electrophoresis  power  or  optimizmg  the polymertzatton  of  the
acrylamide  Base calling  also can be compromised by high noise levels  because
of  low  srgnals or  false primmg.
3.5.3.  Sequence  Alignment  and  Comparison  Software
An  analysis  package  called  SeqED  (Perkin  Elmer,  Applted  Biosystems
division)  can be used to align similar  sequence data from  dtfferent  tracks or runs
and can display  aligned  data and chromatograms. However,  tt has very  hmited
ability  to perform  multiple  alignments and this together with  an mefficient  means
of  heterozygote  detection  make the program  poor  for  heterozygote  mutation
detection,  A  follow-on  program  called  Sequence Navigator  (Perkin  Elmer,
Applied  Biosystems division)  was produced as a more  comprehensive  analysis
package. This program can perform multiple ahgnments much more efficiently  and
considers peak size for  heterozygote detection. A  compostte normal  can be pro-
duced that can then be compared with  abnormal  samples for  heterozygote detec-
tion and the level  of recognition  of  the second base can be set by the user.
3.5.4.  Data  Storage
For each 373A instrument  it is advisable  to have a Macintosh  computer  dedi-
cated to  collection  of  data and  inmal  automated  analysis, this  allows  two  to
three runs per  24 h period  with  vn-tually  contmuous  data collection.  For  data
collection  it is recommended that there is at least 40 Mb  free hard disk space on
the computer  prior  to collection  and that the disk IS regularly  monitored  with  a
repair  program  such as Norton  Utilities.  In  order to process this amount of  data
from  the  instrument,  it  is necessary to  have  two  additional  computers  for
detailed  sequence analysis, comparison,  and printing  of hard copies  Network-
ing  of  the  computers  is preferred  as transfer  of  large  files  (up  to  20  Mb)  is
required.  This  can be otherwise  achieved  by the use of  removable  hard or opti-
cal drives,  Once analysis of  the large  gel file  is complete, this file  can be dis-
carded and only  the results files require  archiving.  A result file  for  a single track
in a gel occupies 96 kb of disk space, thus two floppy  disks (1.4 Mb)  are required
310  Graham  and  Hill
to  store  result data from  a 24-lane  gel. It  is recommended that bulk  archiving  1s
carried  out  using removable  hard  or  optical  disks with  capacmes from  approx
40-200  Mb.  Optical  drives  probably  are more  reliable  and  cheaper  per  megabyte
storage, however  the drive  unit is considerably more expensive. We have  found
removable  hard disks (Syquest 88 Mb with  a Prodrtve  80 drive  unit, Format)  to
be satisfactory. However,  essential results should also be stored on floppy  disk.
Networking  to a mam frame  computer for  storage is another option  that should
be discussed with  your  local mformation  technology  department.
3.6.  Examples  and  Interpretation  of  Fluorescent
Sequencing  Gels  for  Heterozygote  Detection  in  Diagnosis
Visual  pattern  recognmon  is very  efficient  for  identifymg  sequence profile
irregularittes  providing  that  the  Tuq  dye-terminator  sequencing  anomalies  and
the  heterozygote detection criteria defined are considered (see Notes 5+8). A color
mkJet printer  such as the Hewlett  Packard 500~ series 1s more suitable for  prmt-
mg  sequence  chromatograms  than  the  thermal  wax  printers  supplied  with  the
machine  because of  cost and the color  defimtion  1s better.
3.6.1.  Phenylalanine  Hydroxylase  (PA H)  Gene  Mutations
Phenylketonuria is an autosomal recessive disorder caused by mutations m the
PAH  gene. The  gene is composed of  13 exons coding for  a 2.2-kb  mRNA.  The
mutatronal  spectrum  is diverse  with  point  mutations  occurring  throughout  the  gene.
We have used fluorescence dye terminator cycle sequencing to screen all exons of
the  gene  and  have  identified  35  different  missense and  nonsense mutations
accounting  for  99% of  gene defects (5) and several polymorphisms.  Anomalies
observed  in the detection of  the main mutation  R408W  are shown in  Fig. 4C.
3.6.2.  Cystic  Fibrosis  Transmembrane  Conductance  Regulator  (CFTR)
Gene  Mutations
Cystic  fibrosis  is an autosomal  recessive  disorder  caused by  mutations  in
the CFTR  gene. The  gene is composed of 27 exons coding  for  a 6.5-kb  mRNA
(6).  The  main  mutation  1s a 3-bp  in  frame  deletion  m exon  10. The  sequence
pattern  for  a  patient  heterozygous  for  this  mutation,  AF508,  1s shown  in
Fig.  5C.  The  mutational  spectrum is very  heterogeneous  and over  500 muta-
tions  have  been  reported  to  date,  covering  all  exons  of  the  gene,  intron  splice
regions  and the 5’ promoter.
Fig.  5.  (opposite  page)  Deletion  mutations.  All  chromatograms  are  of  Taq  dye
terminator  cycle  sequencing  of  PCR  products.  (A)  A  single  base  deletion  in  exon  4
of  the  CFTR  gene  (557  de1 T).  (B)  The  reverse  sequence  for  a 2-base  deletion  in
exon  6  of  the  p53  gene  (1214  de1 TT)  (C)  A  3-base  deletion  in  exon  10  of  the
CFTR  gene  (AF508,  1652  de1 CTT).  In  each  case the  normal  profile  is  shown  in  the
Fluorescent  Sequencing  Protocols  in Diagnosis
C&T  T  T  N  N  0  0  C  C  &  T  C  A  T  C  A  C  A
CTCNACNAA
T  A,T,OC  A  T  C  T  Tf  Q  0  &,Q  TT?CCTAT&
n  ”  w  n
Fig.  5.  (continued)  top  panel  and  the  start  of the  deletion  is  indicated  with  a star  The
deletions  are only  present  in  one allele  (heterozygous).  Thus  the profiles  are staggered
by  1,2,  and  3 bases after  the  site  of the  deletion.
312  Graham  and  Hill
Thus  comprehensive  mutation  detection  for  this disorder  requires  analysis
of  the common  mutations  followed  by  screening  of  all  the  exons  and  splice
sites. We  have  used  direct  fluorescent  dye  terminator  cycle  sequencing  to
screen all exons of the gene. Over  40 different  mutations and several  polymor-
phisms have  been detected using  this method.  A  polymorphism  m  exon  10 is
shown m Fig. 4B. A rare single base deletion  in exon 4 (7)  and a stop mutation
m exon 3 are illustrated  m Frgs. 5A  and 6A,  respectively.
3.6.3.  LDLR  Gene  Mutations
Famihal  hypercholesterolemia  is a codominant disorder  caused by mutations
m the low  density lipoprotein  receptor gene (LDLR).  The  gene is composed of
18 exons coding  for  a 5 kb  mRNA.  Over  150  different  mutations  have  been
described to  date (81. In  approx  5%  of  cases the condition  is caused by  gross
deletion  m  the  gene,  however,  the  majority  of  cases are  caused  by  small  deletions
and single base changes. Automated  fluorescent  sequencing has enabled us to
identify  over  70%  of  gene  defects  m  patients  heterozygous  for  this  condttton  and
two  missense  mutations  m  consecuttve  codons  in  exon  10  are  shown  in  Fig.  6B
(9). See Notes 9-l  3 for  general interpretative  points m heterozygote detection.
3.6.4  p53  Gene  Mutations
Mutations  m  the  ~53  gene  represent  the  most  common  genetic  abnormality
described  in  human  cancers  to  date.  The  prevalence  of  ~53  mutations  varies
among  tumor  types,  ranging  from  O-60%  m  major  cancers,  and  is  over  80%  m
some histological  subtypes. The  ~53  gene  consists of  11  exons;  exon  1  1s
noncoding,  exons 2-l  1 code for  the protein of 393 amino acids. There  are a wide
variety  of  ~53  mutations,  dispersed  over  several  hundred  basepans  of  the  gene
(10).  The  majority  of  ~53  mutations  (approx  90%  of  all  mutations)  occur  m
exons  5-8,  correspondmg  to the regions  of  the gene that are highly  conserved
through  evolution.  Missense mutations  are the  most  common  type  (79%  of
mutations)  m  this  conserved  midregion,  but  occur  less  frequently  in  the  ammo  and
carboxy  termmi  where  nonsense  mutations  predominate  (77%  of  mutations)  (1 I).
Direct  fluorescent  sequencing  of  exons 5-8  has proved  to be  an effective
method  for  the detection  of  mutations  m the ~53 gene, a 2-bp  deletion  m exon
6 is illustrated  m Fig.  5B.
Fig.  6.  (opposzte  page)  Missense  mutations.  All  chromatograms  are of  Taq  dye  ter-
minator  cycle  sequencing  of PCR  products  (A)  A  G  >  T  change  in  codon  60,  exon  3 of
the  CFTR  gene.  (B)  Codons  46tX-462,  exon  10 of the  LDLR  gene. The  top  panel  shows
a G  >  A  change  and  the  bottom  panel  a T  >  C  change.  In  the  given  examples  the  het-
erozygote  shows roughly  equal  intensities  for the mutant  and normal  bases and the  nor-
mal  base is reduced  relative  to the control.  (C)  Codons  57-59,  exon 2 of the HLA  D-1
gene.  The  top  panel  shows the normal  profile  of the  0401  type  The  bottom  panel  shows
a G  >  C change  in  the  0416  type  A  DR4  specific  primer  was used in  the  PCR  reaction
thus  only  that  allele  was amplified  and the  sequence change  shows as a homozygote
CFTR-Ex3
T  AG  AG  AG&T
A
NOR
Jo AG  AN  AG  CT
LDLR  -ExlO
TQT&,N  ACTGG
2r
D461N
B  GlGGACNGG
W462R
HLA-  DRfY
CTQ  AT
C
0401
0416
E59Q
Fig. 6.
314  Graham  and  Hill
3  6 5  HLA  DR  and  DP  Typing
Automated  fluorescence  sequencing  is  now  being  considered  as a  possible
alternative  to  ollgotypmg  for  the  DR  and  DP  10~1. These  regions  are highly
polymorphic  and  a sequencing  method  would  require  a very  efficient  means  of
semlautomated  heterozygote  detection  The  use of  Sequence Navigator  may
accomplish  this.  We  have  used  allele-specific  PCR  and  dye-termmator
sequencing  to  define  a rare  subtype  detected  by  oligotypmg  (Frg  6C)
3.6.6  Dwussion
Automated  fluorescent  sequencing  using  the  dye-termmator  chemistry  1s
Increasingly  being  used  m  diagnostic  laboratories  to  define  rare  mutations
detected  by  rapid  screening  procedures  such  as  DGGE  (12)  or  SSCP (13-15).
The  mam  benefits  of  this  system  are  single  tube  and  single  lane  reaction  chem-
istry, cycle sequencing for  easy sequencing of  PCR products, fluorescent  detec-
tion  that  eliminates  the  need  for  radioactivity,  automated  base  calling  and
semi-automated  analysis,  hard  copy  printouts  of  the  signal  profiles,  and  mass
data  storage
4.  Notes
1  The  purified  samples  should  be checked  on  2%  agarose  gels  to  ensure  efficient
sample  recovery  from  the  column  Alternative  methods  can be used  for template
purlficatlon  (4)  including  ion-exchange  columns  such as QIAqmck-spin  columns
(Qulagen),  “gene  cleaning”  methods  using  glass  powder  suspensions  such  as
Geneclean  (Stratech  Scientific,  Teddmgton,  UK)  or  similar  DNA  bmdmg  agents
as used  m  Magic  PCR  preps  (Promega,  Madison,  WI)  These  methods  may  be
less  expensive  than  the  ultrafiltration  method  described  earlier,  however,  they
are  more  labor  mtenslve  and  we  have  not  found  them  to  give  good  results  as
consistently  Overall  the  Centricon-  100  procedure  gives  the  most  consistent
results  m  our  hands  and  is  recommended  for  diagnostic  sequencing.  This  method
efficiently  punfies  PCR  products  of >lOO  bp.
2  The  PRISM  kits  marketed  by Perkm  Elmer,  Applied  Blosystems  dlvlslon,  are ready
mixed  versions  of the  TaqDyeDeoxy  Terminator  Kits  and  are used  m  exactly  the
same manner  but  without  the preparation  of the premix.  The  cycling  reaction  should
take  approx  2  h  45  mm.  If  the  thermal  ramping  time  1s too  fast  or  too  slow,  the
resulting  data  may  be  poor,  with  high  levels  of background  noise  The  annealing
temperature  should  be  adjusted  according  to  the  primer  sequence  and  IS usually
optimal  5-7°C  below  the  estimated  melt  temperature  of the primer  [T,  =  2(A  +  T)
+  4(G  +  C)]  The  followmg  thermal  cyclers  have been  found  to  give  good  quality
cycle  sequencing  Perkm  Elmer  480  and Aztec  PC-700  (Hoefer,  San Francisco,  CA)
3.  The  preclpltatlon  step  1s vital  for  efficient  recovery  of  termination  products
after  phenol:chloroform  extractlon  and  it  is necessary to  use fresh sodium  acetate
(~1  mo  at 4°C  after  opening)  to  obtain  good  product  yield  It  is also  not  recom-
mended  to  resuspend  the  pellet  during  the  70%  ethanol  rinse  to  remove  the
sodium  acetate  prior  to  electrophoresls,  as this  can  result  m  a low  yield  and  poor
Fluorescent  Sequencing  Protocols  in  Diagnosis  315
signal  When  used  efficiently  spm  columns  can  prove  an  effective  and  quick
method  for  terminator  removal  Select-D,  G50  columns  have  been  used  and
proved  to  be satisfactory  with  careful  use. With  the  spm  column  procedure  avoid
touching  the  side  of  the  column  when  loading  the  samples,  as this  material  can
shunt  through  and  contaminate  the  eluate.  InconsIstency  in  column  preparation
can also  affect  the effcrency  of terminator  removal.  In  general  the  phenol  chloro-
form  extraction  method  1s preferred.
4.  The  use of  a  low  fluorescence  commercial  sequencing  gel  mix  1s highly  recom-
mended,  as these  are batch  tested  and  thus  gel  consistency  can be  assured within
a batch.  This  also  ehmmates  gel  variation  problems  if  the  machme  1s bemg  oper-
ated  by  multiple  users  The  Sequagel-6  gel  mix  does  not  require  degassmg  for
optimal  polymerization
Notes  5-8  refer  to  Taq  dye  terminator  sequencing  anomalies
5  Peak  profiles  are u-regular but  highly  consistent  for given  sequence (see Fig  3A,B)
6.  Reduction  m  signal  strength  occurs  after  the  first  base  m  A  and  T  tracts  (see
Fig  4A).
7.  Bases followmg  a G base often  have a reduced  signal,  especially  C (see Fig  4A*)
8  Multiple  Gs often show a signal  reduction  at the second or third  base (see Fig  3A,B)
Notes  9-l  1 refer  to  interpretive  points  in  heterozygote  detection
9.  Print  sequence profiles  m  color  at four  to five  panels  per page  and  500-800  points
per  panel
10.  Signal  strength  reduction  of the  normal  base is the  most  consistent  feature  denot-
mg  a heterozygous  base position  (see Figs  4B,C  and  6A,B)
11  The  appearance  of the  second  base m  a heterozygote  1s often  not  detected  by  the
base calling  software  Compare  the  center  panel  of the  sequence  m  Fig  4B  with
the  center  panel  of  the  R  sequence  m  Fig  4C
12  The  base after  the heterozygote  posltlon  will  often  show an altered  signal  strength
(see Fig.  4B  T  after  the  G  >  A  polymorphism)
13.  Heterozygotes  that  show only  peak  reduction  in  one  direction  generally  show the
mutant  base  clearly  m  the  other  direction  (see Fig.  4C)
14.  In  August  1995  Perkm  Elmer,  Applied  Blosystems  dlvlslon,  released  a new gen-
eration  of PRISM  kits,  mcludmg  the ABI  PRISM  Dye  Terminator  Cycle  Sequenc-
ing  Ready  Reaction  Kit  (with  AmpllTaq  DNA  Polymerase,  FS  Product  No.
402079)  all  of which  utilize  a thermal  stable  enzyme  specially  modified  for  fluo-
rescent  sequencing  All  the  necessary reagents  are premixed  and  ready  for  use m
the  sequencing  of  smgle-  and  double-stranded  DNA  and  PCR  fragments.  There
are  however  some  differences  m  the  techniques  used  and  the  results  obtamed
with  these  kits  This  section  again  concentrates  on  Tag-FS  dye  terminator  cycle
sequencing  of  double-stranded  PCR  products.
a.  Template.  Double-stranded  PCR  template  1s produced  and  purified  as
described  (see Section  3  1.). Use  of the new AmphTuqFS  enzyme  has resulted
m  an increase  m  the efficiency  of the  fluorescent  cycle  sequencing  reaction  It
is  therefore  only  necessary  to  use approximately  half  of  the  orlgmal  amount
of  template,  1 e , 2-4  PL  or  250-500  ng.
316  Graham  and  Hill
b  Terminator  incorporation:  AmpliTuq  DNA  Polymerase  (FS)  is a mutant  form
of the  original  Tuq DNA  polymerase.  It  has very  little  S-3’  exonuclease  acttv-
tty  and  mcorporates  all  four  dtdeoxynucleotrdes  with  equal  ease thus  remov-
mg  the  need  for  very  htgh  concentrattons  of  dye-labeled  termmators  The
concentrations  of dideoxynucleotides  and dye termmators  have therefore  been
set such that  the  A,  T.  C,  and  G  signals  should  be  relatively  uniform  between
bases 10 and  700  In  addition  dGTP  has been  replaced  with  dITP  m  an  effort
to  reduce  band  compression  effects
c.  Purifying  cycle  sequencmg,  products:  The  reduction  m  the  amount  of  dye-
labeled  termmators  m  the  sequencing  reaction  has resulted  in  the  removal  of
the phenol  chloroform  extraction  step and its replacement  by  a simple  ethanol
precipttatton  or  spm  column  purtfication,  both  of  which  have  been  recom-
mended  by  the  manufacturer.  The  ethanol  prectpttatton  1s mexpenstve  and
effective  and  gives  clean,  reproducible  sequence.
1  Add  2 uL  3M  sodmm  acetate,  pH  6.0 and  50 uL  of  95%  ethanol  to  a mtcro-
centrifuge  tube
il.  Transfer  the  20  pL  sequencing  reaction  product  to  this  tube  and  mix
thoroughly.  Place  at 4’C  for  10-15  mm.
iii  Microcentrifuge  at htgh  speed for  20-25  mm
iv.  Gently  remove  the supematant  using  a plastic  Pasteur pipet  attached  to a fine
pipet  tip,  taking  care not  to  disturb  the  pellet,  which  1s not  usually  visible
v  Rinse  the pellet  with  250  uL  of  cold  70%  ethanol
vt.  Remove  the  70%  ethanol  as previously  described  and  carefully  dry  the
inside  of  the  tube  using  a tissue
vii  Dry  the pellet  in  a vacuum  centrifuge  and  store at -20  or  +4”C,  until  ready
for  electrophorests
d.  The  changes  described  in  the  concentrattons  and  effecttveness  of  mcorporatton
of  the  dideoxynucleotides  and  dye  termmators  has  resulted  m  more  even  dye
terminator  incorporatton  and  thus  more  even  signal  profiles.  However  the  signal
profile  for  a given  sequence  differs  markedly  between  the  old  and  new  kits  as
illustrated  in  Fig.  7. Thus  it  1s not  possible  to  directly  compare  old  and  new ver-
sion  sequences especially  for heterozygote  detection.  Specific  improvements  with
the new kit  include  better  read through  A  and T  tracts  and  no signal  drop  off  after
G bases. However  there  is now a drop  in  signal  strength  after  A bases particularly
for  G  bases
Fig.  3.  (opposite  page)  Stgnal  profiles  in  fluorescent  sequencing.  (A,B)  Taq  dye
terminator  cycle  sequencing  of  PCR  product  for  exon  4  of  the  LDLR  gene  in  two
patients.  The  peak  profiles  produced  for  a given  sequence  are virtually  identical  from
one  indtvidual  to  another  The  arrow  mdtcates  how  the position  of  specific  bases, e g.,
CCACT  withm  a sequence  can determine  then  exact  profile  (C,D)  Taq  dye  termma-
tor  vs  Tuq  dye  primer  cycle  sequencing  of  PCR  product  for  exon  13a  of  the  CFTR
gene.  The  dye  primer  sequencing  gives  more  even  peak  heights  and  does  not  suffer
from  the  A  and  T  tract  peak  reductions  seen wtth  dye  termmators.
A  TTC&ACTPCCTAA&,TQGQO  AGTO&,ATCCACTCC,&,QCTQQ
B  TTCCAC~~~CCTAAOTO~OGAST”CAT~CAC’CCA”C,~~QO
c  A  A  C  A  A  A  A  C  Jo  AGQATTOOQ&QCACTTCTA&
Fig.  3.
A  rirA&,TUO  AC~CB  AC&CT@  TCOTO1)$,CAOTa  TOTC&,
B
Fig.  7. Comparison  of the  Tag-FS  (A)  and  Taq  (B)  version  dye terminator  sequenc-
ing  hts  for PCR  product  sequencing.  Note  the  more  consistent  slgnal  profile  with  the
newer  version  Taq-FS  kit.  Over  a 70-base  region  of this  exon  (LDLR  exon  lo),  94%  of
peaks  were >25%  of the  panel  height  with  Taq-FS  compared  to  73%  with  Taq.
318  Graham  and  HI//
Acknowledgments
We  thank  our  colleagues  Johannes Zschocke,  Alana  Ward,  Kate  Gleeson,
and  David  Hughes  for  providing  data and  for  helpful  dlscusstons during  the
preparation  of  this chapter. The  followmg  have  provided  financial  support  for
our  sequencing  proJects: The  Cystx  Fibrosis  Research Trust;  The  Northern
Ireland  Chest, Heart and Stroke Assoctatlon; and the Medical Research Council
References
1  Sanger, F , Ntcklen,  S.,  and  Coulson,  A.  R.  (1977)  DNA  sequencing  with  chain
terminating  mhtbitors  Proc  Natl  Acad  SCI  USA  14,  5463-5467
2  Hawkins,  T  L  , Du,  Z  , Halloran,  N.  D.,  and  Wtlson,  R  K  (1992)  Fluorescence
chemistries  for  automated  primer-directed  DNA  sequencing  Electrophorests
13,552-559
3  Bjourson,  A  J  and  Cooper,  J  E  (1992)  Band-stab*  a sample  techmque  for  the
purification  of  mdtvldual  PCR  products  Nuclezc  Acids  Res  20,  4675.
4  Rao,  V  B  (1994)  Direct  sequencmg  of  polymerase  chain  reaction-amplified
DNA  Anal  Biochem  216,  l-14
5  Hobbs,  H  H.,  Brown,  M  S , and Goldstem,  J. L  (1992)  Molecular  genetics  of  the
LDL  receptor  gene  m  famlhal  hypercholesterolaemta  Hum  Mutut  1,4451166
6.  Graham,  C. A,  Ward,  A.  J., Nevm,  N.  C., Young,  I  , O’Kane,  M.,  andNicholls,  D  P
(1994)  Automated  sequencing  has ldenttfied  70%  of mutations  m  30 pattents  with
familial  hypercholesterolaemta  m  Northern  Ireland  Atheroscleroszs  112,  262
7.  Zschocke,  J.,  Graham,  C  A  , Stewart,  F  J  , Carson,  D  J  , and Nevm  N  C  (1994)
Automated  sequencing  detects all  mutations  m Northern  Irish  pattents  wtth  phenyl-
ketonurla  and mild  hyperphenylalaninaemla.  Acta  Paedlatr  407(Suppl.),  37,38
8  Kerem,  B.,  Rommens,  J.  M.,  Buchanan,  J.  A  ,  Marktewlcz,  D  ,  Cox,  T  R  ,
Chakravatt,  A.,  et  al  (1989)  Identtfication  of  the  cysttc  fibrosts  gene  genetic
analysis  Sczence  245,  1073-I  080
9.  Graham,  C.  A,  Goon,  P.  K  C.,  Hill,  A.  J  M  , and Nevin,  N.  C  (1992)  Identlfica-
tion  of  a frameshtft  mutation  (557delT)  m  exon  4  of  the  CFTR  gene  Genomzcs
12,  854,855.
10  de  Fromentel,  C  C  and  Soussi,  T  (1992)  TP53  tumor  suppressor  gene  a model
for  mvestlgatmg  human  mutagenesis  Genes,  Chromosom  Cancer  4,  l-l  5
11  Hollstein,  M  , Race, K.,  Greenblatt,  M  S.,  SOUSSI, T  , Fuchs,  R.,  Sorhe,  T.,  et al
(1994)  Database  of p53  somatic  mutations  m  human  tumors  and cell  lines  Nuclezc
Acids  Res  22,355  1-3555
12.  Guldberg,  P.,  Henriksen,  K  F.,  and  Guttler,  F.  (1993)  Molecular  analysts  of
phenylketonuria  m  Denmark:  99%  of  the mutations  detected  by  denaturmg  gradl-
ent  gel  electrophoresis.  Genomrcs  17,  141-146
13  Chtllon,  M.,  Casals,  T  , Gtmenez,  J , Nunes,  V.,  and  Esttvlll,  X  (1994)  Analysis
of the  CFTR  gene  in  the  Spamsh  population:  SSCP-screening  for  60 known  muta-
tions  and  tdentificatlon  of  four  new mutations  (Q3OX,  A 120T,  18 12- 1 G  >  A  and
3667del4).  Hum  Mutat  3,223-230
Fluorescent  Sequencmg  Protocols  m Diagnoses  319
14  Nunes,  V.,  Chlllon,  M  , Dork,  T.,  Tummler,  B.,  Casals,  T.,  and Esttvtll,  X.  (1993)
A  new mlssense  mutation  (E92K)  in  the first  transmembrane  domain  of the  CFTR
gene  causes a bemgn  cysttc  fibrosis  phenotype  Hum  Mel  Genet  2,  79,80
15  Hagemann,  T  L  , Chen,  Y  , Rosen,  F.  S  and Kwan,  S -P  (1994)  Genomlc  orgam-
zatlon  of  the Btk  gene  and  exon  scanning  for  mutations  in  patients  with  X-linked
agammaglobulmaemla  Hum  Mel  Genet  3,  1743-1749

19
High  Throughput  Modifications  of  Single-Strand
Conformation  Polymorphism  Analysis
Mutation  Detection  in  Familial  Hypercholesterolemia
Steve  E. Humphries,  Vilmundur  Gudnason,  Ros  E. Whittall,
and  Ian  N.  M.  Day
1.  Introduction
In  most  patients  with  familial  hypercholesterolemia  (FH)  the  disorder  is
caused by a mutation  in the gene coding  for  the low  density lipoprotein  recep-
tor  (LDL-R)  (I).  The variety  of  different  defects observed  in receptor  function
at the  cellular  level  reflects  mutations  in  different  domains  of  the gene, and
there is an increasing  number  of  pointers  to suggest that genetic  factors  influ-
ence clinical  severity.  The  diagnosis  of  FH  on  clinical  grounds  is not  100%
accurate, and some hypercholesterolemic  individuals  may not have  a mutation
m the LDL-R  gene, whereas  some individuals  who  would  not  be included  in
the clinical  criteria  do have  such a mutation.  The  purpose of  this chapter  is to
Illustrate  the use of  the single-strand  conformational  polymorphism  (SSCP)
technique  for  mutation  screening  in  the  LDL-R  gene and  to  discuss several
adaptations of published  methods that improve  throughput,  and that we believe
are appropriate  for  a disorder  such as FH. In the next few  years such techniques
will  help  to tackle molecular  diagnosis and family  tracing  in the large number
of FH  patients present in Europe  and North  America.
1.7.  General  Principles  of  the  (SSCP)  Technique
Several  methods  have  been  published  that  allow  rapid  comparison  of  the
sequence of  specific  fragments  of  DNA  amphfied  by polymerase  chain reac-
tion  (PCR)  from  different  individuals  (2,3) and we have found  the SSCP analy-
sis to be the most useful.
From  Methods  in  Molecular  Medicme  Molecular  Dagnosrs  of  Genebc  Dseases
E&ted  by  R  Elk  Humana  Press  Inc.  Totowa,  NJ
321
322  Humphries  et  al.
The  SSCP technique  (4)  is a method  capable of  identifying  most sequence
variations  in  a single  strand  of  DNA,  typically  between  150 and  250  nucle-
otides in  length. Under  nondenaturmg  conditions  a single strand of  DNA  will
adopt a conformation  (presumably  dependent on internal  basepairing  between
short segments by  foldback)  that is uniquely  dependent  on its sequence com-
posltion.  This  conformation  usually  will  be different,  if  even  a single  base is
changed. Most  conformations  seem to alter  the physical  configuration  or  size
sufficiently  that,  even  though  the variant  sequence has the same charge, the
configuration-to-charge  (size-to-charge)  ratio  is different  enough  to be detect-
able as a mobility  difference  on electrophoresis through  a retarding  matrix  such
as polyacrylamide  gel. Although  the samples have  been denatured, the buffer
in  the wells  and  nondenaturing  environment  into  which  the  sample concen-
trates  immediately  on  entry  into  the  gel  will  allow  some  double-strand
reannealmg  to  take place,  as well  as adoption  and resolution  of  the  various
single-strand  conformations.  The  considerations  implicit  in  classical  “Cot”
studies of  reannealing  (concentration  of  each single  strand, DNA  complexity,
and time)  apply  (5).
The  “classical”  SSCP protocol  is  a denatured  sample,  [32P]-labeling  for
maximal  detection  sensitivity  in  the diluted  sample and  long  track  length  for
maximal  resolution  of  small mobility  differences  (see Fig.  1). However,  in the
interests of  higher  efficiency  of  detection,  greater  convenience,  or  safety,  a
number  of  studies have  been made using  other protocols.  Restriction  digestion
of  a large PCR fragment  prior  to SSCP has been described (6). Multiplex  PCR
is also possible  and SSCP can be combined  with  allele-specific  PCR  (7,8)  to
select alleles  in  complex  sets (e.g.,  HLA  genes), and can also be  combined
with  dideoxy  chain termination  to localize the approximate position  of  an SSCP
variation  in a sequence (9).
In  SSCP analysis, heteroduplex  bands are often  seen on the gel as a useful
byproduct  of  the procedure  (10). Reannealing  of  double-strand  DNA  has been
discussed herein,  and when  higher  concentrations  of  single-stranded  DNA  are
loaded, for  example, for nonisotopic  detection methods, the double-strand  band
is the predominant  band. For human DNA  (except for  the sex chromosomes in
males),  a  PCR  product  usually  represents  amplification  from  two  alleles,
derived  from  each autosome of  a pair.  When a sequence variation  is present in
the heterozygous  state, the classical  SSCP picture  would  be  of  four  single-
stranded bands, the sense and antisense strands of  the “normal”  allele,  and the
altered mobility  sense and antisense strands of the “variant”  allele. In  addition,
reannealing  to double  strands permits four  possible products, “normal”  double
strand, “variant”  double  strand, and two heteroduplexes (“normal”  sense/“vari-
ant”  antisense; and “normal”  antisense/“variant”  sense). The  heteroduplexes
have  a mismatch  “bubble”  that  often  alters  their  mobilitles  relative  to
Single-Strand  Conformation  Polymorphism  323
EXON  No  1  2  3  4  5
5’11  I  I  I  I
6,7(81  gl  10  11  12  13  14  15  18  17  18
II  I  II  II  I  3
N%-  I  2  3  4  5  6  ollllllllllll C  BOOH
Llgand  Binding  EGF  Precursor  Homology  0-Llnked  cyto-
DOMAIN  Sugars  plasmlc
Signal  Membrane
Peptide  Spanning
Fig.  1. A  map  of  the  LDL-R  protein,  its  mRNA  and  gene.  Vertical  bars  denote  the
exon-exon  junctions  Numbered  boxes  and  circles  denotes  the  cysteine-rich  repeats.
The  primary  coding  sequence  is  2580  nucleotides  long.  The  3’  untranslated  region  is
not  shown  on  the  scale  of  the  figure  (I).
homoduplex,  resulting  in  further  additional  bands  (see  Fig.  2).  The  combined
efficiency  of  SSCP  plus  heteroduplex  analysis  for  detection  of  sequence  varia-
tions should be well  m excess of the 80% estimated for  each technique  consid-
ered individually  (2).
Since RNA  basepairing  is more  stable than  RNA-DNA  basepairing,  RNA
might  be expected to adopt more  conformational  structure and hence be more
sensitive  to sequence changes. Published evidence  suggests that this  is  the  case
(1 I),  with  detection of  up to 95% of variations,  but the inconvenience  of  mak-
ing  RNA  strands (which  involves  the complexity  and expense of  introducing
RNA  polymerase  promoters  and extra reaction  steps) for  SSCP has precluded
widespread  use. For  analysis of  FH, used as a model  system in this chapter, a
suitable  source of  RNA  would  be from  lymphocytes, but success is dependent
on  equal  representation  of  mRNA  levels  from  the normal  and mutant  allele,
and in the presence of premature  stop codons or splice-site mutations this may
not be the case (V.  Gudnasson, unpublished).
1.2. F/i
FH  is  characterized  clinically  by  elevation  in  the  concentration  of  LDL
cholesterol  in blood,  tendon  xanthomata,  and an increased risk of  myocardial
infarction.  It is present in 5-l  0% of  individuals  who  develop  coronary  artery
disease (CAD)  under  the age of  55 yr  in the United  Kingdom  and the United
States (1,12). Based on the estimated population  frequency  of carriers of  l/500,
there are more than  100,000 FH heterozygous individuals  in the United  King-
dom,  of  which  probably  less than  3000  have  been  identified  to  date.  Once
identified,  the hyperlipidemia  of  these patients is responsive  to treatment  by
324  Humphries  et  al.
Fig.  2.  Autoradiograph  of  a double-loaded  SSCP  gel  of  exon  3 of  the  LDL-R  gene.
Exon  3  was amplified  by  PCR  using  primers  flanking  exon  3.  The  sequence of  the  5’
primer  is  5’-TGACACTTCAATCCTGTCTCTTCTG  and for  the  3’  oligonucleotide  S-
ATAGCAAAGGCAGGGCCACACTTAC,  to give  a product  of  172 bp  (4). Oligonucle-
otides  were obtained  from  Genosys. The  amplifications  were performed  in  an automated
thermal  cycler  (Hybaid  Omnigene)  using  Tuq DNA  polymerase  (Gibco  BRL)  in  a total
volume  of 20 PL  and overlaid  with  20 pL  paraffin  oil,  using  previously  described  cycling
conditions  (11).  The  fragment  was labeled  by  PCR  amplification,  with  the  addition  of
[a-32P]  deoxycytosine  triphosphate  (800  Ci/mmol,  10 uCi/pL;  Amersham).  A  quantity
of  5 pL  of the  PCR  mixture  was diluted  with  25  pL  of  0.1%  SDS  and  10 mMEDTA.
Five  microliters  of this  dilution  was mixed  with  5 pL  formamide  dye (95%  formamide,  20
mA4EDTA,  0.05%  bromophenol  blue,  0.05%  xylene  cyanole;  FF).  The  PCR  DNA
was  denatured  by  boiling  at  100°C  for  3  min  and  then  chilled  immediately  on  ice.
Samples  (4 uL)  were loaded  onto  a 4.5%  polyacrylamide  nondenaturing  gel  (ratio  of
acrylamide  to  bisacrylamide  49: 1) in  1X  TBE  buffer,  with  10%  glycerol.  Gels  were
40  cm  x 30 cm  x 0.4 mm.  Electrophoresis  was at 20 mA  for  16 h at room  temperature  on
4.5%  polyacrylamide  gels  with  10%  glycerol.  The  gel  was then  transferred  onto
Whatman  3MM  chromatographic  paper,  dried,  and  exposed  to  hyperfilm  p  max
(Amersham)  for  12-24  h  at -70°C  before  developing.  The  samples  are run  toward  the
anode  (+).  The  single  and  double  strands  of  the  first  and  second  loadings  are  desig-
nated,  respectively,  on  right  and  left,  SSl,  SS2,  and  DS,  the  double  strands  having
migrated  approx  30  cm  and the  single  strands  approx  20  cm  in  the  gel.  SSCP  variants
I  are apparent  in  one  sample  from  the  first  loading  and in  one  from  the  second  loading,
as indicated.
Single-Strand  Conformation  Polymorphism  325
diet  and  drugs  (13),  and  such treatment  reduces  subsequent morbidity  and
mortality  (14).  FH  results  from  different  genetic  defects  in  a  cell  surface
receptor  that  normally  controls  the uptake  of  plasma LDL  (1),  or  in  a small
proportion  of  patients  one particular  defect  in  apolipoprotein  B, the  ligand
for  the receptor  (15).  This  disorder,  which  is called  Familial  Defective  apoB,
has been reported  to  occur  in  about  3% of  FH  patients  in  the  United  King-
dom,  and the mutation  in the apoB  gene causing  it can be detected easily by
PCR  and ASOs  (allele-specific  oligonucleotides).  Children  who  have  inher-
ited two  defective  alleles of  the LDL-R  (homozygous  FH phenotype,  but usu-
ally  compound  heterozygous  for  two  different  defects) represent  l/million  of
the  population.  In  these  children  there  is usually  little  useful  lowermg  of
plasma  LDL-cholesterol  levels  in response to diet  or  drugs, and many suffer
a major  coronary  event  in the  first  or  second decade of  life,  but  life  expect-
ancy can be extended  by appropriate  treatment.  Current  treatment  ts usually
by  plasma  exchange  or  LDL  apheresis,  but  patients  alternatively  may  be
treated  by  transplantation  of  a donor  liver,  possibly  in  conjunction  with  a
heart  transplant  (16).  In  the  future  it may  be possible  to  treat  such children
using  “gene  therapy”  methods  (17).
For many heterozygous FH individuals  a clear diagnosis can be made on the
basis of elevated plasma cholesterol. However,  several studies (18) have  shown
that  measures  of  total  cholesterol  or  LDL  cholesterol  alone  do  not  allow
unequivocal  diagnosis  of  FH  in  1045%  of  cases, even  in  the  children  of  a
parent  with  FH.  It  has been  suggested that a monocyte  or  lymphocyte  assay
may  be a useful  tool  for  identifying  individuals  with  defective  LDL-R  fine-
tion,  and there  are several  reports  of  such methods (19).  However,  there  are
considerable  technical  difficulties  with  these approaches  that  prevent  their
application  for  routine  screening at the present time. In  particular,  as with  all
other  tests used for  diagnosis of  FH,  there  is still  overlap  between  the values
obtained  for  some “normal”  individuals  and patients with  a defect in the recep-
tor, whereas a genetic approach  to identify  LDL-R  defects gives  an unequivo-
cal result. An  additional  concern about  such nongenetic  tests is the frequency
of  false-negative  results,  and  some children  whose  lipid  levels  initially  are
within  the normal  range  for  then  age and gender,  show a greater than average
rise in lipid  levels  over  time, to a point where  it is evident  that they have  inher-
ited the LDL-R  gene mutation  (20). Although  the frequency  of  this problem  is
unknown,  there is no doubt that the equivocal  nature of the tests currently  avail-
able to identify  children  with  FH is one of  the factors that deter some clinicians
from  actively  pursuing  such diagnosis in the relatives  of a patient with  FH. The
advantage  of an unequivocal  DNA  test would  be both to allay fears for  half  the
relatives,  and to identify  children  where  monitoring  dietary  advice  and appro-
priate  therapy  should be started.
326  Humphries  et al.
1.3.  The  LDL-R
and  LDL-R  Gene  Mutations
The  LDL-R  is a membrane  protein  of  839 amino  acids that  is responsible
for  cholesterol  uptake  into  cells  via  receptor-mediated  endocytosis  of
cholesterol-rich  lrpoproteins  secreted by the liver  (I).  The  LDL-R  binds  two
different  ligands,  apoB, which  is the sole apoprotein  of LDL,  and apoE, which
is  found  on  the  triglyceride-rich  lipoprotems  and their  remnants.  Once  the
LDL-R  has bound  a ligand,  it  clusters in coated pits, where  it is taken up  by
the cell,  via  endocytosis. The  ligand  is released from  the receptor  in the lyso-
some and the receptor  is then recycled  to the cell  surface  where  it can bind  a
ligand  again.
The  human LDL-R  gene was cloned and characterized more  than 10 yr  ago
(I).  It  is located  on the short  arm  of  chromosome  19 (~13. I-p13.3),  and  as
shown  in Fig.  1, it  spans 45 kb and comprises  18 exons  and  17 introns.  Five
classes of  mutations  at the LDL-R  locus have  been identified  on the basis of
the phenotypic  behavior  of  the mutant  protein,  and to  date there  have  been
over  200  different  mutations  of  the LDL-R  gene characterized  at the  DNA
level  (21)  and  they  have  given  valuable  insights  into  the  function  of  the
different  domains  in the LDL-R.  Within  a geographically  or  culturally  iso-
lated  population,  or  where  a  large  proportion  of  people  are  related  by
descent because of  migration,  there may be a single  mutation  causing  FH  in
many  of  the patients.  For  example,  in the Christian  Lebanese  one mutation
is  responsible  for  the  disorder  in  98%  of  all  FH  patients,  whereas  in
Afrikaaners  in  South  Africa  three  mutations  are responsible  for  over  95%
of  FH  patients,  with  the most common  mutation  being  found  in  two-thirds
of  all  patients.  In  French-Canadians  a common  founder  deletion  occurs  in
60%  of  FH  patients,  and  in  Finland  two  mutations  account  for  most  FH
(1,2I).  In  the United  Kingdom,  where  there  is a very  heterogeneous  popu-
lation,  a priori  it  is unlikely  that  any  mutations  will  be present  at  a high
frequency,  and  so far  no mutation  detected  has been present  at a frequency
greater  than  2-3%  (22-29).  However,  rt  is of  interest  that  a point  mutation
in  exon  3 of  the  gene was present  in 2%  of  the London  sample,  but  15% of
a sample  of  patients  from  Manchester  (251,  and  therefore  some  muta-
tions  may  be relatively  high  in  certain  local  areas. We  predict  that  there
may  be more  than  100 different  mutations  in the United  Kingdom,  of  which
so far  more  than 20 have  been detected (22-29;  unpublished),  and although
it  would  be  feasible  to  develop  methods  to  screen  for  reported  mutations,
our  calculations  demonstrate  that  it  is more  cost and  time  effective  to use
an approach  that will  enable any mutation  in the LDL-R  gene to be detected,
rather  than  to  screen specifically  for  all  mutations.
Sing/e-Strand  Conformation  Polymorphism  327
1.4. Mutations  in  Repeat  Five
of  the  Ligand  Binding  Domain  of  the  LDL-R
The  first  292 residues of  the receptor  contain seven imperfect  repeats of  40
amino  acids that make up the binding  domain  (1).  Mutational  analysis of  the
binding  domain  (30)  has shown  that repeat one is not required  for  binding  of
either apoB or apoE. Repeats two and three as well  as six and seven are required
for  maximal  binding  of  an apoB-containing  lipoprotein  such as LDL,  but  not
for  apoE  lipoproteins,  and  a naturally  occurring  mutation  in  repeat  four
(S 156L),  abolishes the bmding  of  LDL  but not that of VLDL  (32).  On the other
hand, repeat five  is required  for  both  ligands, and this is encoded by the 3’ end
of  exon 4. We have applied  SSCP to detect mutations in this region  (I7),  and m
3 11 FH patients investigated,  seven different  mutations were  detected m a total
of  29 patients  (9.3%).  Three  of  the mutations  show  very  similar  changes in
mobility  and cannot be distinguished  easily from  each other  by the SSCP pat-
tern alone and need separate tests for  confirmation  (e.g., restriction  digestion,
ASOs, or sequencing).
1.5. Current  Progress  of  SSCP  Analysis  on  FU  Research
With  the modifications  in  sample handling  described m this chapter, it  has
been possible to screen DNA  from  800 FH patients for  mutations in the LDL-R
at the rate  of  one exon per  week, which  occupies 3.5 research assistant days/
week. The LDL-R  gene has 18 exons, and pairs of oligonucleotides  and amphfi-
cation conditions  have  been reported  (II),  which  allow  the amplification  of  the
promoter  plus coding portions of  the entire gene in 20 fragments  (exon 4 has to
be  amplified  in two  parts owing  to its size). In  all  cases the amplifymg  oligo-
nucleotides are complementary to intron  sequences, which  therefore  also allow
comparison  of  the intron-exon  boundary junction  in patients, where  mutations
may cause defects m correct splicing  of nuclear RNA.  This has resulted m more
than  170  SSCP variants  identified  at a rate  of  l O-12/wk.  The  frequency  of
detected SSCPs in the different  exons of  the gene is shown in Fig. 3.
1.6. Future  Developments
in  SSCP  Mutation  Screening  for  FH
Some  patients  will  have  no  defect  identified  by  the  SSCP technique,
although  published  data (20)  suggests the sensitivity  of the method is extremely
high  (SO-go%).  Some patients may have  a major  deletion  or rearrangement  of
the gene, and in the English population  the frequency of  gross alterations (inser-
tions  and deletions)  is approx  5% (13).  Many  of  these gross alterations  have
occurred  because of  recombination  between  repetitive  Alu  type elements, and
detailed  analysis  indicates  nonhomologous  recombmation  involving  Ah
sequences as the  mechanism  of  the  rearrangements.  In  the LDL-R  gene the
deletions and insertions described are distributed over  the whole  of  the gene,  so
328  Humphries  et  al.
60,
181  SSCPs  in 50
u)  779  samples  (23%)
4  40
8
z  30
5
s  20
B
10
0
Prom1  2  3  4  5  6  7  8  9  10  11  12  13  14  16  16  17  18
Exons  of  the  LDL-receptor  gene
Fig. 3. Frequency of detected SSCPs in the LDL-R  gene in 779 UK  patients with
FH. *,  SSCP interpretation difficult  because of two common polymorphisms. From
Day et al., in preparation.
there  are no  isolated  hotspots that  could  be  used to  develop  a  simple  rapid
strategy for  gross rearrangement  detection. When  screening large numbers  of
patients for  mutations  in  the LDL-R  gene, Southern blotting  will  become the
last line  of  investigation  after  identification  of  point  mutations  by  faster  and
easier means, such as SSCP. In the case of  already known  rearrangement, PCR-
based tests can be constructed to identify  patients with  that particular  mutation.
These PCR-based tests may also eventually  replace Southern blotting  for  assays
for  gene rearrangement,  analogous with  methods established for  the dystrophin
(Duchenne)  gene (32)  (see Chapter  2).
At  the present time the majority  of  detected mutations are novel,  indicating
that general  screening methods such as SSCP will  continue to be useful  for  FH
for  some time. However,  it can be seen from  Fig. 3 that in patients in the United
Kingdom,  roughly  30% of all detected SSCPs occur in exon 4 and 18% in exon
3. This  suggests that a useful  strategy will  be to focus on exons 3 and 4. This
would  lead to the rapid  detection of the specific mutation  in  10% of patients. In
other  parts  of  the world  where  founder  mutations  have  been identified,  or  in
the United  Kingdom  if  common mutations  or  “region-specific”  mutations  are
detected, it is possible that, as with  mutations  causing thalassemia, a targeted,
or  sequential  approach to specific  mutation  testing will  be useful  in the future
(see Chapter  9).
Single-Strand  Conformation  Polymorphism  329
2.  Materials
2.1.  PCR
1.  Tug  DNA  polymerase  (Gibco,  Paisley,  UK)  Stored  at -20°C.
2.  1X  Taq DNA  polymerase  reaction  buffer:  10 mMTris-HCl,  pH  8  3,50  mMKC1,
0.001%  gelatin,  0.2  mA4  dATP,  0.2  mM  dGTP,  0.2  rmI4  dTTP,  and  0 02  mA4
dCTP.  10X  stock  is prepared  and  stored  in  aliquots  at -20°C.
3.  MgClz  IS kept  as stock  of 50  mM  in  aliquots  at -2O’C.
4.  W-l  (“detergent”  from  Gibco)  stored  at -20°C.
5.  Redivue  [32P]-o,dCTP  (Amersham,  Amersham,  UK)  stored  at 4’C.
6.  Oligonucleotide  pnmers  (Genosys).  Store  in  ahquots  at -20°C.
7  Paraffin  oil  (light  liquid,  BDH,  London,  UK)
2.2.  Gel  Running
1.  30%  Polyacrylamide  gel  solution  with  bts acrylamide  to  acrylamrde  ratio  of  1:49.
(Severn  Biotech  Ltd,  UK).  Store  at 4°C.
2.  TEMED  (N,N,N’,N’-tetramethylethylenediamine)  (BDH).  Store at 4°C  m  the dark.
3.  25%  Ammonium  persulfate  (BDH).
4.  Glycerol.
5  Formamide  dye mix:  95%  formamide,  10 mMEDTA,  0.025%  bromophenol  blue,
0.025%  xylene  cyan01 FF.
6.  0.1%  (w/v)  Sodium  dodecylsulfate  (SDS)  containing  10 mM  EDTA
7.  10X  TBE*  0.89M  T&base,  0.89M  boric  acid,  20  mM  EDTA,  pH  8.0.
8.  Repelcote  (BDH).
3. Methods
3.1.  Rapid  Throughput  Modifications  for  Sample  Handling
We  have  made  several  major  improvements  m  the  techniques  used  for
sample  handling  that allow  SSCP or  other  such mutation  analyses to be car-
ried  out  in  an extremely  rapid  manner  (33,34).  Tube  handling  and  labeling
time  has been reduced by  storing  DNA  from  individual  patients  in  a 96-well
format.  These  arrays  can  easily  be  “replicated”  20-30  times  in  96-well
microtiter  plates,  for  subsequent PCR amplification  and mutation  screening
or  other  genotyping.  The  use  of  96-well  microtiter  arrays  and  compatible
multichannel  devrces  are well  established  for  cell  culture  and for  analytical
reactions.  There  is no  labeling  of  tubes and the plate  is also the storage  rack
(with  identity  of  sample being  related  to  its position  in  the array).  The  stor-
age of  many  such  plates,  each  containing  a  small  volume  of  pre-PCR  tem-
plate in  refrigerators  or freezers is inconvenient  and expensive.  To  overcome
this problem,  we allow  the DNA  templates to dry overnight  at room  tempera-
ture  and  store all  such plates at room  temperature.  There  are the  additional
330  Humphries  et  al.
advantages  that  because the  template  DNA  is dry,  it  has no  volume  to  be
taken  mto  account when  setting up the PCR  reaction  and it  also reduces the
probability  of  cross-contamination  when  using  an  automatic  multrpipet  to
ahquot  the PCR mix.  Several  wells  are left  empty  of  DNA  in  each array,  so
that cross-contamination  can be monitored  and control  samples can be added
when  necessary. In  several  months  using  this  procedure  we  have  not  found
any  cross-contammation.  For  samples  from  which  repeated  and  different
PCRs will  be undertaken,  this enormously  reduces staff  time and reduces the
requnement  for  laboratory  equipment  for  storage.  We  routmely  adjust  the
DNA  concentration  in  the master array  to an average  of  16 ng/pL  water,  so
that to obtain  40 ng dried  DNA  requires  repeated ptpeting  of  2.5~pL  aliquots
using  multichannel  plpets:  It  is much easier to pipet  repeatedly  2.5 pL  rather
than  1 PL  of  a more  concentrated  stock using  standard  trps and  2.5  PL  is a
small  enough  volume  to dry  in a few  hours on standing  at room  temperature.
Twenty  rephcas  from  one master  array,  consummg  96  tips  m  total  rather
than  20  x  96  tips,  can  be  prepared  with  an  eight-channel  pipet  by  one
worker  m 2 h.  Storage  of  pre-PCR  dried  plates at room  temperature  makes
it possible  to prepare  many  identical  replicas  m  advance,  where  many  dif-
ferent  PCRs are planned  from  a given  master array,  whereas advance  prepa-
ration  of  replicas  would  not  be  possible  if  there  were  a requirement  for
refrigeration  or  freezing.
The  setup of  these PCRs is extremely  simple,  in  that the sample has zero
volume,  so that unless the exact quantity  of  template DNA  is critical,  any vol-
ume of  a PCR master mix containing  all components except template DNA  can
be added to the well.  The coefficient  of variation  introduced  by prpetmg  1s also
minimized.  Thus,  as well  as ease of  setup, robustness to drop-out  of  PCRs is
improved.  The  making  and distributing  of  a PCR mix  and oil  to all  wells  of  a
dried  plate  using  a repeating  dispenser takes one worker  approx  10 min.  We
have  also recently  described, for  PCR  checking  and other  analyses, a system
for  preparing,  and  stacking  open-faced  horizontal  polyacrylamide  gels,  in
which  the wells  retain the 96-well  array (microtiter  array diagonal  gel electro-
phoresis, MADGE)  (3.5; Chapter  16).
3.2. All  Exon  SSCP  Screen
In  some situations, we wish  to undertake  a large number  of  different  PCRs
simultaneously  on the same DNA  sample or on a small set, e.g., samples from
four  newly  diagnosed  FH  patients.  Instead  of  drying  a different  template  in
each well,  drying  a  different  premixed  pan  of  PCR  primers  in  each well  is
Single-Strand  Conformation  Polymorphism  331
Fig.  4. Electrophoresis  of PCR  products  from  four  independent  human  DNAs,  using
dried  arrays  of  PCR  primer  pairs.  The  PCR  products  are electrophoresed  under  stan-
dard  SSCP  technique  conditions  and  are grouped  by  PCR.  It  can be noted  that  almost
all  PCR  reactions  yielded  PCR  product.  The  lowermost  band  represents  double-
stranded  DNA,  the  upper  bands  represent  single  strands:  There  are polymorphisms  or
mutations  in  the  third,  fourth,  and  seventh  sets of  PCR  reactions  counting  from  the
left.  Note  SSCP  arrow  indicating  Ex2  SSCP.
equally  efficient  in PCR yield.  This  suggests that little  of  the oligonucleotide  is
irreversibly  bound  to  the  plastic.  The  PCR  premix  is arranged  to  contain  a
template DNA  instead of  a primer  pair,  and an example of an SSCP autoradio-
graph  from  the  simplified  setup of  21  PCRs  from  the  LDL-R  gene  in  four
patients with  familial  hypercholesterolemia  is shown in Fig.  4. Typical  PCRs
in this laboratory  are set up in  a volume  of  20  pL,  using 40 ng template DNA
and  8 picomoles  of  each PCR primer.  Eight  pmol  of  a 20-mer  primer  repre-
sents approx  48 ng,  so that a dried  DNA  template  plate  contains 40 ng DNA
per  well,  a  dried  primer-pair  plate  contains  96  ng  oligonucleotide  per  well.
Thus,  on a weight  basis, the layer of  DNA  dried  onto the plastic is of  the same
order  for  the two  strategies.
332  Humphries  et al.
3.3.  PCR  Setup
Using  Microtiter  Arrays  of  Dried  Template  DNA
1.  Dilute  DNA  samples  to  a concentration  of  approx  10 ng/pL  in  0.5  yL  m  96-well
arrays.  This  forms  the  master  plate.
2.  Transfer  2.5  pL  of  this  to  96-well  microtiter  plates  (Hybaid  Omnigene,  UK,
microtiter  plates  for  PCR)  using  an eight-channel  multipipet.  Many  copies  from
the  master  plate  can be made,  left  to  dry  overnight,  and  stored  at room  tempera-
ture  for  future  use.
3.4 . Minimization  of  32P Usage
1.  Make  up a modified  PCR  polymerase  mix  containing  one-tenth  the usual  concen-
tration  of dCTP  (0.2  mM  dATP  and  so forth,  0.02  mA4 dCTP).  This  may  be used
m  conlunction  with  a lo-fold  reduction  in  the concentration  of  [a-32P]dCTP  com-
pared  with  earlier  protocols  (14,19)
2  Prepare  the  complete  polymerase  mix  including  oligonucleotides,  Taq  poly-
merase,  deoxynucleotides,  buffer,  W 1, and  radioisotope  for  distribution  into  the
wells  of plates  containing  dried  DNA  templates.
3.  Perform  the  amplifications  in  an  automated  thermal  cycler  (Hybaid  Omnigene)
using  Thermus  Aquaticus  (Taq)  DNA  polymerase  (Gibco  BRL)  m  a total  volume
of  20  pL  and overlay  with  20  pL  paraffin  oil,  using  previously  described  cycling
conditions  (II)  (see Note  1).
3.5.  SSCP  Double  Gel  Setup
1.  Pour  two  gels  between  one  large  glass  sequencing  plate  (33  x  42  cm)  and  two
outer  smaller  plates  (33  x 39 cm),  so that  the two  gels  can be subjected  to  electro-
phoresis  simultaneously  on  one  apparatus  (see  Note  2).  The  three  plates  are
defined:  “lowest,”  which  is  the  large  plate  and  the  outermost  one  when  the
arrangement  is clamped  to  the  vertical  electrophoresis  apparatus;  “middle;”  and
“uppermost  ”  The  terms  refer  to  the  plates  as arranged  horizontally  on  a leveling
table  for  gel  pourmg.
2.  Prior  to  gel  pouring,  silanize  the  four  glass  faces which  will  contact  the  gel  with
Repelcote.
3.  Spread  2 mL  evenly  over the  surface with  the edge  of another  glass plate.  Arrange
the  plates  with  their  sides  aligned,  with  a pan  of  0.4  x  10  x  400  mm  spacers
supportmg  the  sides  of both  the  middle  and uppermost  glass  plates.  The  edge  of
the middle  plate  that will  contact the bottom  gel tank  is arranged to be recessed 5 mm
relative  to  the  other  plates.  This  leaves  a 5-mm  “platform”  at the  top,  which  bet-
ter  facilitates  the  msertion  of the  comb  for  the  upper  gel.
4.  Clamp  the  three  plates  at the  sides with  bulldog  clips.
5.  Pour  the  bottom  gel  (on  the  large  plate)  first  (by  injection  between  the  plates
using  a large  syringe,  with  firm  tapping  to  avoid  the  formation  of bubbles  during
pouring).
6.  Insert  the  comb  and  leave  the  gel  to  set for  30-60  mm.
Single-Strand  Conformation  Polymorphism  333
7.  Prepare  the  second  gel  in  an  identical  manner.  The  gels  can  be  stored  for  sev-
eral  days  with  TBE-saturated  tissues  and  cling  film  covering  the  ends.  Care
must  be  taken  when  clamping  the  gels  to  the  apparatus  to  ensure  that  no  au
bubbles  are trapped  in  the  recess between  outermost  and  innermost  plates  in  the
bottom  tank.
3.6.  SSCP  Analysis  on  Nondenaturing  Gels
1.  Add  2  pL  of  the  PCR  product  to  12 pL  of a 7:5  ratio  mix  of  formamide  dye  mix
and  a solution  of  0.1%  (w/v)  SDS  containmg  10 mM  EDTA.
2.  Denature  the  amplified  DNA  sample  at  95’C  for  5 min  and  chill  immediately  on
wet  ice  (see  Note  3).  Load  7.5  pL  samples  on  to  a  7  5%  polyacrylamide
nondenaturing  gel  (ratio  of  acrylamide  to  bisacrylamide  of  49:l)  in  1X  TBE
buffer  with  5%  glycerol,  10 mA4EDTA.  Gels  were 40  cm  x  30  cm  x  0 4 mm.
3.  Conduct  electrophoresis  at a constant  voltage  of 200  V  overnight  at room  tempera-
ture  (usually  2 l-25°C)  (but  see Note  4)  until  the  xylene  cyan01 migrates  20  cm.
4.  Transfer  the  gels  onto  Whatman  3MM  chromatographtc  paper,  dry,  and  expose
to  Hyperfilm  p max  (Amersham,  Maidstone,  UK)  for  l-4  d  at -70°C  with  one
intensifying  screen before  developmg  the  film  (see Note  5).
3.7.  Double  Loading  Gels
1.  After  first  loading  the  gel,  the  samples  are  electrophoresed  at  400  V  until  the
bromophenol  blue  runs 2.5-3  cm,  at which  point  the electrophoresis  may  be stopped
and  a second  set of  SSCP  samples  loaded  in  the  same  way  as the  first  samples.
2.  Before  loading  the  second  time,  the  sharktooth  comb  must  be removed  and repo-
sitioned  half  a  well  across  from  its  orlginal  pontion.  This  enables  the  first  and
second  loading  bands  to  be distmguished  more  easily  (see Note  6).
3.8.  Sharktooth  Comb
1.  Sharktooth  combs  are custom  cut  with  4.5~mm  spacing  tooth-to-tooth  to  enable
the  use of a multichannel  pipet  compatible  with  microtiter  plates  (g-mm  well-to-
well  spacing)  for  loading  the  SSCP  gels.  This  results  in  every  second well  being
loaded  with  a  multichannel  plpet  so  that  two  adjacent  columns  or  rows  of  a
microtiter  plate  are  interleaved  when  loading  (see Note  6).
4.  Notes
1.  Single-strand  length:  The  optimal  length  of  single  strand  seems  to  be  approx
150-200  nt (36).  In  this  size range  70-90%  of single  base substitutions  are appar-
ent  on  SSCPs.  Presumably,  longer  strands exhibit  relatively  less conformational
change  by a single  base substitution,  and  shorter  strands adopt  less complex  con-
formations.  On  average,  the  reverse  complement  of  a  particular  four-base
sequence  will  occur  once every  4  x 4 x 4 x 4 =  256  nucleotides:  Thus,  it  would  be
expected  that  a PCR  single  strand  would  contain  quite  a few possible  sequences
to  form  four-base  double-stranded  stems,  but  few  stems  of  significantly  longer
perfect-match  duplexes.  Such  segments  would  be  expected  to  melt  and  hence
334  Humphries  et  al.
lose any sequence-specific  conformation  below  the melting  temperatures  (25-35OC)
at  which  lO-15-mer  oligonucleotides  dissociate  from  their  target  (37).  The
behavior  of stem-loop  folds  would  also be  expected  to  depend  on  guanosme  plus
cytosme  content,  since  the  three  hydrogen  bond  basepair,  GC,  is  more  stable  to
temperature  than  the  two  hydrogen  bond  basepair,  AT.  We  have  observed  that
for  exon  4  mutations  in  the  LDL-R  gene,  mobility  shifts  are  more  frequently
apparent  in  the  upper  strand.  One  explanation  for  this  might  be  that  the  faster
migrating  single  strand,  which  IS  assumed  to  be  more  compact,  has  sufficient
stability  not  to  be  so markedly  affected  by  a  base  change  at  the  temperatures
used.  A  better  understanding  of  these factors  would  be  of  value  m  order  to  make
predictive  analyses of  specific  sequences and maximize  the mutation  detection  effi-
ciency  of SSCP  in  a fashion  similar  to  the preplanning  of DGGE  expenments  (38).
2.  Effect  of temperature:  Several  studtes have reported  the  use of different  tempera-
ture  running  conditions  for  SSCP,  and typical  conditrons  are either  at room  tem-
perature,  or 4°C  with  5  or  10%  glycerol.  As  drscussed earlier,  the  small  regions
of  basepairing  that  are responsrble  for the  conformation  of the  single  strands  and
thus  the  potential  polymorphisms  are  likely  to  have  a meltmg  temperature  at  or
below  the  UK  average  room  temperature,  and  our  experience  is  that  during  hot
weather  the migration  of bands  changes considerably  such that  certain  SSCPs  are
no  longer  detected.  The  use  of  4°C  standardizes  these  conditions,  but  although
we have not  systematically  investigated  the effect  of temperature  control  on band
sharpness  or  detection  rate  of  SSCPs,  we and  others  have  not  found  many  addr-
tlonal  SSCPs  in  samples  run  at other  than  our  standard  conditions  (39,40).  Gels
are routinely  run  at 5 V/cm  overnight  at “room”  temperature  in  an an  conditroned
room,  which  is typically  approx  22’C,  wtth  temperature  fluctuations  between  20
and  25°C.  At  this  voltage,  power  per  gel  is  about  4 W,  and  gel  warming  is insig-
nificant  A  more  expensive  option  would  be the  use of  a water-jacketed  gel  plate
with  a circulating  water  bath.
3.  PCR  product  denaturation:  For  convenience,  PCR  products  are  used  without
purification,  but  spurious  bands may  result  rf the  number  of cycles  is excessive  or
if  there  is  excessrve residual  primer  whtch  may  anneal  to  single  strands  (41).
Using  high  detection  sensitivity  for  DNA  (i.e.,  32P) the  number  of  PCR  reaction
cycles  can  be  reduced  (e.g.,  to  20)  and  the  sample  can  be  diluted  lO-30-fold,
which  will  minimize  annealing  between  single  strands  or  between  single  strands
and PCR  oligonucleotides.  However,  if less sensitive  detection  methods  are to be
used  (see the following)  less dilution  is possible  and  stronger  denaturants  added
to the sample  may  help.  Formamide,  sodium  hydroxide,  urea, and methylmercurm
hydroxide  have  been  used  (42).  Although  toxic  and  requiring  a  fume  hood,
methylmercuric  hydroxide  appears  to  be  the  most  effective.  Most  protocols
involve  heating  the  sample,  immediate  chilling  on ice,  then  loading  onto  an appa-
ratus  of  temperature  between  4  and  25°C.  A  top  layer  of  gel  with  formamide
Incorporated  has  also  been  proposed  to  aid  sample  denaturation  (43),  but  this
does  not  avoid  the  strand  reanneahng  that  will  take  place  when the  single  strands
first  enter  the  nondenaturing  gel.
Single-Strand  Conformation  Polymorphism  335
4.  Characteristics  of the  gel:  Polyacrylamide  is the  commonly  used matrix  for  DNA
fragments  in  the  SSCP  size  range.  The  ratio  of  acrylamide  to  bw-acrylamide
crosslinker,  and the  total  acrylamide  concentration,  determines  the  sievmg  prop-
erties  of the  gel,  The  buffer  conductivity  and  concentratton  also  mfluence  SSCP
mobility,  as do  gel  temperature  and  other  additives  such as glycerol.  Several  pub-
lications  have  detailed  the  different  effects  that  these  conditrons  can  have  on
resolvmg  a  particular  sequence  variation.  Reduced  crosslinker  ratio  (his:
acrylamide  1:49)  and  5-10%  (v/v)  glycerol  are popular  (441, although  other  pro-
tocols  such as high  percentage  gels can be useful  (‘45). We  have  found  (Gudnason,
unpublished)  that  the  latter  is true  for  a 340  bp  PCR  fragment  representmg  the  5’
end of  exon 4  of the  LDL-R  gene. However,  there  1s no adequate  theoretrcal  basis
to  explain  the  substantial  influence  of  particular  conditions  in  resolving  certain
SSCPs  although  some  studies  of  folding  and  single-strand  mobrlity  have  been
performed  under  nondenaturmg  and  denaturing  conditrons  (46,47).  Hydrolink  is
an  acrylamide-like  matrix  polymerized  by  TEMED  and  ammomum  persulfate,
which  is  reported  to  have  a more  uniform  pore  size  and  is  claimed  to  give  nar-
rower  bands  and  hence  better  resolution  than  acrylamide  (27).
Reported  gel  lengths  range  between  5 and  50  cm  At  present,  most  results  are
read  by  eye  and  therefore  visible  resolution  is  necessary.  Although  clearcut
mobility  shifts  (e.g.,  10%)  are demonstrable  on  short  gels,  a long  electrophoresrs
may  be  necessary  to  resolve  a 0.5%  mobility  difference.  Long  electrophoresis
has  the  disadvantages  that  it  needs  a  large  apparatus,  a  higher  voltage  power
pack,  and more  complex  arrangements  to  set up  and control  temperature.  A  longer
run  broadens  a band  in  accord  with  basic  theory  (effects  of  an  imperfect  matrix
and  diffusion)  and  this  may  be  compounded  for  SSCP  without  proper  tempera-
ture  control  (i.e.,  nonuniform  conformation  and  hence  nonumform  mobrlity).
Nevertheless,  where  it  is  important  to  avoid  false-negative  results,  long  track
length  is advisable.
5.  Detection  methods  for  SSCP  single  strands:  Autoradiography  of  dried  gels  for
32P  incorporated  during  PCR  as  [a-32P]dNTP  (or  by  [Y-~~P]ATP  end-labeling
primers  (or  PCR  product)  involves  the  hazards  and  inconvenience  of  radioiso-
tope  usage.  The  main  options  that  have  been  explored  are silver  staining  (48,49)
and  ethidium  bromide  fluorescence  (43)  Ethidmm  bromide  intercalates  with  5-l  O-
fold  higher  affinity  in  double-stranded  DNA,  and  is therefore  not  well  suited  to
smgle-strand  detection.  Nevertheless,  ethidium  bromide  staining  is  a  one-step
process  and conditrons  to  load  sufficient  smgle-strand  DNA  have  been  achieved
(42,43).  Sensitive  srlver  staining  protocols  are available  for  DNA,  with  detection
down  to  I-10  pg/mm2  (50).  The  catalytic  process  of silver  reduction  IS initiated
on DNA  bases. A  typical  protocol  involves  depositron  of  silver  nitrate  on  bands,
then  reduction  of  silver  by  formaldehyde  and  sodium  carbonate  to  give  a brown
color  (see Chapter  3 for  protocol).  The  reaction  IS stopped  by  acetic  acid.
Large  gels  (e.g.,  30  x  40  x  0.04  cm  are  difficult  to  handle  for  postelectro-
phoretic  staining.  Binding  the  gel  to  one  glass  plate  with  y-methacryloxy-
propyltrimethoxysilane  is  used  for  silver  staining,  but  this  renders  gel  recovery
336  Humphries  et  al.
(as a dried  image  on  Whatman  3 MM  paper)  very  difficult.  A  photographrc  film
based process  can take  a direct  imprint  from  the  gel  while  amplifymg  the  signal
(Promega  Corp.,  Southampton,  UK).  We  find  that  our  staining  protocol  can  be
used, with  complete  adherence  of the gel  to  a glass plate,  using  4 pL/cm*  of QS%
y-methacryloxypropyltnmethoxysilane/OS%  glacial  acetic  acid/ethanol,  and that
the  gel  can then  be  reliably  recovered  onto  Whatman  3  MM  paper.  The  smgle-
strand  band  intensity  depends  on PCR  fragment  sequence and  size (some  reanneal
more  readily  than  others)  and  tends  to  be  faint.
A  further  possibility,  not  yet  fully  explored  is  to  blot  the  gel,  most  conve-
niently  by  “direct  blotting.”  DNA  is  electrophoresed  off  the end  of  the  gel  onto  a
revolving  blot  (51)  and  then  one  of  the  several  methods  of  detection  by  hybrtd-
ization  is used.
Automated  DNA  sequencers  perform  electrophoresis  and  detection  on  gels
similar  to manual  sequencing  gels. However,  the detection  system  is usually  fluo-
rescence  either  using  oligonucleotides  wtth  fluorescent  labels  attached,  or incor-
porating  fluorescent  nucleotide  analysis  during  polymerase  reactions.  It  has been
shown  that  such  apparatus  also  can  be applied  to  SSCP  using  fluorescent  labels
(52).  The  arguments  pertinent  to  throughput,  sensitivity  of detection,  and  resolu-
tion  are stmrlar  to  those  for  automated  sequencing  (53).  The  main  shortfalls  are
that  one  sequencer  can only  run  one gel  at a time;  that  there  is high  capital  expen-
dtture;  that  access to  “primary  data”  1s impossible  if  computer  corrections  for the
differential  effect  of different  dyes on mobility  are involved;  and  that  there  is the
need  for  additional  sophisticated  workstations  for  secondary  editing  and  inter-
pretation  of  the  data.
6.  The  first  and  second  loading  single  and  double  strands  need  to  be  nonover-
lapping  if  the  gel  1s to  be  informative.  The  calculation  of  the  timing  of  the
second  loading  is  possible  if  the  relative  mobilities  of  the  two  single  strands,
one  double  strand,  and  marker  dyes are already  known  for  the  set of conditions
to  be  used.  These  mobilities  may  be  determined  in  a  prior  experiment  with
single  loading.  In  order  that  repetitive  loading  can be  applied  both  to  the  same
and  different  exons,  we have  prepared  a  computer  stmulatron  that  solves  the
equations  relating  relative  mobilities,  boundary  conditions  including  timing  of
loading,  range  of migration  distance  desired  and  time  delays  between  loadings
(available  from  G.  P.  Weavind,  73064,3063@compuserve.com  by  e-mail
request).  Double  loading  the  gel  means  that  a whole  96-well  mrcrotiter  array  of
samples  may  be  analyzed  on  one  gel.
Acknowledgments
I.  N.  M.  Day  is  the  recipient  of  a  British  Heart  Foundation  Intermediate
Fellowship.  S.  E.  Humpbries  is  supported  by  a Chair  award  and  Program  grant
RG  16  from  the  British  Heart  Foundation,  and  V.  Gudnason  by  the  Icelandic
Council  of  Science.  The  work  was  also  supported  by  the  Sir  Halley  Stewart
Trust,  Helen  Eppel  Fund,  and  John  Pinto  Foundation.
Single-Strand  Conformation  Polymorphism  337
References
1.  Goldstein,  J.  L.  and  Brown,  M.  S. (1989)  Familial  hypercholesterolemia,  in  The
Metabolic  Basis  ofInherited  Disease,  6th  ed. (Striver,  C. R.,  Beaudet,  A.  L.,  Sly,
W.  W.,  and  Valle,  D.,  eds.),  McGraw-Hill,  New  York,  pp.  1215-1250.
2.  Cotton,  R.  G.  H.  (1993)  Current  methods  of mutation  detection.  Mutat.  Res.  285,
125-144.
3.  Condie,  A.,  Eeles,  R.,  Borreson,  A.-L.,  Coles,  C.,  Cooper,  C.,  and  Prosser,  J.
(1993)  Detection  of point  mutations  in  the  P53  gene:  comparison  of  smgle-stand
conformation  polymorphism,  constant  denaturant  gel  electrophoresis,  and
hydroxylamine  and  osmium  tetroxide  techniques.  Hum.  Mutat.  2,58-66.
4.  Orita,  M.,  Suzuki,  Y.,  Sekiya,  T.,  and  Hayashi,  K.  (1989)  Rapid  and  sensitive
detection  of point  mutations  and DNA  polymorphisms  using  the polymerase  chain
reaction.  Genomics  5,874-879.
5.  B&ten,  R.  J.  and  Davidson,  E.  H.  (1985)  Hybridisation  strategy,  in  Nucleic  Acid
Hybridlsatzon:  A Practical  Approach  (Hames,  B.  D.  and  Higgins,  S. J.,  eds.), IRL
Press,  Oxford,  UK,  pp.  3-15.
6.  Lee,  H.-H.,  Lo,  W.-J,  and  Choo,  K.-B.  (1992)  Mutational  analysis  by  a  com-
bined  application  of  the  multiple  restriction  fragment-single  strand  conformation
polymorphism  and  the  direct  linear  amplification  DNA  sequencing  protocols.
Anal.  Blochem. 205,289-293.
7.  Suzuki,  Y.,  Seklya,  T.,  and  Hayashi,  K.  (1991)  Allele-specific  polymerase  cham
reaction:  a method  for  amplification  and  sequence  determination  of a single  com-
ponent  among  a mixture  of  sequence  variants.  Anal.  Biochem. 192,82-84.
8.  Lo,  Y.-M.  D.,  Patel,  P.,  Mehal,  W.  Z.,  Fleming,  K.  A.,  Bell,  J. I.,  and  Wainscoat,
J. S. (1992)  Analysis  of complex  genetic  systems  by  ARMS-SSCP.  application  to
HLA  genotypmg.  Nucleic Acids Res. 20, 1005-1009.
9.  Sarkar,  G.,  Yoon,  H.-S.,  and Sommer,  S. S. (1992)  Dideoxy  fingerprinting  (ddF):
a rapid  and  efficient  screen for the  presence  of mutations.  Genomacs 13,441-443.
10.  Keen,  J., Lester, D., Inglebeam,  C., Curtis, A., and Bhattacharya,  S. (1991) Rapid  detec-
tion  of single  base mismatches  as heteroduplexes on Hydrolink  gels. Trends Genet. 7,5.
11.  Sarkar,  G.,  Yoon,  H  -S.,  and  Sommer,  S.  S.  (1992)  Screening  for  mutations  by
RNA  single-strand  conformation  polymorphism  (rSSCP):  comparison  with  DNA-
SSCP.  Nucleic Acids Res. 20, 871-878.
12.  Patterson,  D.  and  Slack,  J. (1972)  Lipid  abnormalities  in  male  and  female  survi-
vors  of myocardial  infarction  and their  first  degree  relatives.  Lancet i,  1393-l  399.
13.  Betteridge,  D.  J.,  Dodson,  P.  M.,  Durrington,  P.  N.,  Hughes,  E.  A.,  Laker,  M.  F.,
Nicholls,  D.  P.,  et  al.  (1993)  Management  of  hyperlipidaemia:  guidelines  of  the
British  Hyperlipidaemia  Association.  Postgrad. Med.  J.  69,35%369.
14.  Kane,  J. P.,  Malloy,  M.  J., Ports,  T.  A.,  Phillips,  N.  R.,  Diehl,  J. C.,  and  Havel,  R.
J.  (1990)  Regression  of  coronary  atherosclerosis  during  treatment  of  familial
hypercholesterolemia  with  combined  drug regimens.  JAMA  264,3007-3012.
15.  Tybjaerg-Hansen,  A.  and  Humphries,  S. (1992)  Familial  defectrve  apolipoprotein
B- 100:  a single  mutation  that  causes hypercholesterolaemia  and  premature  coro-
nary  artery  disease.  Atherosclerosis 96,91-l  07.
338  Humphries  et al.
16.  Starzl,  T.  E.,  Bilheimer,  D.  W.,  Bahnson,  H.  T.,  Hardesty,  R  L.,  Griffith,  B.  T.,
Iwatsuki,  S.,  et  al.  (1984)  Heart-liver  transplantation  in  a patient  with  famthal
hypercholesterolaemia.  Lance&  23,  1382,1383.
17.  Grossman,  M.,  Raper,  S. E.,  Kozarsky,  K.,  Stein,  E.  A.,  Engelhardt,  J. F.,  Muller,
D.,  et al.  (1994)  Successful  ex vzvo gene  therapy  directed  to  liver  m  a patient  with
familial  hypercholesterolaemia.  Nat.  Genet.  6,335-341
18  Leonard,  J.  V.,  Whitelaw,  A.  G.  L.,  Wolff,  0.  H.,  Lloyd,  J.  K  ,  and  Slack,  J.
(1977)  Diagnosing  FH  in  children  by  measuring  serum  cholesterol.  Br.  Med.  J,  i,
1566-1568.
19.  Schmitz,  G.,  Bruning,  T.,  Kovacs,  E.,  and  Barlage,  S. (1993)  Fluorescence  flow
cytometry  of  human  leukocytes  in  the  detection  of  LDL  receptor  defects  in  the
differential  diagnosis  of hypercholesterolemia.  Arterioscl.  Thromb.  13,  1053-1065.
20.  Kesslmg,  A.  M.,  Seed,  M.,  Taylor,  R.,  Wynn,  V.,  and  Humphries,  S.  E  (1990)
Rismg  cholesterol  levels  m  children  with  famrhal  hypercholesterolaemia.  Biomed
Pharmacother.  44,373-379.
2 1  Hobbs,  H.  H.,  Brown,  M  S., and  Goldstein,  J. L.  (1992)  Molecular  genetics  of the
LDL  receptor  gene in  familial  hypercholesterolaemia.  Hum.  Mutat.  1,44%+66.
22.  King-Underwood,  L.,  Gudnason,  V.,  Humphries,  S.,  Seed,  M.,  Patel,  D.,  Knight,
B  , et  al.  (199 1) Identification  of  the  664  proline  to  leucme  mutation  m  the  low
density  hpoprotein  receptor  in  four  unrelated  patients  with  famihal  hypercholes-
terolaemia  m  the  UK.  Clzn.  Genet.  40,  17-28.
23.  Sun,  X.-M.,  Webb,  J. C.,  Gudnason,  V.,  Humphries,  S.,  Seed, M.,  Thompson,  G.
R.,  Knight,  B.  L.,  and  Soutar,  A.  K.  (1992)  Characterization  of  deletions  in  the
LDL  receptor  gene in patients  with  FH  m  the UK.  Arterzoscl  Thromb  12,762-770.
24.  Gudnason,  V.,  Kmg-Underwood,  L.,  Seed,  M.,  Sun,  X-M.,  Soutar,  A.  K  ,  and
Humphries,  S. E. (1993)  Identification  of recurrent  and novel  mutations  in  exon  4
of LDL  receptor  gene  m patients  with  familial  hypercholesterolaemia  in  the United
Kingdom.  Arterzoscl  Thromb.  13,6-63.
25  Webb,  J  C.,  Sun,  X.-M.,  Patel,  D.  D.,  McCarthy,  S. N.,  Knight,  B.  L.,  and  Soutar,
A.  K.  (1992)  Characterisation  of two  new point  mutations  m  the  low  density  lipo-
protein  (LDL)  receptor  genes  of  an  English  patient  wrth  homozygous  familial
hypercholesterolemia.  J  Lzpzd Res.  33,  689-698.
26.  Gudnason,  V.,  Mak,  Y.-T.,  Betteridge,  J.,  McCarthy,  S. N.,  and  Humphries,  S
(1993)  Use  of  the  single  strand  conformatronal  polymorphism  method  to  detect
recurrent  and  novel  mutations  in  the  low  density  lipoprotein  receptor  gene  in
patients  with  familial  hypercholesterolaemia:  detection  of  a  novel  mutation
Asp200 +  Gly.  Clin.  Invest  71,33  1-337.
27.  Gudnason,  V.,  Day,  I  , and Humphries,  S. E.  (1994)  Effect  on plasma  lipid  levels
of  mutations  in  exon  4  of  the  low-density  hpoprotem  receptor  gene  in  patients
with  familial  hypercholesterolaemia.  Arterioscl  Thromb.  14,  17 17-I  72 1.
28.  Sun,  X.-M.,  Patel,  D.  D.,  Bhatnagar,  D.,  Knight,  B.  L.,  and  Soutar,  A.K.  (1995)
Characterization  of  a splice-site  mutation  in  the  gene  for the  LDL  receptor  assocr-
ated  with  an unpredictably  severe clinical  phenotype  in  English  patients  with  het-
erozygous  FH.  Arterioscl  Thromb.  15,219-227.
Single-Strand  Conformation  Polymorphism  339
29.  Graham,  C. A.,  Ward,  A.  J., Nevin,  N.  C.,  Trinick,  T.,Young,  I.,  O’Kane,  M.,  and
Nicholls,  D.  P.  (1995)  Automated  sequencing  has identified  70%  of  mutations  in
30  patients  with  familial  hypercholesterolaemia  in  Northern  Ireland.  AtheroscEe-
rosls  112,261-267.
30.  Esser,  V.,  Limbird,  L.  E.,  Brown,  M.  S.,  Goldstein,  J.  L  ,  and  Russell,  D.  W.
(1988)  Mutational  analysis  of the  ligand  binding  domain  of  the  low  density  lipo-
protein  receptor.  J.  Biol.  Chem.  263,  13,282-13,290.
3 1.  Hobbs,  H.  H.,  Leltersdorf,  E., Leffert,  C. C., Cryer, D. R., Brown,  M.  S., and Goldstein,
J. L.  (1989)  Evtdence  for a dominant  gene that  suppresses hypercholesterolemia  in  a
family  with  defective  low  density  lipoprotein  receptors. J.  Clm.  Invest.  84,656–6&k
32.  Chamberlain,  J.  S., Gibbs,  R.  A.,  Ranier,  J. E.,  Nguyen,  P.  N.,  and  Caskey,  C.  T.
(1988)  Deletion  screening  of the  Duchenne  muscular  dystrophy  locus  via  multi-
plex  DNA  amplification.  Nuclezc  Acids  Res.  16,  11,141-l  1,156.
33.  Whittall,  R.,  Gudnason,  V.,  Weavind,  G.,  Day,  L.  B.,  Humphries,  S., and  Day,  I.
N.  M.  (1995)  Utilities  for high  throughput  use of the  single  strand  conformational
polymorphism  method:  screening  of  791  patients  with  familial  hypercholes-
terolaemia  for mutations  in  exon  3 of the  low  density  lipoprotein  receptor  gene. J,
Med.  Genet.,  32,509-5  15.
34.  Day,  I.  N.  M.,  Whittall,  R.,  Gundason,  V.,  and  Humphries,  S.  E.  (1995)  Dried
template  DNA,  and  dried  PCR  oligonucleottdes  and  marlmg  in  96-well  plates:
LDL  receptor  gene  mutatton  screening.  BioTechniques  18,981-984.
35.  Day,  I.  N.  M.  and  Humphries,  S.  E.  (1994)  Electrophoresis  for  genotyping:
microtitre  array diagonal  gel  electrophorests  (MADGE)  on hortzontal  polyacryla-
mide  (H-PAGE)  gels,  Hydrolink  or  agarose. Anal.  Biochem  222,389-395.
36.  Sheffield,  V.  C.,  Beck,  J.  S., Kwitek,  A.  E.,  Sandstrom,  D.  W.,  and  Stone,  E.  M.
(1993)  The  sensitivity  of  single-strand  conformation  polymorphism  analysis  for
the  detection  of  single  base  substitutions.  Genomics  16,325-332.
37.  Wood,  W  I.,  Gitschier,  J.,  Lasky,  L.  A.,  and  Lawn,  R.  M.  (1985)  Base  composi-
tion  independent  hybridization  in  tetramethylammonium  chloride:  a method  for
oligonucleotide  screening  of highly  complex  gene libraries.  Proc  Natl  Acad  Scz.
USA  82,1585-1588
38  Cariello,  N.  F.  and  Skopek,  T.  R.  (1993)  Mutational  analysis  using  denaturing
gradient  gel  electrophoresis  and PCR.  Mutut  Res.  288,  103-l  12.
39.  Leren,  T.  P.,  Solberg,  K.,  Rodningen,  0.  K.,  Rosby,  O.,  Tonstad,  S., Ose, L.,  et al.
(1993)  Screening  for  point  mutations  in  exon  10  of  the  low  density  lipoprotein
receptor  gene  by  analysis  of  single-strand  conformation  polymorphisms:  detec-
tion  of  a nonsense  mutation-FH469  +  Stop.  Hum.  Genet.  92,6-10.
40.  Sekiya,  T.  (1993).  Detection  of  mutant  sequences by  single-strand  conformation
polymorphism  analysis.  Mutat.  Res.  288,79-83.
41.  Cai,  Q.-Q.  and  Touitou,  I.  (1993)  Excess  PCR  primers  may  dramatically  affect
SSCP  efficiency.  Nucleic  Acids  Res.  21,3909,3910.
42.  Hongyo,  T.,  Buzard,  G.  S.,  Calve&  R.  J.,  and  Weghorst,  C.  M.  (1993)  “Cold
SSCP”:  a simple,  rapid  and  non-radioactive  method  for  optimized  single-strand
conformation  polymorphtsm  analyses.  Nucleic  Acids  Res  21,3637-3642.
340  Humphries  et  al.
43.  Yap,  E.  P.  H.  and  McGee,  J.  0.  (1993)  Nonisotoptc  discontinuous  phase  single
strand  conformation  polymorphism  (DP-SSCP):  genetic  profiling  of  D-loop  of
human  mitochondrial  (mt)  DNA.  Genomes  21,4155.
44.  Spmardi,  L.,  Mazars,  R.,  and Theillet,  C.  (1991)  Protocols  for  an improved  detec-
tion  of  pomt  mutations  by  SSCP.  Nucleic  Acids  Res  19,4009.
45.  Savov,  A.,  Angehcheva,  D.,  Jordanova,  A.,  Eigel,  A.,  and  Kalaydjieva,  L.  (1992)
High  percentage  acrylamide  gels  improve  resolution  in  SSCP  analysis.  Nucleic
Aads  Res.  20,674  1,6742.
46.  Baxter,  S.  M.,  Greizerstein,  M  B.,  Kushlan,  D.  M.,  and  Ashley,  G.  W  (1993)
Conformational  properties  of DNA  hairpins  with  TTT  and TTTT  loops.  Biochem-
istry  32,8702-87  11.
47.  Mayer,  P.,  Slater,  G.  W.,  and Drouin,  G.  (1993)  Exact  behavtour  of single-stranded
DNA  electrophoretic  mobilities  in  polyacrylamtde  gels.  Appl.  Theoret.  Electro-
phor  3,145-155.
48.  Ainsworth,  P  J., Surh,  L.  C.,  and Coulter-Mackte,  M.  B.  (1991)  Diagnostic  single
strand  conformatronal  polymorphism,  (SSCP):  a  simplified  non-radioisotopic
method  as applied  to  a Tay-Sachs  Bl  variant.  Nucleic  Acids  Res.  19,405,406.
49  Mohabeer,  A  J.,  Hiti,  A.  L.,  and  Martin,  W.  J.  (1991)  Non-radioacttve  single
strand  conformation  polymorphtsm  (SSCP)  using  the  Pharmacia  “PhastSystem.”
Nucleic  Acids  Res.  19,3  154.
50.  Bassam,  B.  J.,  Caetano-Anolles,  G.,  and  Gresshoff,  P.  M.  (1991)  Fast  and  sensr-
tive  silver  staining  of DNA  in  polyacrylamrde  gels. Anal  Blochem.  196,  8&83.
5 1.  Beck,  S.  and  Pohl,  F.  M.  (1984)  DNA  sequencing  with  direct  blotting  electro-
phoresis.  EMBO.  J.  3,2905-2909.
52.  Elhson,  J  ,  Dean,  M.,  and  Goldman,  D.  (1993)  Efficacy  of  fluorescence-based
PCR-SSCP  for  detection  of  point  mutattons.  BioTechmques  l&684-691
53.  Yang,  M.  M.  and  Youvan,  D.  C.  (1989)  A prospectus  for multispectral-multiplex
DNA  sequencing.  Biotechnology  7,576-58  1.
Quality  Assurance  in  Molecular  Diagnosis
The  UK  Experience
Susan  A.  R. Stenhouse  and  Helen  Middleton-Price
1.  Introduction
Molecular  genetic diagnosis is a relatively  young  discipline  and also one of
the fastest growing  among clinical  laboratory  sciences. The  majority  of  diag-
nostic  laboratories  in  this  field  emerged  from  groups  active  in  research  into
human  genetic  disease, and  the  development  of  a service-oriented  structure
from  more loosely  organized research laboratories was the first  priority  for  the
provision  of  an  efficient  diagnostic  service.  In  April  1988,  the  Clinical
Molecular  Genetics Society (CMGS)  was constituted as the professional  body
representing molecular  geneticists working  in a diagnostic capacity in the United
Kingdom  (UK).  This  organization quickly  saw the need for  a central system of
external  quality  assurance (EQA),  and  a subcommittee was set up to establish
such a scheme.
The  first  trial  of  EQA took place in  199 1 and required  simple genotyping  of
DNA  samples for  three disorders: Duchenne muscular dystrophy  (DMD),  cys-
tic fibrosis  (CF),  and Huntington  disease (HD).  The majority  of laboratories  in
the UK  offering  a service  for  these diseases participated  in  the scheme. In  the
second trial  in  1993, CF, DMD,  and fragile  X  syndrome (FRAXA)  were  cov-
ered. The  scheme was expanded  on this occasion to  include  interpretation  of
the results  with  risk  calculations  and  recommendations  for  further  analysis,
which  were  submitted  in the form  of  a full  clinical  report.
Encouraged  by the success of  these trials, the EQA  subcommittee applied  to
the UK  Department  of  Health  for  funding  of  a Z-yr  pilot  project  with  a view
toward  moving  to a subscription-based  scheme at the end of  that period.  This
application  was successful and the CMGS  EQA  subcommittee  was reconsti-
From.  Methods  m  Molecular  Medicine.  Molecular  Diagnosis  of  Gene&  Diseases
Edlted  by:  R  Elles  Humana  Press  Inc.,  Totowa,  NJ
347
342  Stenhouse  and  Middleton-Price
tuted as an independent  body  known  as the steering committee  for  Molecular
Genetics External  Quality  Assurance (MGEQA),  since independence from  the
professional  organization  is required  for  formal  recognition  by the Department
of  Health.  In  1994, the first  pilot  scheme was established for  five  disorders:
DMD,  CF, HD,  FRAXA,  and myotonic dystrophy (distroplia  myotonica  [DM]).
2.  Structure  of  EQA  Schemes  in  the  United  Kingdom
Most clinical  laboratory  disciplines  are subject to EQA  and participation  m
such a scheme is generally  required  for  laboratory  accreditation.  EQA schemes
in the UK  are overseen  at the highest level  by the Joint Working  Group,  which
is comprised  of  representatives  from  the professional  organizations  of  all  the
pathology  laboratory  sciences and members of  the Royal  College  of  Patholo-
gists.  The  Joint  Working  Group  approves  each EQA  scheme  and  reports
directly  to the government  via  the Secretary of  State for  Health. Advisory  pan-
els for  individual  disciplines  constitute the next level  of  management, and the
Chairs  of  the  Advisory  Panels report  directly  to  the  Joint  Working  Group
regarding  the progress of  individual  schemes. Advisory  panels are composed of
experts in the field,  and their primary  function  1s to deal with  poor  performance
and to advise  the scheme organizers. The  steering committee  of  the MGEQA
plans the structure of  the EQA  scheme, devises the questions, and supplies the
DNA  samples. It  is also responsible  for  the scoring  of  final  reports,
The  scheme organizer  is responsible  for  the practical  administration  of  the
EQA and is the main direct contact with participating laboratories. A key function
of  the  scheme organizer  is to maintain  the anonymity  of  the individual  labo-
ratories, which  are otherwise identified  by numerical  code. He or she is respon-
sible for  sample distribution  and receipt of final  reports. Any  queries or problems
related to the EQA are directed through  the scheme organizer. Figure  1 outlines
the overall  structure of  clinical  laboratory  external EQA  schemes in the UK.
3.  Present  Scheme
The  UK  scheme currently  involves  37 participating  laboratories,  including
recently  8 in  the Netherlands  and  1 in  the Republic  of  Ireland.  Laboratories
may choose from  eight diseases offered:  DMD,  CF, FRAXA,  HD,  DM,  Prader-
Willi/Angelman  syndromes  (PWS/AS),  familial  adenomatous  polyposis  coli
(FAP),  and  spinal  muscular  atrophy  (SMA).  There  are two  sample distribu-
tions per year with  four  disorders  covered  in each distribution.
Samples and relevant  clinical  details are provided  by members of  the steer-
ing  committee  and distributed  to all  participating  laboratories  by the scheme
organizer.  The EQA  samples are supplied  with  a clinical  request as if  referred
by a clinician.  Each will  require  either direct mutation  testing or the analysis of
linked  markers,  but  the choice  of  the  appropriate  test is normally  left  to  the
individual  laboratory.  Four  or  five  DNA  samples  are  provided  for  each
Quality  Assurance  343
Fig.  1. Structure of clinical laboratory EQA schemes in the UK. -,  Direct interac-
tion; —, interaction through observers.
disorder,  and they  may  be a family  group  or  single  individuals.  Results and
reports must be returned  to the scheme organizer within  6 wk and are identified
by  a number  code. Only  the scheme organizer  knows  the identity  of  the indi-
vidual  laboratories.
Performance  is assessed on two  levels,  correct genotyping  and appropriate
interpretation.  Clear  criteria  for  the scoring  of  each disorder  are agreed to by
the  steering  committee.  The  individual  who  supplied  the  samples and  posed
the  clinical  request  marks  the  returns  first  before  passing them  to  a second
committee  member for  independent  scoring using the same agreed on criteria.
Discrepancies  in the scoring are discussed and resolved  by the full  committee.
The  scoring  system is described in full  in this chapter.
Feedback to the participating  laboratories is provided  annually after the second
sample distribution.  Each center will  receive  a general  overview  of the returns
and an anonymous  table of  results, including  the scoring  criteria  plus specific
comments from  assessors on the individual  performance  of  their  laboratory.
At  every  stage in the development  of  the EQA  scheme, the choice of  disor-
ders has reflected  those that are most commonly  offered  in diagnostic  service,
and EQA  is now  provided  for  all  disorders  which  are tested for  in  more  than
eight  laboratories  in the UK.  However,  some disorders  are so rare or  special-
ized that  only  a few  centers offer  testing.  It  will  not  be possible  to  provide
comprehensive  EQA  for  such conditions,  but the MGEQA  steering committee
intends to coordinate  transfer  of  samples between the laboratories  involved  in
order  to give  a measure of  EQA.
344  Stenhouse  and  Middleton-Price
4.  Scoring
In  contrast  to  many  other  pathology  disciplines,  reports  from  molecular
genetics laboratories  in  the UK  are expected to  contain  a full  interpretation
of  the  results  in  addition  to  raw  genotyping  data. Most  referring  clinicians
require  the addition  of  an explanatory  paragraph  or two  interpreting  the data
in concise English. In  order to reflect this, each report is scored for  the accuracy
of the genotype  data and for  the presence of  a number  of  interpretative  points,
which  are judged  by  the  MGEQA  steering  committee  to  be  elements  of  a
good  report.
The  marking  scheme is best illustrated  by  an example.  In  the  1994 EQA,
DNA  samples were provided  from  a family  in which  there was an isolated case
of  Becker  muscular  dystrophy  (BMD)  (Fig.  2).  Sufficient  DNA  was provided
for  polymerase chain reaction (PCR)-based analysis, but not for  Southern blots.
Laboratories  were  asked to write  reports  for  individuals  BMDl  and BMD3,
who  wished  to know  their  carrier  status, and BMD4,  who  is affected.
DNA  analysis  should  have  shown  a  deletion  of  exons  45-47  of  the
dystrophin  gene in  BMD4.  BMD  1 was homozygous/hemizygous  at the (CA)n
marker  locus STR45  from  within  the deleted region,  whereas BMD3  was het-
erozygous at STR45. In addition,  there had been a recombination  5’ to the dele-
tion between BMDl  and BMD3  or between BMDl  and BMD4.  The most likely
approach  to  the  problem  would  be  a multiplex  deletion  screen followed  by
analysis with  markers from  within  and flanking  the deletion.
The  genotyping  data were  scored as follows:
Correct  genotypes  2  Marks
Correct  but  incomplete  genotypes  1 Mark
One  or  more  incorrect  genotypes  0  Marks
A  report  written  followmg  this  analysis ideally  should  have  contained  the
following  five  interpretative  points:
1.  BMD4  was deleted  for  exons  45-47  of  the  dystrophin  gene.
2.  BMD3  was heterozygous  at STR45  from  within  the  deleted  region  and was, there-
fore,  at very  low  risk  of being  a carrier  of BMD.
3.  BMD  1 was either  homozygous  or hemrzygous  at  STR45  from  within  the  deleted
region,  and  her  carrier  status could  not  be resolved  by  this  analysis  alone.
4.  A  calculation  of  BMDl’s  carrter  risk  (90%  on  pedigree  alone,  which  rises  if  an
estimate  of the  likelihood  of  homozygosity  at  STR45  in  BMDl  is  included).
5.  A  suggestion  of  further  analyses  (e.g.,  pulsed-field  gel  electrophoreses  [PFGE],
fluorescent  in  situ  hybridization  [FISH],  dosage  densitometry),  which  would
resolve  the  carrier  status  m  BMD  1.
A report that contained four  to five  of  these points was awarded 2 marks, one
containing  two  to three was awarded  1 mark, and a report  with  one or no points
Quality  Assurance  345
BMDl  BMD2
0
-T-
cl
d
BMD3  BMD4
Fig. 2. DNA  samples of BMD.
was awarded  0 marks.  These  interpretative  points  assumed that  laboratories
adopted the most likely  approach to the analysis. The scheme must be adaptable,
however,  and should accommodate alternative  ways of  tackling any problem.  In
fact, one laboratory  analyzed the BMD  pedigree by PCR-based dosage densito-
metry using an automated fluorescent sequencer, which  gave the correct answer
for  BMD3  and also allowed  the carrier status of  BMDl  to be resolved.  Clearly,
this report  received  full  marks for  the genotype data and interpretation.
The  level  of  interpretation  required  will  vary  depending on the clinical  ques-
tion and type of analysis involved.  In some cases, increased flexibility  was intro-
duced by using half  marks. The criteria  necessary for  a full  interpretation  of each
report are agreed to by the steering committee, and each report is marked indepen-
dently by two  committee members. The  anonymity of  laboratories is maintained
throughout  since the markers have access only to the laboratory  number  code.
Scores are  reported  back  to  the  steering  committee  for  validation  before
results are returned  to the laboratories.  In the future,  the style and clarity  of  the
final  report  will  also be considered with  a view  toward  establishing  minimum
criteria  for  reporting.
The object of using this sort of criteria-based  marking  scheme was to reduce
the  subjective  nature  of  the process as far  as possible  and  to  allow  average
performance  for  each disease to  be  calculated.  Circulation  of  the  collected
results for  all laboratories  and diseases is, of  course, anonymous,  and although
it should not in any way be considered a league table, it does allow  a laboratory
to check that its standard of  reporting  is acceptable compared to the average.
Publication  of the criteria  used in the scoring can provide  guidance to laborato-
ries for  the future,  as well  as making  the steering committee accountable to the
participating  laboratories  to some extent.
EQA  schemes in other countries seem to follow  broadly  similar  approaches,
although  the College  of American  Pathologists EQA scheme puts more empha-
sis on  interpretation  and  less on  DNA  analysis.  In  the  American  scheme
346  Stenhouse  and  Middleton-Price
samples are sent out as cell pellets for  DNA  extraction.  In  the EQA  scheme for
Australia  and New  Zealand,  returns are scored on time taken to issue the report,
accuracy of clerical  information,  accuracy of genotype, and appropriateness  of
comment  of  report.  Anonymous  scores are distributed  in  a similar  way  to the
UK  MGEQA  (G.  Suther,  personal  communication).  The  UK  MGEQA  is
attempting to cover  all aspects of laboratory  work  and reporting,  although  speed
of  reporting  has not been addressed and is discussed in Section 8.
5.  Performance
In  general,  the quality  of  results and reports  submitted  for  EQA.  EQA  has
been very  good, with  most laboratories  achieving  a high  degree of  accuracy in
genotyping  and  appropriate  interpretation.  Where  problems  have  arisen,  the
laboratory  concerned has been approached informally  by the scheme organizer
offering  advice  and, where appropriate,  practical help. The primary  function  of
the advisory  panel  is to deal with  persistent poor  performance,  a problem  that
has not yet been encountered.  This  would  involve  a more  formal  approach  to
the head of  the laboratory  concerned. In  the future,  satisfactory performance  in
an approved  EQA  scheme is likely  to be a prerequisite  for  molecular  genetic
laboratory  accreditation.  In  the UK  National  Health  Service,  the purchasing
agencies for  health care may also provide  pressure on laboratories  to maintain
high  standards, one measure of  which  is EQA  performance  scores.
6. Topic-Based  Discussion  Meetings
One  of  the most  successful aspects of  the  MGEQA  scheme has been  the
introduction  of  topic-based  discussion meetings. These have  been held  either
in  response to  demand  from  the participating  laboratories  or  following  new
developments  in the field.
Disease-based meetings  allow  current  practice  to  be discussed and  agree-
ment to be reached on a common approach to service provision.  Such meetings
can be particularly  helpful  for  laboratories  wishing  to expand their  service  to
include  the  disease in  question.  Technique-based  meetings  can also be  very
useful  for  the evaluation  of  a new  method  or piece of  equipment  with  advice
available  from  scientists with  experience of  its use. Discussion meetings have
been  held  on  DMD,  CF,  DM,  HD,  SMA,  FAP,  FRAXA,  hereditary  non-
polyposis  colon  cancer (HNPCC),  internal  quality  control  (QC),  and fluores-
cent DNA  analysis.
Following  many  of  these meetings and in  light  of  the discussion there,  the
steering  committee  has drawn  up  consensus guidelines  for  many  aspects of
service provision,  including  “best practice”  for  individual  diseases and internal
QA.  These are distributed  to  all participating  laboratories  and have  helped  to
ensure a high  quality  of  diagnostic  service throughout  the UK.
Quality  Assurance  347
7. Bench-Level  QC
Participation  m external  QC schemes is intended  to assist molecular  genet-
ics laboratories  to  monitor  their  performance  by  providing  an  independent
assessment of  results and reporting.  Internal  QC refers  to the additional  meas-
ures that should be in place in each laboratory  to maintain  the highest possible
standard of  service.  The  following  guidelines  were  drawn  up following  a dis-
cussion meeting  on internal  QC.
7.1.  Specimen  Reception
Care  should  be taken  to ensure that specimens are received  and stored  in
such a way that the chance of  errors and mix-ups  is minimized.  The  laboratory
should  ideally  have  a designated reception  area that is clear of  other  activities
or apparatus. Logging  in of  specimens includes responsibility  for  checking that
the condition  of  the specimen is suitable (i.e., whether  the tube is intact, if  the
sample  is  clotted,  whether  the  blood  volume  is  sufficient  for  the proposed
analysis, and so on)  that the details on the form  and specimen container  (usu-
ally  a blood  tube)  are complete, and that the referral  is appropriate.  Unlabeled
or  incompletely  labeled  specimens should  not be accepted. The  operator  log-
ging  in  specimens should also be responsible  for  drawing  the attention  of  the
referring  clinician  to the need for  a further/different  specimen if  appropriate.
At this stage, the specimen is usually  given  a sample reference  number,  which
is then  used throughout  the subsequent analysis. Many  laboratories  find  that
the use of  printed  numbered  labels helps to reduce transcription  errors,
7.2.  DNA  Extraction
It  could  be argued  that DNA  extraction  is the most critical  stage of  sample
handling;  an error  here cannot be rectified  at a later stage and may be difficult
to detect. Consideration  should therefore  be given  to the employment  of rigor-
ous checking procedures  at this stage.
The  greatest chance for  error at DNA  extraction  is associated with  the trans-
fers  that must necessarily occur  during  preparation,  Some laboratories  prefer
to  use a  DNA  extraction  method  that  avoids  phenol/chloroform  extraction
steps, improving  the  safety  of  the  procedure,  and  cutting  down  on  sample
transfer.  Other  laboratories  have  opted  for  DNA  extraction  machines,  which
minimize  operator handling.  When appropriate,  these techniques may be com-
bined  with  an independent  checking  system where  the checker observes  each
transfer,  which  is signed and witnessed as correct.
7.3.  DNA  Storage
DNA  samples for  storage should carry at least the unique  identifier  (labora-
tory number)  as well  as the name of  the individual  on the tube. Other  appropri-
348  Stenhouse  and  Middleton-Price
ate information  to add to the tube is the date of birth,  date of preparation,  or any
additional  data that would  assist in tracing  the sample through  the laboratory.
Efforts  should be made to store duplicate  samples or at least a blood  spot at a
separate location  in  order  to  protect  this  valuable  resource  in  case of  fire  or
other mishap. Special care should be taken to label samples fully  when  sending
them to another  laboratory.
7.4.  Laboratory  Handling  of  DNA  Samples
In  order  to  minimize  errors  during  analysis,  sample  transfers  should  be
reduced  to  a minimum,  and  systematic tube  handling  procedures  employed.
Some laboratories  have  extended the independent checker system to all sample
handlmg  procedures,  including  PCR  setup, restriction  enzyme digestion,  and
gel loadmg.  This  1s not a substitute for  careful  work,  which  is still  required,  but
it does provide  evidence  of  the care taken.
7.5.  Control  Size  Markers  and  Gel  Orientation
Most molecular  genetics diagnostic procedures involve  running  samples on
agarose or polyacrylamide  gel  systems. Molecular-weight  markers,  negative
controls,  normal  male  and/or  female  samples, and specific  mutation  controls
should  always  be used when  appropriate.  Since gels, particularly  polyacryla-
mide gels, can be inverted,  it is wise to incorporate  a vacant track or some other
method that ~111 allow  unambiguous  orientation  of the gel. The MGEQA  steer-
ing committee  has been active  in obtaining  standard-size markers, available  to
all  laboratories  for  use as controls  in specific  diseases, such as DM  and HD.
7.6.  Checking  of  Results  for  Reporting
Results  should  always  be read  independently  by  two  scientists who  must
agree  on  their  suitability  for  reporting.  It  is recommended  that  results  are
graded  according  to their  quality.  A  suggested scheme grades as follows:  (1)
a clear  result;  (2)  a less good,  but  reportable  result;  and  (3)  a failure.  Final
reports  should be independently  checked when  all data, including  the referral
sheet, experimental  details, raw  data, and risk calculattons,  should  be scruti-
nized.  Final  reports  should  carry  the  signatures  of  the scienttst who  carried
out  the analysis  and wrote  the report,  and also of  the  scientist who  checked
the report.
7.7.  Paternity  Testing
Where  family  relationships  are different  from  those indicated  by the pedi-
gree, this is often uncovered  by chance in the course of  a family  analysis. How-
ever,  correct paternity  should only be specifically  tested for  when  it is vital  for
the inference  of  the genotype  in an individual  or fetus.
Quality  Assurance  349
7.8. Maternal  Contamination  of  Chorionic  Vi//us  Biopsy  (CVB)
The  contamination  of  fetal  material  with  maternal  cells  could  result  in  a
genotyping  error  at prenatal  diagnosis. This  is only  a consideration  when  the
fetus  shows  an identical  genotype  to that in the mother.  Such results  should
be checked by using  highly  polymorphic  repeat markers to confirm  the pres-
ence of  one maternal  and one paternal  allele  in the fetal  material.
7.9. Audit  Trail  and  Standard  Protocols
Audit  trail  refers  to the efficient  storage of  information  on each individual
sample so that information  on its passage through  the laboratory  from  recep-
tion  to report  can be easily retrieved.  This issue will  be highlighted  as laborato-
ries seek accreditation,  at which  time they will  have to expose their  systems for
recording  and tracing  samples to inspection.  In  addition,  laboratories  will  be
expected to keep accessible, up-to-date  standard protocols  for  each analysis, so
that quality  of  service  can be maintained  regardless of  the operator.
8.  Future  Issues
8.1. Reporting  Times
In  the present EQA  system, 6 wk  are allowed  between  sample distribution
and submission  of  returns. This  recognizes the fact that EQA  testing  must be
fitted  around  the routine  work  of  the laboratory  and cannot  take precedence
over  urgent  diagnostic  requests. However,  reporting  time  is an important  ele-
ment  of  a service  and should  be measured. One way  would  be to  establish a
national  average  reporting  time  for  each disorder  as a guideline.  Laboratories
could  then be asked to calculate the percentage of  samples reported  within  this
time. This  is certainly  an issue that will  need to be addressed, since it  IS likely
to be a requirement  as evidence  of  the quality  of  service.
8.2.  EQA  for  Rare  Diseases
The  question  of  rare  diseases analyzed  in  a few  specialized  centers  has
already  been  mentioned  briefly.  One  way  to  address this  issue would  be  to
exchange samples between  the laboratories  involved,  which  may be centrally
coordinated  by  the MGEQA  steering committee.  Involvement  of  other  coun-
tries in Europe would  be helpful  in this respect in order to give  a broader  popu-
lation  base and the potential  to assess more diseases.
8.3. Size  of  the  EQA  Scheme
At  present in  the UK,  only  four  participating  laboratories  test for  all  eight
diseases offered  in the EQA  scheme, and so will  receive  the maximum  number
of  samples; FRAXA  is the most commonly  tested disorder  with  3 1 laboratories
350  Stenhouse  and  Middleton-Price
offering  diagnosis,  and  FAP  is the least common  with  only  10 participating
laboratories.  The  eventual  size of  the scheme will  be determined  in part by the
proportion  of  laboratory  work  load  that  can be devoted  to  EQA.  Even  for  a
large  laboratory,  the  EQA  for  HD  probably  represents as much  as 540%  of
the  annual  work  load  for  this  disease, and  this  would  be  accentuated  for  a
smaller laboratory.  This  is very  different  from  EQA  m chemical pathology,  for
example, which  represents a much smaller proportion  of  the annual work  load.
A  balance  must be  found  between  adequate EQA  and excessive interference
with  routine  diagnostic  work.  As more  diseases become amenable to molecu-
lar  diagnosis,  the EQA  scheme will  need to  adapt, perhaps by  not  testing  all
diseases every  year or by offering  a more flexible  time-scale for  the analysis of
a larger  number  of  diseases. The  availability  and quality  of  DNA  samples for
EQA  testing  are already  an issue as the scheme expands both  in  numbers  of
participating  laboratories  and  the  range  of  diseases covered.  This  may  be
addressed  by  establishing  cell  lines  from  suitable  patient  samples  after
informed  consent. This  will  require  additional  resources and facilities  for  mam-
tenance of  cell  lines, extraction  of  DNA  from  cells, and validation  testing  of
the final  samples. Such developments  will  also be more complex to administer
efficiently,  and  will  require  full-time  technical  and  clerical  support  for  the
EQA  scheme.
8.4.  Assessors
The  work  involved  m  administration  and  execution  of  the  MGEQA  has
increased considerably  over  the years of  its operation,  The  MGEQA  steering
committee has been solely rebponsible for  all aspects of the scheme. In  order to
spread this  responsibility  more  widely,  it  has been proposed  that  a panel  of
assessors be recruited  from  senior  laboratory  scientists from  around  the UK.
These independent  assessors would  score the anonymous reports  according  to
criteria  agreed on by the steering committee, and their  scores would  finally  be
ratified  by that committee.
8.5.  Cost  of  EQA
In  its first  2 yr, the financial  cost of  the QA was met entirely  by the CMGS.
The  pilot  scheme was funded  by the UK  Department  of  Health.  At  the end of
the 2-yr  pilot  study, the  scheme will  become self-financing,  and this  will  be
achieved  by  setting  a charge per  disease with  partictpatmg  laboratories  sub-
scriptions  being  dependent on how  many diseases they offer.
In  setting the subscriptron rate, the cost of technical and clerical  support will
have  to be taken into  account to allow  further  development  of  the  scheme as
outlined  in  Section 8.3. EQA  subscription  costs will  also have  to be taken into
account when  laboratories  are setting their  annual budgets.
Quality  Assurance  351
8.6.  Adoption  of  Common  Standards  and  Reporting  Systems
It  is clearly  desirable  that  the minimum  service  offered  by  all  molecular
genetics laboratories  should be consistent and standardized as far  as possible.
Although  all  laboratories  offering  testing  for  a  disorder  should  provide  the
accepted minimum  service,  specialist laboratories  will  offer  a more  extensive
service  in their  field  of  expertise and accept referrals  from  outside  their  own
normal  catchment population.  To  try to establish minimum  service  provision,
the MGEQA  steering committee has produced a guidelines  booklet with  details
of  the most useful markers for  the various  diseases, recombination  frequencies
where  appropriate,  and suggested best practice for  the analysis of families.  The
guidelines  also provide  recommendations  for  sample labeling  and internal  QC.
Much  of  the  information  in  this  booklet  was  gained  during  disease-based
meetings with  the participating  laboratories  and is regularly  updated in light  of
new developments.
Recommendations  for  the basic elements of  a good  report  are also included
in the guidelines.  MGEQA  feedback to laboratories  included  critical  appraisal
of  the report  format  with  the emphasis on ensuring  clear, concise, and unam-
biguous  information,  and  the  inclusion  of  pedigree  structure  where  this  is
appropriate.  Local  preference  and protocols  from  individual  clinical  teams will
mean that  true  standardization  will  never  be  achieved,  but  information  pro-
vided  by MGEQA  should encourage a convergence  to best practice.
8.7.  Expansion  of  the  UK  EQA  Scheme  in  Europe
In  1995, eight  molecular  genetics laboratories  from  The  Netherlands  and
one from  the Republic  of Ireland  participated  in the UK  MGEQA.  This  was the
first  time that laboratories  outside the UK  had been involved  in the scheme and
resulted  from  the absence of  any similar  facility  in continental  Europe.
In  1994, the European  Concerted Action  on Cystic Fibrosis initiated  a qual-
ity-control  study for  CF only, which  was coordinated by  Jean-Jaques Cassiman
of  Leuven.  Sixty-nine  laboratories throughout  Europe were invited  to take part,
and 40 of  these agreed, 22 of  which  were in the UK.  Nine  DNA  samples were
provided  for  CF mutation  analysis with  no additional  information.  Distribution
of  these samples within  the UK  was organized by the MGEQA  steering com-
mittee. A  summary of the results was published  in the autumn of  1994 (2)  and
also sent out to the participating  laboratories,  but no comments were  included.
This  was an exercise that provided  some lessons for  both  the organizers  and
the laboratories  and the results show that there is a need for  some formal  EQA
throughout  Europe  (2).  The  best way  to organize  a European  EQA  scheme is
not clear, but some of  the problems  involved  can be anticipated.
The  use of  a common  language  for  written  EQA  reports  would  be inappro-
priate, but language differences  would  have to be overcome.  For disorders  like
352  Stenhouse  and  Middleton-Price
CF  m  which  the most  common  mutattons  are routinely  sought,  laboratories
Europe-wide  may screen for  a very  different  spectrum of  mutations  according
to  the prevalence  in  their  population.  Within  the UK,  MGEQA  provision  of
adequate DNA  samples of uniform  quality  for  all the participating  laboratories
has proven  to be problematic,  and this would  be exacerbated if  a single  scheme
attempted to cover  the whole  of  Europe.
One approach would  be for  each country  or group  of  small countries  to run
an internal  scheme, perhaps drawing  on the experiences of  the UK  schemes.
Central  coordination  of all the approved  schemes by a European MGEQA  com-
mittee  would  ensure similar  standards and  facihtate  communication  between
the  separate countries.  Such a system could  prove  extremely  valuable  m the
sharing of  resources, experience, and techniques.
Acknowledgments
The  authors thank Walter  No11 of  the College  of  American  Pathologists and
Karen  Snow  of  the Human  Genetics Society of  Australasia  for  helpful  infor-
mation  on EQA  schemes in  other parts of  the world.
References
1.  Cassiman, J. J. (1994)  A  Quality  Control  Study  of  CFTR  Mutation  Screening  zn 40
Different  European  Laboratories  Newsletter  of  the  European  Commumty  Con-
certed  Action  for  Cystic  Fibrosis,  Autumn  1994  vol  2,  no  4  , pp.  7-10.
2.  Cuppens,  H.  and  Cassiman,  J. J. (1995)  A quality  control  study  of CFTR  mutation
screening  in  40  different  European  laboratories.  Eur  J.  Hum.  Genet.  3,235-245.

Advertisements

One comment on “Clinical Molecular Genetics

  1. Scientists create potent molecules aimed at treating muscular dystrophy…

    ScienceDaily (Feb. 22, 2012) — While RNA is an appealing drug target, small molecules that can actually affect its function have rarely been found. But now scientists from the Florida campus of The Scripps Research Institute have for the first time de….